
==== Front
Am J Physiol Regul Integr Comp Physiol
Am J Physiol Regul Integr Comp Physiol
AJPREGU
American Journal of Physiology - Regulatory, Integrative and Comparative Physiology
0363-6119
1522-1490
American Physiological Society Rockville, MD

38708546
R-00268-2023
R-00268-2023
10.1152/ajpregu.00268.2023
Research Article
Biological sex impacts oxidative stress in skeletal muscle in a porcine heat stress model
BIOLOGICAL SEX IMPACTS OXIDATIVE STRESS DURING HEAT STRESS
https://orcid.org/0009-0003-0071-3684
Rudolph Tori E. 1
https://orcid.org/0000-0001-8814-9130
Roths Melissa 1
Freestone Alyssa D. 1
Yap Sau Qwan 1
https://orcid.org/0000-0002-5616-6953
Michael Alyona 2
https://orcid.org/0000-0002-5205-5834
Rhoads Robert P. 3
White-Springer Sarah H. 4 5
Baumgard Lance H. 1
https://orcid.org/0000-0003-3797-7539
Selsby Joshua T. 1
1Department of Animal Science, https://ror.org/04rswrd78 Iowa State University , Ames, Iowa, United States
2Department of Vet Diagnostic & Production Animal Med, Iowa State University , Ames, Iowa, United States
3School of Animal Sciences, Virginia Tech , Blacksburg, Virginia, United States
4Department of Animal Science, Texas A&M University and Texas A&M AgriLife Research , College Station, Texas, United States
5Department of Kinesiology and Sport Management, Texas A&M University , College Station, Texas, United States
Correspondence: J. T. Selsby (jselsby@iastate.edu).
1 6 2024
6 5 2024
6 5 2024
326 6 R578R587
30 11 2023
3 4 2024
25 4 2024
Copyright © 2024 The Authors.
2024
The Authors.
https://creativecommons.org/licenses/by/4.0/ Licensed under Creative Commons Attribution CC-BY 4.0. Published by the American Physiological Society.

Oxidative stress contributes to heat stress (HS)-mediated alterations in skeletal muscle; however, the extent to which biological sex mediates oxidative stress during HS remains unknown. We hypothesized muscle from males would be more resistant to oxidative stress caused by HS than muscle from females. To address this, male and female pigs were housed in thermoneutral conditions (TN; 20.8 ± 1.6°C; 62.0 ± 4.7% relative humidity; n = 8/sex) or subjected to HS (39.4 ± 0.6°C; 33.7 ± 6.3% relative humidity) for 1 (HS1; n = 8/sex) or 7 days (HS7; n = 8/sex) followed by collection of the oxidative portion of the semitendinosus. Although HS increased muscle temperature, by 7 days, muscle from heat-stressed females was cooler than muscle from heat-stressed males (0.3°C; P < 0.05). Relative protein abundance of 4-hydroxynonenal (4-HNE)-modified proteins increased in HS1 females compared with TN (P = 0.05). Furthermore, malondialdehyde (MDA)-modified proteins and 8-hydroxy-2′-deoxyguanosine (8-OHdG) concentration, a DNA damage marker, was increased in HS7 females compared with TN females (P = 0.05). Enzymatic activities of catalase and superoxide dismutase (SOD) remained similar between groups; however, glutathione peroxidase (GPX) activity decreased in HS7 females compared with TN and HS1 females (P ≤ 0.03) and HS7 males (P = 0.02). Notably, HS increased skeletal muscle Ca2+ deposition (P = 0.05) and was greater in HS1 females compared with TN females (P < 0.05). Heat stress increased sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA)2a protein abundance (P < 0.01); however, Ca2+ ATPase activity remained similar between groups. Overall, despite having lower muscle temperature, muscle from heat-stressed females had increased markers of oxidative stress and calcium deposition than muscle from males following identical environmental exposure.

NEW & NOTEWORTHY Heat stress is a global threat to human health and agricultural production. We demonstrated that following 7 days of heat stress, skeletal muscle from females was more susceptible to oxidative stress than muscle from males in a porcine model, despite cooler muscle temperatures. The vulnerability to heat stress-induced oxidative stress in females may be driven, at least in part, by decreased antioxidant capacity and calcium dysregulation.

calcium
; climate change
; heat stroke
hyperthermia
; pig
; USDA | National Institute of Food and Agriculture (NIFA) 10.13039/100005825 2019-07859 Joshua T. SelsbyUSDA | National Institute of Food and Agriculture (NIFA) 10.13039/100005825 2022-67011-36636 Tori E. Rudolph
==== Body
pmcINTRODUCTION

With more frequent and severe heat events, heat stress (HS) is a present and mounting concern for public health and animal agriculture (1–4). Heat stress is physiologically distinct from both therapeutic hyperthermia and heat stroke, as the former may enhance muscle growth (5, 6), whereas the latter typically includes central nervous system dysfunction and can result in death (7). Currently, the pathological consequences of HS are poorly defined; a knowledge gap made even more critical as ∼70% of heat-related hospitalizations are due to HS (8, 9). In addition to threatening human health, HS negatively impacts agricultural production (10, 11), particularly as continued genetic selection for rapid growth has increased metabolic heat production, and therefore increased susceptibility to the negative effects of environmental heat (12). Productivity losses accrued following HS events are detrimental to agricultural economics, increase the environmental strain of production, and increasingly threaten global food security in the face of current and accelerating climate change (13, 14).

Oxidative stress and subsequent dysfunction are common sequela of environment-induced HS in skeletal muscle (15–20). This is notably divergent from the reported antioxidant effects of therapeutic hyperthermia (5, 6). Heat stress causes reduced mitochondrial function, mitochondrial remodeling, and alters markers of mitophagy in oxidative skeletal muscle (21–23). Loss of Ca2+ homeostatic control is regularly observed during muscle injury and disease (24–27) and may lead to mitochondrial Ca2+ sequestration (28, 29) and subsequent oxidative stress following impaired function of sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA). Indeed, SERCA function may be impaired due to thermal denaturation (30, 31) and oxidative modification (32), both of which are likely during HS. Importantly, Ca2+ dysregulation was causatively linked to mitochondrial dysregulation in a Caenorhabditis elegans HS model (33).

Recent data from our laboratory using a porcine heat-stress model suggest that females are more susceptible to skeletal muscle dysfunction than males (34, 35). Specifically, we had consistently identified oxidative stress and dysfunctional autophagy in skeletal muscle from females (15, 17, 18, 22, 36); however, in a recent investigation, males appeared resistant to these HS-induced changes (34). Nevertheless, the extent to which biological sex impacts oxidative stress following HS remains largely unknown. We hypothesized that muscle from males would better preserve redox balance following environment-induced HS than muscle from females.

MATERIALS AND METHODS

All procedures were reviewed and approved by the Institutional Animal Care and Use Committee at Iowa State University (No. 20-063). A more detailed study design and animal treatments have been previously described (35, 37). Briefly, 3-mo-old crossbred males (castrated male pigs; barrows) and prepubescent females (gilts) [36.8 ± 3.7 kg body wt (BW)] were housed in either thermoneutral (TN) conditions (20.8 ± 1.6°C; 62.0 ± 4.7% relative humidity; n = 8/sex) or exposed to constant HS (39.4 ± 0.6°C; 33.7 ± 6.3% relative humidity) for either 1 (HS1; n = 8/sex) or 7 days (HS7; n = 8/sex). After the environmental challenge, all pigs were euthanized via captive bolt and exsanguination. Immediately following euthanasia, an incision was made to expose the semitendinosus, and a calibrated digital thermometer (Taylor, Model 3519) was inserted into the muscle belly to measure muscle temperature (Tm). The contralateral semitendinosus was excised, and the red (oxidative) portion collected and frozen in liquid nitrogen or fixed in 4% paraformaldehyde for subsequent analyses.

Protein Extraction and Western Blot

Protein was extracted and Western blot analysis performed as previously described (34, 38) with minor modifications. Briefly, frozen muscle samples were homogenized in protein extraction buffer (10 mmol/L sodium phosphate and 2% SDS, pH = 7.0) containing protease inhibitor (Halt protease inhibitor cocktail, Thermo Fisher Scientific, Inc.) on ice, centrifuged for 15 min at 10,621 g at 4°C, and the resultant supernatant collected. Protein concentrations were determined colorimetrically using the Pierce bicinchoninic acid (BCA) Protein Assay (Thermo Fisher Scientific, Inc.). Samples were loaded onto precast 4–20% polyacrylamide gels (Bio-Rad, Hercules, CA), separated by molecular weight, and transferred onto nitrocellulose membranes. To confirm equal sample loading, all membranes were stained with Ponceau S stain (PonS) and imaged using the Azure Biosystems c600 imaging system. In all instances, total-lane optical density was similar for all groups indicating successful loading. Membranes were washed in Tris-buffered saline-Tween 20 (TBST) (50 mmol/L Tris·HCl, 150 mmol/L NaCl, 0.1% Tween 20, pH 7.4) to remove the PonS, blocked in 5% nonfat, dehydrated milk dissolved in TBST for 1 h, washed with TBST, and then incubated in primary antibody at 4°C overnight. Primary and secondary antibodies were diluted in TBST, unless otherwise noted, as follows: 4-hydroxynonenal (4-HNE) (Abcam, ab48506, primary 1:1,000 1% milk, secondary 1:2,000 2.5% dehydrated milk solution), calsequestrin [Santa Cruz Biotechnology (SCB), primary 1:500, secondary 1:1,000], CamKII (SCB, sc-5306, primary 1:500, secondary 1:1,000), catalase [Cell Signaling Technology (CST), No. 14097, primary 1:1,000, secondary 1:2,000], Cu/Zn superoxide dismutase (SOD1) (Abcam, ab13498, primary 1:1,000, secondary 1:2,000), glutathione peroxidase 1 (GPX1) (Abcam, ab22604, primary 1:1,000, secondary 1:2,000), malondialdehyde (MDA) (Abcam, ab27642, primary 1:1,000, secondary 1:2,000), Mn-superoxide dismutase (SOD2) (Abcam, ab13533, primary 1:1,000 milk, secondary 1:2,000), phospholamban (PLB) (Novus Biologicals, No. BP2-19807, primary 1:3,000 5% milk, secondary 1:3,000 5% milk), plasma membrane calcium ATPase (PMCA) (SCB, sc-271917, primary 1:500, secondary 1:1,000), sarcoendoplasmic calcium ATPase (SERCA2a) (CST, No. 9580, primary 1:1,000, secondary 1:2,000).

After overnight incubation, membranes were washed in TBST, rocked in secondary antibody for 1 h at room temperature, and washed again in TBST. Membranes were then rocked in enhanced chemiluminescence (Bio-Rad, Hercules, CA), and the resultant protein bands were detected using the Azure Biosystems c600 imaging system. The captured bands were quantified using the AzureSpot Software with automated band detection.

Oxidative Stress

8-Isoprostane is produced by oxidation of phospholipids by reactive oxygen species. The 8-isoprostane competitive ELISA was used to measure free 8-isoprostane within samples (Cayman Cat. No. 516351). Approximately 50 mg frozen muscle tissue was homogenized in extraction buffer (50 mM sodium phosphate, 1 mM EDTA, pH = 7.0) to assess 8-isoprostane concentration. This assay is a competitive ELISA between 8-isoprostane and an 8-isoprostane-acetylcholinesterase (AChe) conjugate. The reaction between the AChe and Ellman’s reagent produces a color and absorbs at 420 nm. The amount of color produced is inversely proportional to the amount of free 8-isoprostane present (expressed in pg/mL).

Protein carbonyl concentration was determined spectrophotometrically using the Cayman Protein Carbonyl Colorimetric Assay Kit (Cat. No. 10005020). Briefly, ∼50 mg of frozen muscle samples were homogenized in phosphate buffer (50 mM sodium phosphate, 1 mM EDTA, pH = 7.0), centrifuged for 15 min at 10,000 g at 4°C, supernatant collected, and protein concentration determined. All samples were normalized to a protein concentration of 2.7 mg/mL, and the assay was preformed per manufacturer’s instructions. Protein carbonyl content is expressed in nmol/mg.

To assess DNA damage, DNA was isolated from ∼20 mg of powdered muscle tissue using the DNeasy blood and tissue kit (Qiagen, Cat. No. 69504) according to manufacturer’s instructions. DNA concentration and purity were determined using a Nanodrop Spectrophotometer and quality assured by 260/280 nm ratio. DNA damage was assessed using a qPCR-based method as previously described (39). The assay is dependent on a structural modification to the template DNA, which limits restriction enzyme (RE) digestion. Reaction mixes were made for the Taq1 restriction digest and undigested controls. The Taq1 reaction mix contained 10 µL iTaq Univer SYBR Green master mix (Bio-Rad), 2 µL forward and 2 µL reverse primers at a concentration of 4 mM, 1 µL Taq1 RE, and 3 µL water, for a total volume of 20 µL. Reaction mix for the undigested control contained the same components without the addition of the Taq1, and water volume was adjusted accordingly. Target primer sequences for a mitochondrial and nuclear gene are provided in Table 1. The cycling parameters were as follows: 95°C for 5 min, 15 s at 95°C for denaturation, and 30 s at 60°C for annealing and elongation for 40 cycles. Melting curves were inspected to confirm amplification of a single product. DNA damage frequency was calculated as 2−(CT Taq1 – CT undigested).

Table 1. qPCR primer sequences

Target Gene	Forward Primer	Reverse Primer	
ND1	CACAACACAAGAGCACATTTG	CGTGGGTATGATGCTCGGATTCA	
Ndufa9	CCTGCTTCTGCAGGTGTTTAC	GTTATGCATTGAGTGTCTGAAGGCC	

We also assessed DNA damage by measuring 8-hydroxy-2′-deoxyguanosine (8-OHdG) via ELISA (Cayman Cat. No. 589320) according to the manufacturer’s instructions. Briefly, DNA was diluted in nuclease-free water and digested with Nuclease P1 and alkaline phosphatase to a final concentration of 6 ng/µL before preforming the assay. Absorbance was read at 420 nm and DNA damage was expressed in pg/mL.

Enzymatic Activities

Catalase activity (nmol/min/mL) was measured using a Catalase Assay Kit (Cayman Chemical, Cat. No. 707002) according to the manufacturer’s instructions. Briefly, 25–50 mg frozen tissue was homogenized in phosphate buffer (50 mM sodium phosphate, 1 mM EDTA, pH 7.0). The formation of formaldehyde from the reaction of catalase and methanol in the presence of hydrogen peroxide was measured spectrophotometrically at 540 nm.

Glutathione peroxidase (GPX) activity was measured according to the manufacturer’s instructions (Cayman, Cat. No. 703102). Approximately 30 mg of frozen tissue was homogenized in Tris·HCl buffer (50 mM Tris·HCl, 5 mM EDTA, 1 mM DTT, pH 7.5), and all samples were diluted to 4 µg/µL. The rate of reduced absorbance at 340 nm is directly proportional to sample GPX activity (expressed as μmol/min/mL).

Total SOD activity was measured colorimetrically from 30 mg of muscle tissue homogenized in HEPES buffer (20 mM HEPES buffer, 1 mM EGTA, 210 mM mannitol, 70 mM sucrose, pH = 7.2) (Cayman Cat. No. 706002). Absorbance at 440 nm was determined using a microplate reader (Bio-Tek, Winooski, VT). Total SOD activity was expressed as U/mL/mg of protein.

Abundance of reduced (GSH) and oxidized glutathione (GSSG) were measured via targeted metabolomic analysis. Tissue preparation and a detailed protocol have been previously described (40, 41). Briefly, frozen skeletal muscle samples were lyophilized overnight before bead mill homogenization in ice-cold methanol:acetonitrile:water extraction buffer containing a mixture of internal standards. Homogenates were centrifuged for 10 min at 21,000 g, and the resultant metabolite extracts were transferred to autosampler vials and dried. Dried metabolite extracts were reconstituted in methoxyamine (MOX) in anhydrous pyridine, vortexed for 5 min, and heated for 1 h at 60°C. N,O-bis(trimethylsilyl)trifluoroacetamide (TMS) was added to each sample. Samples were analyzed on a Thermo Q Exactive hybrid quadrupole Orbitrap mass spectrometer. Acquired LC-MS data were processed by Thermo Scientific TraceFinder.1 software, and metabolites were identified based on the University of Iowa Metabolomics Core facility standard-confirmed, inhouse library. NOREVA was used for signal drift correction (42). Data were normalized to total ion signals and MetaboAnalyst 4.0 was used for further statistical processing and visualization (43).

Calcium ATPase Activity

Ca2+ ATPase activity (nmol/min/mL) was measured colorimetrically through inorganic phosphorus production using a Ca2+-ATPase Activity Assay Kit (Elabscience, Cat. No. E-BC-K212-M) according to manufacturer’s instructions. Briefly, ∼30 mg frozen tissue was homogenized in normal saline (0.9% NaCl) centrifuged for 15 min at 10,000 g, supernatant collected, and protein concentration determined. The optical density was measured at 660 nm using a microplate reader. Ca2+ ATPase activity was expressed as U/g of protein.

Histological Analysis

The oxidative portion of the semitendinosus was fixed in 4% paraformaldehyde overnight and stored in 70% EtOH. Fixed tissues were embedded in paraffin, cut in 4-µm sections, and stained with hematoxylin and eosin (H&E) or Alizarin red (ARS). Before staining, H&E slides were deparaffinized in xylene, whereas ARS slides were deparaffinized in xylenes (Fisher Scientific, Cat. No. AC422685000). Both sets of slides were then rehydrated in EtOH and then rinsed in running water for 1 min. H&E staining was performed according to standard techniques and were dehydrated and cleared in a series of EtOH and xylene washes. For ARS, after slides were deparaffinized and rehydrated, slides were exposed to 2% Alizarin red (pH 4.16) for 2 min, dipped 20 times in acetone, dipped 20 times in a 1:1 acetone-xylene solution, and rinsed in three consecutive 1-min baths of xylenes. All slides were air-dried and mounted with cover slips using Permount Mounting Medium and sealed with nail polish. For H&E images, the entire muscle cross-section on the slide was subjectively evaluated by a boarded veterinary anatomic pathologist under blinded conditions. For ARS, five random images at ×20 magnification were taken for each section under blinded conditions. All images were objectively measured with OpenLab (Improvision) to quantify areas of Ca2+ deposition using density slicing and are expressed as a percentage of the total cross-sectional area.

Statistical Analysis

Sample size was estimated using differences in biochemical outcomes in our previous work utilizing a porcine HS model (22, 34, 38). Normality was assessed in all measures using the Shapiro–Wilk test. Data that were not normally distributed were log transformed before statistical testing. All data were analyzed using the proc MIXED procedure in SAS version 9.4 (SAS Inst. Inc., Cary, NC). The model consisted of main effects of environment, sex, and an environment × sex interaction. Preplanned contrasts were utilized to evaluate the effects of environment within a sex (i.e., TN male vs. HS1 male) and sex within an environment (i.e., HS1 male vs. HS1 female). Data are presented in figures as least square means ± SE. Statistical significance was considered as P < 0.05.

RESULTS

A detailed analysis of the physiological response to this heat intervention has been previously reported (35). Briefly, heat exposure elevated rectal temperature in males (40.4 vs. 39.4°C) and females (40.3 vs. 39.2°C) following 1 day of HS. After 7 days of HS, pigs of both sexes had elevated rectal temperature compared with pre-HS values (males: 40.4 vs. 39.4°C; females: 40.0 vs. 39.2°C); however, rectal temperature from females was decreased compared with HS7 males (P < 0.05; 0.4°C) and compared with HS1 females (P < 0.05; 0.3°C).

Environment-induced HS increased Tm compared with TN (P < 0.0001), and males had higher Tm (P < 0.01) compared with females (Fig. 1A). Specifically, HS1 and HS7 male muscle temperature was 40.9°C and 40.6°C, whereas TN males were 40.0°C (P < 0.01). Similarly, skeletal muscle from HS1 and HS7 females was 40.8°C and 40.4°C, and TN females had a muscle temperature of 39.8°C (P < 0.01). Muscle temperature between HS1 males and females was similar; however, Tm was lower following 7 days of HS compared with 1 day (P < 0.05) in both males and females. Finally, after 7 days of HS, Tm was 0.25°C greater in males than females (P < 0.05; Fig. 1A). Despite elevations in muscle temperature caused by HS, muscle histopathological injury following H&E staining was not apparent (Fig. 1, B–G).

Figure 1. Heat stress (HS) differentially increases muscle temperature (Tm) but does not induce histopathological changes in males and females. A: muscle temperature increased following 1 (HS1) and 7 days of HS (HS7); however, Tm was reduced by 7 days compared with 1 day, and females were lower than males at HS7. B–G: hematoxylin and eosin (H&E) representative images from males and female oxidative skeletal muscle. Data are shown as least square means ± SE (n = 7–8/group). Significant main effects are indicated as text. Significant differences between male groups [thermoneutral (TN)M, HS1M, HS7M] are indicated by different uppercase letters (P < 0.05). Significant differences between female groups (TNF, HS1F, HS7F) are indicated by different lowercase letters (P < 0.05). *Significant difference between males and females within an environmental treatment (P < 0.05).

To assess oxidative stress, we quantified markers of oxidative damage to lipids, proteins, and nucleic acids. Relative protein abundance of MDA- and 4-HNE-modified proteins did not differ by main effects of sex, environment, or the interaction (Fig. 2A). Heat-stressed males remained similar to TN males for both MDA- and 4-HNE-modified proteins. However, preplanned contrasts showed relative MDA-modified proteins were increased by 45% in HS7 females compared with TN females (P = 0.02). In addition, HS1 females had elevated 4-HNE modified proteins compared with TN females (22%; P = 0.05). Free 8-isoprostane (Fig. 2C) and protein carbonyls (Fig. 3) were similar between groups.

Figure 2. Assessment of lipid oxidation in oxidative skeletal muscle from males and females following 1 (HS1) and 7 (HS7) days of heat stress (HS). A: relative protein abundance of malondialdehyde (MDA) and 4-hydroxynonenol (4-HNE) modified proteins was measured via Western blot analysis. Ponceau S stain (PonS) was used as a loading control. B: 8-isoprostane concentration was determined using a competitive ELISA (expressed as ng/mL). Values represent the least square means ± SE (n = 8/group). Significant main effects are indicated as text. Significant differences between female groups [thermoneutral (TN)F, HS1F, HS7F] are indicated by different lowercase letters (P < 0.05). *Significant difference between males and females within an environmental treatment (P < 0.05).

Figure 3. Heat stress (HS) does not increase protein carbonylation in male and female oxidative skeletal muscle. Protein carbonyls were assessed colorimetrically (expressed as nmol/mg). Data are shown as least square means ± SE (n = 7/group). HS1, 1 day of HS; HS7, 7 days of HS; TN, thermoneutral.

Mitochondrial and nuclear DNA damage was assessed following HS in males and females. Relative 8-OHdG concentration remained similar as a main effect of environment, sex, and the interaction; however, HS7 animals had a higher relative abundance of 8-OHdG than TN (12%; P = 0.05; Fig. 4A), which was primarily driven by the HS7 females as they were increased compared with TN females (20%; P = 0.05). With the use of a qPCR-based approach, neither nuclear nor mitochondrial DNA damage was apparent (Fig. 4, B and C).

Figure 4. Assessment of oxidative skeletal muscle DNA oxidative modification following 1 (HS1) and 7 days (HS7) of heat stress (HS) in males and females. A: relative 8-hydroxy-2'-deoxyguanisine (8-OHdG) concentration was measured via competitive ELISA. qPCR-based approach to assess nuclear (B) and mitochondrial oxidative (C) damage following 1 and 7 days of HS. Values represent the least square means ± SE (n = 6–8/group). Significant differences between female groups [thermoneutral (TN)F, HS1F, HS7F] are indicated by different lowercase letters (P < 0.05).

As antioxidants are crucial in maintaining and restoring redox balance, we measured protein abundance and activity of several antioxidants (Fig. 5A). There was a main effect of sex on catalase (P = 0.03), GPX1 (P = 0.01), and SOD1 (P = 0.01) abundance such that males had 17–28% more than females, but relative protein expression of antioxidant enzymes did not change as a main effect of environment or the environment × sex interaction. We observed decreased GPX1 protein abundance between HS7 females compared with HS1 females (P = 0.05), whereas male groups remained similar between groups. In addition, HS7 female GPX1 protein abundance was reduced 38% compared with HS7 males (P = 0.02).

Figure 5. Assessment of antioxidant enzymes following 1 (HS1) and 7 days (HS7) of heat stress (HS) in oxidative skeletal muscle from males and females. A: relative protein abundance of antioxidant enzymes following HS. Ponceau S stain (PonS) was used as a loading control. Enzymatic activity of catalase (nmol/min/mL) (B), total superoxide dismutase (SOD; U/mL) (C), and glutathione peroxidase (GPX; nmol/min/mL) (D) were measured. Peak intensity of reduced (GSH) (E) and oxidized glutathione (GSSG) (F) and the ratio of GSH:GSSG (G) are shown. Oxidized glutathione was not normally distributed and the data were log transformed before statistical analysis. A main effect of environment (P < 0.05) and/or sex (P < 0.05) is indicated. Values represent the least square means ± SE (n = 6–8/group). Significant main effects are indicated as text. Significant differences between male groups [thermoneutral (TN)M, HS1M, HS7M] are indicated by different uppercase letters (P < 0.05). Significant differences between female groups (TNF, HS1F, HS7F) are indicated by different lowercase letters (P < 0.05).

Enzymatic activities of catalase and SOD were similar between groups (Fig. 5, B and C). GPX activity had a main effect of environment (P = 0.03; Fig. 5D), which was driven primarily by the HS7 female group; however, there was no effect of sex or the environment × sex interaction. By 7 days of HS in females, GPX activity was reduced compared with TN females (44%; P = 0.03), HS1 females (54%; P = 0.02), and HS7 males (45%; P = 0.02), whereas all male groups remained similar.

Reduced glutathione (GSH) was not altered by environment or biological sex (Fig. 5E). Oxidized glutathione (GSSG) data were log transformed to achieve normal distribution and was reduced as a main effect of environment (P < 0.01; Fig. 5F). The reduction was driven by the HS males as HS1 and HS7 males were decreased compared with TN males (HS1-5%; P < 0.05; HS7-6%; P < 0.05), whereas females remained similar between groups. The GSH:GSSG ratio was increased as a main effect of environment (P = 0.05) driven by the HS males. Specifically, HS1 and HS7 males were increased 44% and 63% compared with TN males, respectively (P = 0.03; P < 0.01), whereas HS females remained similar to TN females (Fig. 5G).

Given the role Ca2+ homeostasis plays in oxidative stress and overall muscle health, we assessed Ca2+ deposition via histological staining. We discovered an increase in Ca2+ deposition in heat-stressed skeletal muscle compared with TN (P = 0.05; Fig. 6, A–G). Specifically, HS1 females had greater skeletal muscle Ca2+ deposition than TN females (P = 0.02), HS7 females remained similar to TN and HS1 females, whereas Ca2+ deposition in males remained similar between all groups.

Figure 6. Heat stress increases calcium deposition in oxidative skeletal muscles of females. A: average percent alizarin red stain (ARS)-positive area was increased following 1 (HS1) day of heat stress (HS) in female but not male oxidative skeletal muscle. B–G: representative images from ARS stain. Values represent the least square means ± SE (n = 7–8/group). Significant differences between female groups [thermoneutral (TN)F, HS1F, HS7F] are indicated by different lowercase letters (P < 0.05). Areas of calcium deposition are marked with black arrow (↑).

Given the alterations in Ca2+ homeostasis, we examined the Ca2+ pumps, PMCA, and SERCA2a, and the Ca2+ handling proteins, calsequestrin, and CamKII. PMCA did not have a main effect of environment, sex, or the interaction (Fig. 7A). There was a main effect of environment (P < 0.01) and sex (P < 0.01) on SERCA2a protein abundance, such that abundance was increased following HS and males had more SERCA2a relative protein abundance than females (Fig. 7B). In addition, relative abundance of SERCA2a dimer, indicative of SERCA2a oxidative modification (44), had a main effect of sex (P = 0.05) such that males had greater relative protein abundance than females. There was also an environment × sex interaction (P = 0.02) as females had increased SERCA2a dimer protein abundance following HS, whereas males remained similar between groups (Fig. 7B). Despite alterations in protein abundance in PMCA and SERCA2a, Ca2+ ATPase activity remained similar between groups (Fig. 7C). Phospholamban (PLB), a SERCA2a inhibitor, exists in several forms. The PLB monomer was increased as a main effect of environment (P = 0.02). The main effect was primarily driven by HS females as both HS1 and HS7 females were elevated compared with TN (P = 0.02 and P < 0.01, respectively; Fig. 7D). Of note, TN males had more PLB relative protein abundance than TN females (P = 0.02). Furthermore, PLB bound to SERCA2a (45) was neither impacted by environment nor sex (Fig. 7D). Calsequestrin and CamKII remained similar between groups (Fig. 7E).

Figure 7. Calcium regulatory proteins were assessed following 1 (HS1) and 7 days (HS7) of heat stress (HS) in oxidative skeletal muscle from males and females. Relative protein abundance of Ca2+ pumps plasma membrane calcium ATPase (PMCA) (A) and sarco(endo)plasmic reticulum Ca2+ ATPase (SERCA)2a (B) full-length protein and dimer were assessed. C: Ca2+ ATPase activity was measured (expressed as U/g protein). D: phospholamban (PLB), a SERCA2 inhibitor, was assessed in its monomeric and SERCA2-bound form. E: Ca2+ handling proteins calsequestrin and CamKII were also measured. Ponceau S stain (PonS) was used as a loading control. Values represent the least square means ± SE (n = 7–8/group). Significant main effects are indicated as text. Significant differences between male groups [thermoneutral (TN)M, HS1M, HS7M] are indicated by different uppercase letters (P < 0.05). Significant differences between female groups (TNF, HS1F, HS7F) are indicated by different lowercase letters (P < 0.05). *Significant difference between males and females within an environmental treatment (P < 0.05).

DISCUSSION

Prolonged exposure to high environmental temperatures can result in a multisystemic stress that threatens human health and efficient agricultural production (10, 46). Oxidative stress is commonly induced by HS in skeletal muscle (15, 18, 47, 48), as well as other tissues (49–51). Recent data from our laboratory suggest that females may be more susceptible to skeletal muscle oxidative stress than males during HS (34); however, the extent to which oxidative stress differs between males and females following HS remains largely unknown. In the study presented herein, we discovered that skeletal muscle from females may be more susceptible to oxidative stress than skeletal muscle from males following HS in a porcine HS model. Furthermore, this may be due, at least in part, to compromised Ca2+ homeostatic control and reduced antioxidant capacity.

Pathologies such as muscle atrophy, cardiac ischemia-reperfusion, type II diabetes, and Duchenne muscular dystrophy (DMD) share Ca2+ dysregulation as a common feature, which has been causatively linked to impaired mitochondrial function and oxidative stress (24, 52). Consistent with this notion, we observed increased skeletal muscle Ca2+ deposits in heat-stressed skeletal muscle, particularly in females. Although clearly increased, the extent of calcium deposition following HS is mild, particularly when compared with muscle pathologies such as DMD (53). Nevertheless, these data raise the exciting possibility that Ca2+ dysregulation is a mediator of HS-induced oxidative stress. Our working model of skeletal muscle HS-mediated pathology is initiated by a loss of Ca2+ control, followed by an excess of cytosolic and mitochondrial Ca2+, and subsequent slowing and uncoupling of the electron transport chain (ETC). Using these tissues, we previously discovered that mitochondrial function was more negatively impacted by HS in muscle from females than from males and that HS caused sex-specific alterations of ETC complex function, as females relied more on complex I and males had a greater reliance on complex II (21). When mitochondrial membrane potential is altered, ostensibly by excess Ca2+, complex I is more susceptible to e− leak and superoxide production. Consistent with this notion, markers of oxidative stress were only increased in skeletal muscle from females.

The Ca2+ pump, SERCA2a, moves Ca2+ from the cytoplasm into the sarcoplasmic reticulum (SR). Calcium-induced Ca2+-ATPase activity and maximal Ca2+ ATPase activity have been shown to decrease following HS, in vitro, at temperatures of ∼40–41°C compared with 37°C (30, 54). In the current experiment, muscle temperature following HS was ∼40.4–40.9°C, which we note is suspiciously close to the aforementioned temperature that caused impaired function, raising the possibility of decreased SERCA2a function in muscles considered herein. In addition to thermal denaturation, SERCA2a appears to be particularly susceptible to oxidative modification, which alters pump capacity and performance (32). Oxidative modification of SERCA2a can result in protein dimerization (44), which was increased following HS in muscle from females, but not males, and is consistent with our findings of increased oxidative stress in muscles from females. Despite the changes in skeletal muscle temperature and oxidative injury, total Ca2+ ATPase activity was similar between groups. Although this was surprising, as we noted SERCA2a protein abundance was increased following 7 days of HS in muscle from both sexes, it is reasonable to suggest this elevation in protein abundance is a compensatory mechanism to maintain SERCA activity under HS conditions. Indeed, such a change may reflect cellular underpinnings of acclimation. Moreover, while a detailed exploration of the SERCA interactome was beyond the scope of this investigation, aside from phospholamban, another intriguing possibility is maintenance of SERCA activity via interaction with sarcolipin and/or myoregulin, among other proteins (54). We are not aware of previous work exploring the role of SERCA during a hyperthermic stress; however, SERCA activity appears to be increased during hypothermia and is an important contributor to nonshivering thermogenesis (55–57). Ultimately, preservation of Ca2+ ATPase activity discovered herein makes SERCA2a dysregulation an unlikely mechanism driving Ca2+ dysregulation, despite the potential for thermal denaturation and oxidative modification. This leads us to suspect that proteins associated with Ca2+ release from the SR, such as ryanodine receptors, may be contributing to excess sarcoplasmic Ca2+ during HS.

Slowing of the ETC drives electron leakage, and subsequent production of reactive oxygen species (ROS), which can modify lipids, DNA, and proteins. Of the macromolecules, lipids, particularly polyunsaturated fatty acids, are especially susceptible to free radical attack and oxidative modification (58). Consistent with previous findings from our laboratory (15, 34), in this investigation, 4-HNE- and MDA-modified proteins increased with 1 and 7 days of HS, respectively, in muscle from females, but not males. Furthermore, 8-OHdG is a marker of oxidative modification to DNA (59) and has been previously reported to be increased in skeletal muscle following HS (20). In this investigation, we discovered increased relative 8-OHdG concentration between TN and HS females, whereas males remained similar between groups.

To better understand the preservation of redox balance in muscle from males and a shift to a pro-oxidant state in skeletal muscle from females, we probed several antioxidants. Superoxide dismutase converts superoxide into hydrogen peroxide (H2O2), and catalase and GPX reduce H2O2 to H2O. Furthermore, GPX also reduces lipid hydroperoxides through the conversion of GSH to GSSG. An imbalance in antioxidant activity between SODs and catalase and/or GPX may promote oxidative stress via increased cellular H2O2 (60, 61). Indeed, in females, while SOD activity is maintained with HS, the approximate 50% reduction in GPX activity may contribute to a pro-oxidant intracellular environment in muscle from females.

Glutathione is a nonprotein thiol and cellular redox regulator, and the ratio of GSH:GSSG is frequently used as a marker of redox status (62–64). In this investigation, HS caused a reduction in GSSG in males, which led to an increased GSH:GSSG ratio, and is associated with maintenance of redox balance (65). Although the elevation in GSH:GSSG was driven by lowered GSSG rather than increased GSH, oxidative stress was not apparent in HS males, consistent with an elevated ratio (66–68). The mechanism underlying the reduction in GSSG in HS males remains unknown; however, we speculate the maintenance of GSH levels is due, in part, to glutathione reductase activity, which converts GSSG back to GSH. This ratio may be further supported by alterations in purine metabolism (69, 70); however, the interrogation thereof was beyond the scope of this investigation.

Perspectives and Significance

With global temperatures and the frequency of severe heat events increasing, heat stress is a current and growing threat to human health and efficient animal production worldwide. It has been well established that HS induces oxidative stress in a variety of tissues, including skeletal muscle. The data presented herein indicate that biological sex is a key mediator of HS-mediated changes as we discovered evidence supporting a role of Ca2+ dysregulation in heat-stressed muscles was more notable in muscle from females than from males. Moreover, muscle from females had more oxidative injury than muscle from males, even though muscles from females were cooler than males. These data raise the possibility that biological sex plays an underlying role in pathologies caused by a changing environment and should be considered in the development and application of countermeasures in the context of human medicine and agricultural production. To better appreciate the impact of biological sex on these outcomes we are eager to assess skeletal muscle from intact males and in females at various stages of the estrus cycle in future investigations.

DATA AVAILABILITY

The data that support the study findings are available upon request.

GRANTS

This work was supported in part by US Department of Agriculture Grants 2019-07859 (to J.T.S) and 2022-67011-36636 (to T.E.R).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

R.P.R., S.H.W.-S., L.H.B., and J.T.S. conceived and designed research; T.E.R., M.R., A.D.F., S.Q.E.Y., A.M., L.H.B., and J.T.S. performed experiments; T.E.R., S.Q.E.Y., A.M., and J.T.S. analyzed data; T.E.R., A.M., and J.T.S. interpreted results of experiments; T.E.R. prepared figures; T.E.R. and J.T.S. drafted manuscript; T.E.R., M.R., A.D.F., S.Q.E.Y., A.M., R.P.R., S.H.W.-S., L.H.B., and J.T.S. edited and revised manuscript; T.E.R., M.R., A.D.F., S.Q.E.Y., A.M., R.P.R., S.H.W.-S., L.H.B., and J.T.S. approved final version of manuscript.
==== Refs
REFERENCES

1. McGregor GR, Vanos JK. Heat: a primer for public health researchers. Public Health 161 : 138–146, 2018. doi:10.1016/j.puhe.2017.11.005. 29290376
2. Nawab A, Ibtisham F, Li G, Kieser B, Wu J, Liu W, Zhao Y, Nawab Y, Li K, Xiao M, An L. Heat stress in poultry production: mitigation strategies to overcome the future challenges facing the global poultry industry. J Therm Biol 78 : 131–139, 2018. doi:10.1016/j.jtherbio.2018.08.010. 30509629
3. Baumgard LH, Rhoads RP Jr. Effects of heat stress on postabsorptive metabolism and energetics. Annu Rev Anim Biosci 1 : 311–337, 2013. doi:10.1146/annurev-animal-031412-103644. 25387022
4. Khatana SAM, Eberly LA, Nathan AS, Groeneveld PW. Projected change in the burden of excess cardiovascular deaths associated with extreme heat by midcentury (2036–2065) in the contiguous United States. Circulation 148 : 1559–1569, 2023. doi:10.1161/CIRCULATIONAHA.123.066017. 37901952
5. Selsby JT, Rother S, Tsuda S, Pracash O, Quindry J, Dodd SL. Intermittent hyperthermia enhances skeletal muscle regrowth and attenuates oxidative damage following reloading. J Appl Physiol (1985) 102 : 1702–1707, 2007. doi:10.1152/japplphysiol.00722.2006. 17110516
6. Selsby JT, Dodd SL. Heat treatment reduces oxidative stress and protects muscle mass during immobilization. Am J Physiol Regul Integr Comp Physiol 289 : R134–R139, 2005. doi:10.1152/ajpregu.00497.2004. 15761186
7. Bouchama A, Knochel JP. Heat stroke. N Engl J Med 346 : 1978–1988, 2002. doi:10.1056/NEJMra011089. 12075060
8. Harduar Morano L, Watkins S. Evaluation of diagnostic codes in morbidity and mortality data sources for heat-related illness surveillance. Public Health Rep 132 : 326–335, 2017. doi:10.1177/0033354917699826. 28379784
9. Abdelmoety DA, El-Bakri NK, Almowalld WO, Turkistani ZA, Bugis BH, Baseif EA, Melbari MH, AlHarbi K, Abu-Shaheen A. Characteristics of heat illness during Hajj: a cross-sectional study. Biomed Res Int 2018 : 5629474, 2018. doi:10.1155/2018/5629474. 29662887
10. St-Pierre NR, Cobanov B, Schnitkey G. Economic losses from heat stress by US Livestock Industries. J Dairy Sci 86 : E52–E77, 2003. doi:10.3168/jds.S0022-0302(03)74040-5.
11. Pollmann DS. Seasonal effects on sow herds: industry experience and management strategies (Abstract). J Anim Sci 88 : 9, 2010.
12. Brown-Brandl TM, Hayes MD, Xin H, Nienaber JA, Li H, Eigenberg RA, Stinn JP, Shepherd T. Heat and moisture production of modern swine. ASHRAE Trans 120 : 469–489, 2014.
13. Nardone A, Ronchi B, Lacetera N, Ranieri MS, Bernabucci U. Effects of climate changes on animal production and sustainability of livestock. Livestock Sci 130 : 57–69, 2010. doi:10.1016/j.livsci.2010.02.011.
14. West JW. Effects of heat-stress on production in dairy cattle. J Dairy Sci 86 : 2131–2144, 2003. doi:10.3168/jds.S0022-0302(03)73803-X. 12836950
15. Montilla SIR, Johnson TP, Pearce SC, Gardan-Salmon D, Gabler NK, Ross JW, Rhoads RP, Baumgard LH, Lonergan SM, Selsby JT. Heat stress causes oxidative stress but not inflammatory signaling in porcine skeletal muscle. Temperature (Austin) 1 : 42–50, 2014. doi:10.4161/temp.28844. 27583280
16. Ganesan S, Summers CM, Pearce SC, Gabler NK, Valentine RJ, Baumgard LH, Rhoads RP, Selsby JT. Short-term heat stress causes altered intracellular signaling in oxidative skeletal muscle. J Anim Sci 95 : 2438–2451, 2017. doi:10.2527/jas.2016.1233. 28727070
17. Ganesan S, Brownstein AJ, Pearce SC, Hudson MB, Gabler NK, Baumgard LH, Rhoads RP, Selsby JT. Prolonged environment-induced hyperthermia alters autophagy in oxidative skeletal muscle in Sus scrofa. J Therm Biol 74 : 160–169, 2018. doi:10.1016/j.jtherbio.2018.03.007. 29801622
18. Volodina O, Ganesan S, Pearce SC, Gabler NK, Baumgard LH, Rhoads RP, Selsby JT. Short-term heat stress alters redox balance in porcine skeletal muscle. Physiol Rep 5 : e13267, 2017. doi:10.14814/phy2.13267. 28455453
19. Mujahid A, Sato K, Akiba Y, Toyomizu M. Acute heat stress stimulates mitochondrial superoxide production in broiler skeletal muscle, possibly via downregulation of uncoupling protein content. Poult Sci 85 : 1259–1265, 2006. doi:10.1093/ps/85.7.1259. 16830867
20. Huang C, Jiao H, Song Z, Zhao J, Wang X, Lin H. Heat stress impairs mitochondria functions and induces oxidative injury in broiler chickens. J Anim Sci 93 : 2144–2153, 2015. doi:10.2527/jas.2014-8739. 26020310
21. Wesolowski LT, Semanchik PL, Simons JL, Rudolph TE, Roths M, Freestone AD, Rhoads RP, Baumgard LH, Selsby JT, White-Springer SH. Heat stress increases mitochondrial complex I capacity in female pigs but favors reliance on complex II in males. FASEB J 36 : R5245, 2022. doi:10.1096/fasebj.2022.36.S1.R5245.
22. Brownstein AJ, Ganesan S, Summers CM, Pearce S, Hale BJ, Ross JW, Gabler N, Seibert JT, Rhoads RP, Baumgard LH, Selsby JT. Heat stress causes dysfunctional autophagy in oxidative skeletal muscle. Physiol Rep 5 : e13317, 2017. doi:10.14814/phy2.13317. 28646096
23. Yu T, Ferdjallah I, Elenberg F, Chen SK, Deuster P, Chen Y. Mitochondrial fission contributes to heat-induced oxidative stress in skeletal muscle but not hyperthermia in mice. Life Sci 200 : 6–14, 2018. doi:10.1016/j.lfs.2018.02.031. 29499282
24. Avila G. Disturbed Ca2+ homeostasis in muscle-wasting disorders. Adv Exp Med Biol 1088 : 307–326, 2018. doi:10.1007/978-981-13-1435-3_14. 30390258
25. Conte E, Camerino GM, Mele A, De Bellis M, Pierno S, Rana F, Fonzino A, Caloiero R, Rizzi L, Bresciani E, Ben Haj Salah K, Fehrentz J-A, Martinez J, Giustino A, Mariggiò MA, Coluccia M, Tricarico D, Lograno MD, De Luca A, Torsello A, Conte D, Liantonio A. Growth hormone secretagogues prevent dysregulation of skeletal muscle calcium homeostasis in a rat model of cisplatin-induced cachexia. J Cachexia Sarcopenia Muscle 8 : 386–404, 2017. doi:10.1002/jcsm.12185. 28294567
26. Müller M, Ahumada-Castro U, Sanhueza M, Gonzalez-Billault C, Court FA, Cárdenas C. Mitochondria and calcium regulation as basis of neurodegeneration associated with aging. Front Neurosci 12 : 470, 2018. doi:10.3389/fnins.2018.00470. 30057523
27. Vallejo-Illarramendi A, Toral-Ojeda I, Aldanondo G, López de Munain A. Dysregulation of calcium homeostasis in muscular dystrophies. Expert Rev Mol Med 16 : e16, 2014. doi:10.1017/erm.2014.17. 25293420
28. Zhou J, Dhakal K, Yi J. Mitochondrial Ca2+ uptake in skeletal muscle health and disease. Sci China Life Sci 59 : 770–776, 2016. doi:10.1007/s11427-016-5089-3. 27430885
29. Contreras L, Drago I, Zampese E, Pozzan T. Mitochondria: the calcium connection. Biochim Biophys Acta 1797 : 607–618, 2010. doi:10.1016/j.bbabio.2010.05.005. 20470749
30. Schertzer JD, Green HJ, Tupling AR. Thermal instability of rat muscle sarcoplasmic reticulum Ca2+-ATPase function. Am J Physiol Endocrinol Physiol 283 : E722–E728, 2002. doi:10.1152/ajpendo.00204.2002. 12217889
31. Senisterra GA, Huntley SA, Escaravage M, Sekhar KR, Freeman ML, Borrelli M, Lepock JR. Destabilization of the Ca2+-ATPase of sarcoplasmic reticulum by thiol-specific, heat shock inducers results in thermal denaturation at 37°C. Biochemistry 36 : 11002–11011, 1997. doi:10.1021/bi9711590. 9283092
32. Squier TC. Oxidative stress and protein aggregation during biological aging. Exp Gerontol 36 : 1539–1550, 2001. doi:10.1016/s0531-5565(01)00139-5. 11525876
33. Momma K, Homma T, Isaka R, Sudevan S, Higashitani A. Heat-induced calcium leakage causes mitochondrial damage in Caenorhabditis elegans body-wall muscles. Genetics 206 : 1985–1994, 2017. doi:10.1534/genetics.117.202747. 28576866
34. Rudolph TE, Mayorga EJ, Roths M, Rhoads RP, Baumgard LH, Selsby JT. The effect of Mitoquinol (MitoQ) on heat stressed skeletal muscle from pigs, and a potential confounding effect of biological sex. J Therm Biol 97 : 102900, 2021. doi:10.1016/j.jtherbio.2021.102900. 33863453
35. Rudolph TE, Roths M, Freestone AD, Rhoads RP, Baumgard LH, Selsby JT. The contribution of biological sex to heat stress-mediated outcomes in growing pigs. Animal 18 : 101168, 2023. doi:10.1016/j.animal.2024.101168. 38762992
36. Ganesan S, Pearce SC, Gabler NK, Baumgard LH, Rhoads RP, Selsby JT. Short-term heat stress results in increased apoptotic signaling and autophagy in oxidative skeletal muscle in Sus scrofa. J Therm Biol 72 : 73–80, 2018. doi:10.1016/j.jtherbio.2018.01.003. 29496018
37. Rudolph TE, Roths M, Freestone AD, Rhoads RP, Baumgard LH, Selsby JT. Heat stress alters hematological parameters in barrows and gilts. J Anim Sci. 2024: skae123, 2024. doi:10.1093/jas/skae123. 38706303
38. Rudolph TE, Roach CM, Baumgard LH, Ross JW, Keating AF, Selsby JT. The impact of Zearalenone on heat-stressed skeletal muscle in pigs. J Anim Sci 100 : skac215, 2022. doi:10.1093/jas/skac215.35908787
39. Wang W, Scheffler K, Esbensen Y, Eide L. Quantification of DNA damage by real-time qPCR. Methods Mol Biol 1351 : 27–32, 2016. doi:10.1007/978-1-4939-3040-1_3. 26530672
40. Zhang Y, Taufalele PV, Cochran JD, Robillard-Frayne I, Marx JM, Soto J, Rauckhorst AJ, Tayyari F, Pewa AD, Gray LR, Teesch LM, Puchalska P, Funari TR, McGlauflin R, Zimmerman K, Kutschke WJ, Cassier T, Hitchcock S, Lin K, Kato KM, Stueve JL, Haff L, Weiss RM, Cox JE, Rutter J, Taylor EB, Crawford PA, Lewandowski ED, Des Rosiers C, Abel ED. Mitochondrial pyruvate carriers are required for myocardial stress adaptation. Nat Metab 2 : 1248–1264, 2020 [Erratum in Nat Metab 2: 1498, 2020]. doi:10.1038/s42255-020-00288-1. 33106689
41. Jiang J, Reho JJ, Bhattarai S, Cherascu I, Hedberg-Buenz A, Meyer KJ, Tayyari F, Rauckhorst AJ, Guo DF, Morgan DA, Taylor EB, Anderson MG, Drack AV, Rahmouni K. Endothelial BBSome is essential for vascular, metabolic, and retinal functions. Mol Metab 53 : 101308, 2021. doi:10.1016/j.molmet.2021.101308. 34303879
42. Li B, Tang J, Yang Q, Li S, Cui X, Li Y, Chen Y, Xue W, Li X, Zhu F. NOREVA: normalization and evaluation of MS-based metabolomics data. Nucleic acids Res 45 : W162–W170, 2017. doi:10.1093/nar/gkx449. 28525573
43. Chong J, Soufan O, Li C, Caraus I, Li S, Bourque G, Wishart DS, Xia J. MetaboAnalyst 4.0: towards more transparent and integrative metabolomics analysis. Nucleic Acids Res 46 : W486–W494, 2018. doi:10.1093/nar/gky310. 29762782
44. Wang Y, Bruce AT, Tu C, Ma K, Zeng L, Zheng P, Liu Y, Liu Y. Protein aggregation of SERCA2 mutants associated with Darier disease elicits ER stress and apoptosis in keratinocytes. J Cell Sci 124 : 3568–3580, 2011. doi:10.1242/jcs.084053. 22045735
45. MacLennan DH, Asahi M, Tupling AR. The regulation of SERCA-type pumps by phospholamban and sarcolipin. Ann N Y Acad Sci 986 : 472–480, 2003. doi:10.1111/j.1749-6632.2003.tb07231.x. 12763867
46. Haines A, Kovats RS, Campbell-Lendrum D, Corvalan C. Climate change and human health: impacts, vulnerability and public health. Public Health 120 : 585–596, 2006. doi:10.1016/j.puhe.2006.01.002. 16542689
47. Lu Z, He X, Ma B, Zhang L, Li J, Jiang Y, Zhou G, Gao F. Dietary taurine supplementation improves breast meat quality in chronic heat-stressed broilers via activating the Nrf2 pathway and protecting mitochondria from oxidative attack. J Sci Food Agric 99 : 1066–1072, 2019. doi:10.1002/jsfa.9273. 30014460
48. Mujahid A, Akiba Y, Toyomizu M. Acute heat stress induces oxidative stress and decreases adaptation in young white leghorn cockerels by downregulation of avian uncoupling protein. Poult Sci 86 : 364–371, 2007. doi:10.1093/ps/86.2.364. 17234852
49. Gu XH, Hao Y, Wang XL. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Poult Sci 91 : 790–799, 2012. doi:10.3382/ps.2011-01628. 22399716
50. Reith RR, Sieck RL, Grijalva PC, Swanson RM, Fuller AM, Diaz DE, Schmidt TB, Yates DT, Petersen JL. Transcriptome analyses indicate that heat stress-induced inflammation in white adipose tissue and oxidative stress in skeletal muscle is partially moderated by zilpaterol supplementation in beef cattle. J Anim Sci 100 : skac019, 2022. doi:10.1093/jas/skac019. 35079800
51. Xu D, Li B, Cao N, Li W, Tian Y, Huang Y. The protective effects of polysaccharide of Atractylodes macrocephala Koidz (PAMK) on the chicken spleen under heat stress via antagonizing apoptosis and restoring the immune function. Oncotarget 8 : 70394–70405, 2017. doi:10.18632/oncotarget.19709. 29050288
52. Bravo-Sagua R, Parra V, López-Crisosto C, Díaz P, Quest AF, Lavandero S. Calcium transport and signaling in mitochondria. Compr Physiol 7 : 623–634, 2017. doi:10.1002/cphy.c160013. 28333383
53. Hakim CH, Wasala NB, Pan X, Kodippili K, Yue Y, Zhang K, Yao G, Haffner B, Duan SX, Ramos J, Schneider JS, Yang NN, Chamberlain JS, Duan D. A five-repeat micro-dystrophin gene ameliorated dystrophic phenotype in the severe DBA/2J-mdx model of Duchenne muscular dystrophy. Mol Ther Methods Clin Dev 6 : 216–230, 2017. doi:10.1016/j.omtm.2017.06.006. 28932757
54. Fu M, Bombardier E, Gamu D, Tupling AR. Phospholamban and sarcolipin prevent thermal inactivation of sarco(endo)plasmic reticulum Ca2+-ATPases. Biochem J 477 : 4281–4294, 2020. doi:10.1042/BCJ20200346. 33111944
55. Robinson S, Hechter D, Almoumen F, Franck JPC. Sarcolipin (sln) and sarcoplasmic reticulum calcium ATPase pump (serca1) expression increase in Japanese medaka (Oryzias latipes) skeletal muscle tissue following cold challenge. Comp Biochem Physiol A Mol Integr Physiol 287 : 111534, 2024. doi:10.1016/j.cbpa.2023.111534. 37844835
56. Pani P, Swalsingh G, Pani S, Senapati U, Sahu B, Pati B, Rout S, Bal NC. Seasonal cold induces divergent structural/biochemical adaptations in different skeletal muscles of Columba livia: evidence for nonshivering thermogenesis in adult birds. Biochem J 480 : 1397–1409, 2023. doi:10.1042/BCJ20230245. 37622342
57. Periasamy M, Maurya SK, Sahoo SK, Singh S, Sahoo SK, Reis FCG, Bal NC. Role of SERCA pump in muscle thermogenesis and metabolism. Compr Physiol 7 : 879–890, 2017. doi:10.1002/cphy.c160030. 28640447
58. Xiao M, Zhong H, Xia L, Tao Y, Yin H. Pathophysiology of mitochondrial lipid oxidation: Role of 4-hydroxynonenal (4-HNE) and other bioactive lipids in mitochondria. Free Radic Biol Med 111 : 316–327, 2017. doi:10.1016/j.freeradbiomed.2017.04.363. 28456642
59. Hahm JY, Park J, Jang ES, Chi SW. 8-Oxoguanine: from oxidative damage to epigenetic and epitranscriptional modification. Exp Mol Med 54 : 1626–1642, 2022. doi:10.1038/s12276-022-00822-z. 36266447
60. Omar BA, McCord JM. The cardioprotective effect of Mn-superoxide dismutase is lost at high doses in the postischemic isolated rabbit heart. Free Radic Biol Med 9 : 473–478, 1990. doi:10.1016/0891-5849(90)90124-2. 2079227
61. Wenk J, Brenneisen P, Wlaschek M, Poswig A, Briviba K, Oberley TD, Scharffetter-Kochanek K. Stable overexpression of manganese superoxide dismutase in mitochondria identifies hydrogen peroxide as a major oxidant in the AP-1-mediated induction of matrix-degrading metalloprotease-1. J Biol Chem 274 : 25869–25876, 1999. doi:10.1074/jbc.274.36.25869. 10464329
62. Zitka O, Skalickova S, Gumulec J, Masarik M, Adam V, Hubalek J, Trnkova L, Kruseova J, Eckschlager T, Kizek R. Redox status expressed as GSH:GSSG ratio as a marker for oxidative stress in paediatric tumour patients. Oncol Lett 4 : 1247–1253, 2012. doi:10.3892/ol.2012.931. 23205122
63. Rebrin I, Sohal RS. Pro-oxidant shift in glutathione redox state during aging. Adv Drug Deliv Rev 60 : 1545–1552, 2008. doi:10.1016/j.addr.2008.06.001. 18652861
64. Calabrese V, Sultana R, Scapagnini G, Guagliano E, Sapienza M, Bella R, Kanski J, Pennisi G, Mancuso C, Stella AM, Butterfield DA. Nitrosative stress, cellular stress response, and thiol homeostasis in patients with Alzheimer’s disease. Antioxid Redox Signal 8 : 1975–1986, 2006. doi:10.1089/ars.2006.8.1975. 17034343
65. Owen JB, Butterfield DA. Measurement of oxidized/reduced glutathione ratio. Methods Mol Biol 648 : 269–277, 2010. doi:10.1007/978-1-60761-756-3_18. 20700719
66. Kaplowitz N, Aw TY, Ookhtens M. The regulation of hepatic glutathione. Annu Rev Pharmacol Toxicol 25 : 715–744, 1985. doi:10.1146/annurev.pa.25.040185.003435. 3890714
67. Garcia J, Han D, Sancheti H, Yap LP, Kaplowitz N, Cadenas E. Regulation of mitochondrial glutathione redox status and protein glutathionylation by respiratory substrates. J Biol Chem 285 : 39646–39654, 2010. doi:10.1074/jbc.M110.164160. 20937819
68. Sun R, Eriksson S, Wang L. Oxidative stress induced S-glutathionylation and proteolytic degradation of mitochondrial thymidine kinase 2. J Biol Chem 287 : 24304–24312, 2012. doi:10.1074/jbc.M112.381996. 22661713
69. Bakshi R, Zhang H, Logan R, Joshi I, Xu Y, Chen X, Schwarzschild MA. Neuroprotective effects of urate are mediated by augmenting astrocytic glutathione synthesis and release. Neurobiol Dis 82 : 574–579, 2015. doi:10.1016/j.nbd.2015.08.022. 26341543
70. Matsumura N, Kinoshita C, Bhadhprasit W, Nakaki T, Aoyama K. A purine derivative, paraxanthine, promotes cysteine uptake for glutathione synthesis. J Pharmacol Sci 151 : 37–45, 2023. doi:10.1016/j.jphs.2022.11.001. 36522121
