
==== Front
Am J Physiol Regul Integr Comp Physiol
Am J Physiol Regul Integr Comp Physiol
AJPREGU
American Journal of Physiology - Regulatory, Integrative and Comparative Physiology
0363-6119
1522-1490
American Physiological Society Rockville, MD

38586887
R-00240-2023
R-00240-2023
10.1152/ajpregu.00240.2023
Research Article
β-Cell-selective regulation of gene expression by nitric oxide
EFFECTS OF NITRIC OXIDE ON β-CELL GENE EXPRESSION
Naatz Aaron 1
Yeo Chay Teng 1
Hogg Neil 2
https://orcid.org/0000-0002-1134-4664
Corbett John A. 1
1Department of Biochemistry, Medical College of Wisconsin , Milwaukee, Wisconsin, United States
2Department of Biophysics, Medical College of Wisconsin , Milwaukee, Wisconsin, United States
Correspondence: J. A. Corbett (jcorbett@mcw.edu).
1 6 2024
8 4 2024
8 4 2024
326 6 R552R566
31 10 2023
7 3 2024
2 4 2024
Copyright © 2024 The Authors.
2024
The Authors.
https://creativecommons.org/licenses/by/4.0/ Licensed under Creative Commons Attribution CC-BY 4.0. Published by the American Physiological Society.

Nitric oxide is produced at low micromolar levels following the induction of inducible nitric oxide synthase (iNOS) and is responsible for mediating the inhibitory actions of cytokines on glucose-stimulated insulin secretion by islets of Langerhans. It is through the inhibition of mitochondrial oxidative metabolism, specifically aconitase and complex 4 of the electron transport chain, that nitric oxide inhibits insulin secretion. Nitric oxide also attenuates protein synthesis, induces DNA damage, activates DNA repair pathways, and stimulates stress responses (unfolded protein and heat shock) in β-cells. In this report, the time- and concentration-dependent effects of nitric oxide on the expression of six genes known to participate in the response of β-cells to this free radical were examined. The genes included Gadd45α (DNA repair), Puma (apoptosis), Hmox1 (antioxidant defense), Hsp70 (heat shock), Chop (UPR), and Ppargc1α (mitochondrial biogenesis). We show that nitric oxide stimulates β-cell gene expression in a narrow concentration range of ∼0.5–1 µM or levels corresponding to iNOS-derived nitric oxide. At concentrations greater than 1 µM, nitric oxide fails to stimulate gene expression in β-cells, and this is associated with the inhibition of mitochondrial oxidative metabolism. This narrow concentration range of responses is β-cell selective, as the actions of nitric oxide in non-β-cells (α-cells, mouse embryonic fibroblasts, and macrophages) are concentration dependent. Our findings suggest that β-cells respond to a narrow concentration range of nitric oxide that is consistent with the levels produced following iNOS induction, and that these concentration-dependent actions are selective for insulin-containing cells.

β-cell
; gene expression
; islet
; nitric oxide
;
; reactive nitrogen species
; HHS | NIH | National Institute of Allergy and Infectious Diseases (NIAID) 10.13039/100000060 AI044458 John A CorbettHHS | NIH | National Institute of Diabetes and Digestive and Kidney Diseases (NIDDK) 10.13039/100000062 DK052194 John A CorbettJDRF (JDRF International) 10.13039/100022690 3-SRA-2023-1281-S-B John A Corbett
==== Body
pmcINTRODUCTION

Insulin-secreting β-cells are selectively destroyed during the development of insulin-dependent type 1 diabetes (T1D) through an autoimmune process (1, 2) where autoreactive cytotoxic T lymphocytes are responsible for most of the killing (2–5). Although genetic factors contribute to the development of T1D, the low concordance rates for disease development in identical twins support a role for environmental factors in the initiation of β-cell damage in this autoimmune disease (6, 7). Proinflammatory cytokines, such as interleukin (IL)-1, are also believed to contribute to the loss of β-cells during disease induction as treatment of rodent and human islets with cytokines results in an inhibition of insulin secretion and the loss of islet-cell viability following prolonged exposures (8, 9). IL-1 is the primary mediator of damage in rat islets whereas a combination of IL-1 and interferon (IFN)-γ are required to attenuate the function and decrease the viability of human islets (10, 11). The mechanisms by which cytokines damage β-cells have been extensively characterized. They inhibit insulin secretion in a concentration- and time-dependent manner with the initial inhibition observed following a 5- to 8-h incubation and complete inhibition following an 18-h incubation (8, 12). The inhibition of insulin secretion correlates with a simultaneous loss of mitochondrial oxidative capacity (aconitase and complex 4 of the electron transport chain) (13–16). Nitric oxide, produced at low micromolar levels (1–3 µM), following inducible nitric oxide synthase (iNOS) expression, is responsible for the inhibition of mitochondrial oxidative metabolism and insulin secretion (13–15, 17, 18). Nitric oxide also induces DNA damage (19–21), attenuates protein synthesis (22), and activates stress responses such as the unfolded protein response (UPR) and heat shock (22–25). DNA damage caused by nitric oxide results in the activation of the DNA damage response (DDR), which can result in DDR-dependent caspase-3 cleavage and apoptotic cell death following prolonged exposures (26).

Although these inhibitory and destructive actions of cytokines are believed to participate in the loss of functional β-cell mass during the development of autoimmune diabetes (27), we believe that there are physiological roles for cytokine signaling in islets that have yet to be fully elucidated. Importantly, islets represent ∼1–2% of the wet weight of the pancreas, yet receive 20% of pancreatic blood flow (28). Although this is expected for an endocrine hormone producing micro-organ that controls whole body glucose metabolism, it also necessitates that β-cells are exposed to all components of blood, including pyrogenic cytokines such as IL-1 and TNF, which are greatly elevated during infection (29). This would suggest that β-cells are routinely exposed to high levels of proinflammatory cytokines during infection, yet most individuals do not develop diabetes following infection. Furthermore, the inhibitory actions of cytokines on insulin secretion and mitochondrial oxidative metabolism are reversible (30, 31) and β-cells maintain pathways that facilitate the repair of DNA damage (32–35). Also, iNOS-derived levels of nitric oxide attenuate DDR activation, insulinoma cell apoptosis, and picornavirus replication (36–38). The inhibitory actions of nitric oxide on DDR activation and virus replication are selective for β-cells as they are not observed in non-β-cell populations (36, 37, 39–41). These findings suggest that there are physiological roles for cytokine-signaling and cytokine-induced nitric oxide production by β-cells.

The purpose of this report is to begin the process of understanding the concentration- and time-dependent actions of nitric oxide on the de novo expression of genes that play important physiological roles in the response of β-cells to cytokines. Because many of the protective actions of nitric oxide are cell type selective, we examined the effects of nitric oxide on gene expression in insulinoma cells, rat islets, and non-β-cell populations including α-cells (αTC1), mouse embryonic fibroblast (MEF) cells, and mouse macrophages (RAW 264.7). We focused our studies on genes regulated by the 1) forkhead Box 1 (FoxO1) transcription factor, growth arrest, and DNA damage 45α (Gadd45α) and the proapoptotic factor p53 upregulated modulator of apoptosis (Puma) (35); 2) nuclear regulatory factor 2 (NRF2), heme oxygenase-1 (Hmox1); 3) heat shock response, heat shock protein 70 (Hsp70); 4) unfolded protein response, C/EBP homologous protein (Chop); and 5) transcriptional coactivator, peroxisome proliferator-activated receptor γ coactivator 1-α (Ppargc1α), which functions in mitochondrial biogenesis (42, 43). Overall, we show that β-cell expression of these genes is limited to a narrow steady-state concentration of nitric oxide between 0.5 and 1 µM. When supplied at concentrations greater than 1 μM, gene expression is delayed until the levels decrease back into this narrow range. Furthermore, these narrow concentration-dependent actions of nitric oxide are limited to insulin-producing cells. There are no delays in nitric oxide-dependent gene expression in non-β-cells at concentrations greater than 1 µM, and nitric oxide fails to stimulate the expression of several of the target genes in noninsulin-containing cells. These exciting findings provide experimental evidence supporting that there is a physiological range of nitric oxide production (∼0.5–1 µM, corresponding to iNOS-derived levels) that regulates gene expression in a β-cell-selective manner.

MATERIALS AND METHODS

Materials

(Z)-1-(N,N-Diethylamino)diazen-1-ium-1,2-diolate (DEA/NO) (No. 82100), (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) (No. 82110), and 2-(4-carboxyphenyl)-4,5-dihydro-4,4,5,5-tetramethyl-1H-imidazolyl-1-oxy-3-oxide (CPTIO) potassium salt (No. 81540) were purchased from Cayman Chemical (Ann Arbor, MI). RPMI 1640 medium, Dulbecco’s modified eagle medium (DMEM), trypsin, l-glutamine, penicillin, and streptomycin were purchased from Corning (Corning, NY). CMRL medium, sodium pyruvate, HEPES, and β-mercaptoethanol were from Thermo Fisher Scientific (Waltham, MA). Fetal bovine serum was obtained from Hyclone Laboratories (Logan, UT). INS 832/13 cells were a gift from Chris Newgard (Duke University, Durham, NC). RAW 264.7 cells were procured from the Washington University Tissue Culture Support Center (St. Louis, MO). MEF (CRL-2991) and αTC1 clone 6 (CRL-2934) cells were purchased through the American Type Culture Collection (Manassas, VA). Male Sprague-Dawley rats were purchased from Envigo (Indianapolis, IN).

Cell Culture

INS 832/13, MEF, αTC1, and RAW 264.7 cell lines were cultured at 37°C with 5% atmospheric CO2 as described previously (36, 38). Cells were detached from culture flasks with 0.05% trypsin in 0.53 mmol/L EDTA and plated at 500,000 cells/mL (INS 832/13, αTC1, and RAW 264.7) or 125,000 cells/mL (MEF) and cultured overnight. All cell types used in this study are routinely tested and are mycoplasma free.

Rat Islet Isolation

Islets were isolated from male Sprague-Dawley rats, cultured at 37°C with 5% atmospheric CO2 (44). Islets were dispersed into individual cells by trypsin digestion (45) and cultured for an additional 2 days before treatment. Animal care and procedures with rats were approved by the Institutional Animal Care and Use Committees at the Medical College of Wisconsin (A3102-01).

qPCR

RNA from whole cell lysates was isolated using the RNeasy mini kit (Qiagen, Valencia, CA) and treated with Turbo DNase (Thermo Fisher). After RNA incubation with oligo(dT)20 (Integrated DNA Technologies, Coralville, IA), first-strand cDNA synthesis was performed using Maxima H minus reverse transcriptase (Thermo Fisher). cDNA was treated with RNase H (New England Biolabs, Ipswich, MA). Quantitative real-time PCR using SsoFast EvaGreen supermix was run using the CFX96 Real Time System (Bio-Rad, Hercules, CA). Fold changes in gene expression were measured by the ΔΔCT method (46), with values normalized to Gapdh. Primers used for qPCR are shown in Table 1 and were purchased from Integrated DNA Technologies.

Table 1. qPCR primers

Gene	Species	Primer	Sequence 5′-3′	
Chop	Mouse/Rat	For
Rev	AAATAACAGCCGGAACCTGA
GGGATGCAGGGTCAAGAGTA	
Gadd45α	Mouse	For
Rev	GCAGAGTTCCCCAGCGAGGC
GCCCACCGTGTCCATCCTTTCG	
Gadd45α	Rat	For
Rev	GTGTGCTGGTGACGAACCCACAT
CCGTTCGGGGAATCACCGTCCG	
Gapdh	Mouse/Rat	For
Rev	GACATCAAGAAGGTGGTGAAGC
TCCAGGGTTTCTTACTCCTTGG	
Hmox1	Mouse	For
Rev	CTCGAGCATAGCCCGGAGCC
ATCCTGGGGCATGCTGTCGGG	
Hmox1	Rat	For
Rev	CGCCTCCAACCAGCGAGTGG
GGACATGCTGTCGAGCTGTGGG	
Hsp70	Mouse/Rat	For
Rev	CATGAAGCACTGGCCCTTCC
CGAAGATGAGCACGTTGCGC	
Ppargc1α	Mouse/Rat	For
Rev	AGTCCCATACACAACCGCAGTCG
GGGGAACCCTTGGGGTCATTTGG	
Puma	Mouse/Rat	For
Rev	GAAGAGCAACATCGACACCG
GGTGTAGGCACCTAGTTGGG	

Estimation of Steady-State Nitric Oxide Concentration

Steady-state nitric oxide concentrations released from the nitric oxide donor compounds DEA/NO and DPTA/NO were estimated using Gepasi 3.30 Biochemical Simulation software using calculations described by Mokry et al. (47). The first-order decay rates for DEA/NO and DPTA/NO at 37°C were 3.851 × 10−3·s−1 (t1/2 ∼3 min) and 6.418 × 10−5·s−1 (t1/2 ∼180 min), and moles of nitric oxide released per mole of donor compound were 1.5 (DEA/NO) and 2 (DPTA/NO), respectively (48). The oxygen concentration was fixed at 220 μM, with the rate of nitric oxide and oxygen reacting to form NO2 set to 2.4 × 106 M−2·s−1 (49). The rate used for reaction of nitric oxide with NO2 to form nitrite was 1.1 × 109 M−2·s−1 (50).

Measurement of Steady-State Levels of Nitric Oxide

A Sievers 280i NO analyzer (GE Analytical Instruments) was used to determine the steady-state nitric oxide concentrations released from DPTA/NO. DPTA/NO was added to prewarmed INS media that was kept at 37°C for the duration of the experiment. Immediately following donor addition, INS media was put under a stream of 5% CO2-95% air for 15 s and capped to maintain pH 7.4. Chemiluminescent signal (mV) was measured for each sample, followed by peak integration and area determination. Final nitric oxide concentrations were calculated based on a nitrite standard curve (51).

Cellular Bioenergetics

A Seahorse XFe96 analyzer (Agilent Technologies) was used to measure oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) in MEF (10,000 cells/well) and INS 832/13 (20,000 cells/well) as outlined previously (40). Extracellular flux measurements were made in DMEM that contained 5.5 mM glucose, 2 mM pyruvate, and 1 mM l-glutamine. Values were expressed as percent baseline according to each cell type.

Statistical Analysis

One-way ANOVA was performed for experimental results and statistical significance (P < 0.05) was determined using a Tukey’s multiple comparisons post hoc test.

RESULTS

Concentration-Dependent Effects of Exogenous Nitric Oxide Released from DEA/NO on β-Cell Gene Expression

Although nitric oxide, derived from iNOS, is known to mediate the inhibitory actions of cytokines (IL-1 and IFN-γ) on insulin secretion by rodent and human β-cells (11, 14, 20), much less is known about the regulation of genes whose expression is induced by this free radical. We have identified several genes whose expression is stimulated by nitric oxide and have recently confirmed their expression by single-cell RNAseq analysis of cytokine-treated mouse islets (52). Each of the genes examined are known to participate in the physiological responses of β-cells to cytokine-induced nitric oxide (24, 33, 35, 38, 53, 54). Initial experiments examined the time- (0–9 h) and concentration- (100–800 µM) dependent actions of nitric oxide generated from the nitric oxide donor DEA/NO on changes in gene expression of INS 832/13 cells. As shown in Fig. 1, DEA/NO stimulates the concentration-dependent mRNA accumulation of the DNA base excision repair (BER) gene Gadd45α, the proapoptotic gene Puma, the antioxidant Nrf2-dependent gene Hmox1 (Fig. 1, A–C), the heat shock response gene Hsp70, the unfolded protein response regulator Chop, and the mitochondrial biogenesis gene Ppargc1α (Fig. 1, D–F). For each of these genes, maximal mRNA accumulation was observed following a 3-h exposure to DEA/NO with the steady-state levels of each mRNA returning to near control levels by 9 h. Hmox1 and Hsp70 responded to all concentrations of DEA/NO examined, whereas Gadd45α, Puma, Chop, and Ppargc1α mRNA accumulation was observed in response to concentrations of 400 µM and 800 µM donor. DEA/NO has a short half-life (∼3 min) (48) and rapidly releases high levels of nitric oxide within minutes of treatment. The calculated steady-state nitric oxide concentrations are more than 10 µM early in the treatment (15 min) and fall to 1–2 µM following a 30-min incubation at each concentration (Fig. 1G). The calculated steady-state levels of nitric oxide fall below micromolar concentrations by 45 min (Fig. 1G, inset).

Figure 1. Concentration- and time-dependent effect of (Z)-1-(N,N-diethylamino)diazen-1-ium-1,2-diolate (DEA/NO) on gene expression in INS 832/13 cells. INS 832/13 cells were treated with DEA/NO for the indicated times and concentrations. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F). Calculated steady-state nitric oxide concentrations released from DEA/NO over 9 h (G) and during the first h (G, inset) are shown. Results are the means ± SE of three independent experiments (A–F).

To determine if there is a threshold level of nitric oxide that is required to stimulate gene expression, DEA/NO was preincubated in media for various times between 0 and 60 min to release nitric oxide before treatment of INS 832/13 cells. Using this approach, a 15-min preincubation of DEA/NO is equivalent to five half-lives of donor decay. As shown in Fig. 2, 800 μM DEA/NO was directly added to cells (0 min) or was preincubated (5, 15, 30, 60 min) in media and then added to INS 832/13 cells followed by three additional hours of culture. The cells were harvested, and steady-state mRNA levels of each target were determined by qPCR (Fig. 2, bar graph) and compared with the calculated concentrations of nitric oxide (Fig. 2, line graph). The direct addition of DEA/NO to INS 832/13 cells (0 min) stimulates an increase in the expression for all genes as seen previously in Fig. 1 (Fig. 2, A–F). After a 5-min decay period, or ∼2 half-lives of donor decay, there was a significant reduction in the accumulation of Gadd45α, Puma, Hsp70, Chop, and Ppargc1α mRNA when compared with the direct addition of DEA/NO (0 min). This occurs under conditions where the calculated steady-state nitric oxide concentration is expected to be ∼25 μM (Fig. 2, A and B, and D–F). After a 15-min decay of DEA/NO, there is a significant attenuation in the accumulation of each of the mRNAs except Hmox1, which accumulates to near-maximal levels. Also, and to a lesser extent, Hsp70 is still induced following a 15-min decay of DEA/NO (∼10-fold; Fig. 2D). After a 60-min pretreatment where the calculated steady-state concentration of nitric oxide falls below micromolar levels (∼0.3 μM, Fig. 1G, inset), DEA/NO does not stimulate mRNA accumulation of any of the genes examined. Overall, the findings presented in Figs. 1 and 2 indicate that heat shock/antioxidant gene expression is more responsive to nitric oxide than genes involved in DNA repair and stress responses, and that low micromolar levels of nitric oxide are required to stimulate new gene expression.

Figure 2. Time-dependent effect of decayed (Z)-1-(N,N-diethylamino)diazen-1-ium-1,2-diolate (DEA/NO) on nitric oxide-stimulated gene expression in INS 832/13 cells. DEA/NO (800 µM) was added to prewarmed INS media for 0, 5, 15, 30, or 60 min to release a portion of nitric oxide. After this decay period, the media was added to INS832/13 cell followed by a 3-h incubation. The cells were harvested and nitric oxide-stimulated mRNA accumulation of Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F) were evaluated by RT qPCR (left Y-axis). The steady-state concentrations of nitric oxide released from DEA/NO over 60 min were calculated (A–F, right Y-axis). Results are the means ± SE of three independent experiments (A–F). Statistically significant changes in mRNA accumulation compared with 0 min DEA/NO decay are indicated (*P < 0.05).

Concentration-Dependent Effects of Exogenous Nitric Oxide Released from DPTA/NO on β-Cell Gene Expression

Results presented in Figs. 1 and 2 suggest that low micromolar levels of nitric oxide are required for the induction of gene expression in β-cells; however, this approach was limited by the rapid rates of nitric oxide released from this short half-life donor. To address this limitation, a second nitric oxide donor, DPTA/NO, with a 3-h half-life was used (48). DPTA/NO provides for sustained release of nitric oxide in the low micromolar range or physiological concentrations that are produced in β-cells expressing iNOS (13, 14). INS 832/13 cells were treated with increasing concentrations of DPTA/NO from 50 to 400 μM for 3–24 h and mRNA accumulation for each of the six genes was determined by qPCR. At 50 µM, new gene expression in response to DPTA/NO is minimal, reaching a twofold or greater increase in Puma, Hmox1, Hsp70, and Chop mRNA following a 3-h incubation (Fig. 3, B–E). Increasing the concentration of DPTA/NO to 100 μM results in an increase in the mRNA accumulation of all genes examined in a time-dependent manner that is first apparent at 3 h and maximal at 6–9 h. The maximal fold increases in mRNA accumulation are as follows: Gadd45α, 3.5-fold; Puma, 10-fold; Hmox1, ∼40-fold; Hsp70, ∼100-fold; Chop, 6.5-fold; and Ppargc1α, 4.5-fold (Fig. 3, A–F). Increasing the concentration of DPTA/NO to 200 µM and 400 μM results in a delay in the induction of mRNA accumulation of all the genes as well as an increase in the incubation time required to stimulate maximal mRNA accumulation (Fig. 3, A–F); however, the maximal level of mRNA accumulation is similar for most of the genes examined except for the stress response genes Hsp70 and Chop. Hsp70 mRNA accumulation is concentration-dependent and maximal at 400 μM DPTA/NO, whereas Chop mRNA accumulation is maximal at 100 µM DPTA/NO and decreases with increasing concentrations of the donor (Fig. 3, D and E). Overall, these data suggest that there is a window of sustained steady-state production of nitric oxide in the high nanomolar to low micromolar range that is capable of stimulating gene expression in INS 832/13 cells.

Figure 3. Concentration- and time-dependent effect of (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) on gene expression in INS 832/13 cells. INS 832/13 cells were treated for 3 to 24 h with the indicated concentrations of DPTA/NO. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F). The calculated steady-state levels of nitric oxide released from DPTA/NO over 24 h are shown (G). The steady-state levels of nitric oxide released from DPTA/NO were measured using the NO analyzer following 0.5–18 h incubation in INS media (H). Results are the means ± SE of three independent experiments (A–F and H).

Two methods were used to gain insights into the amount of nitric oxide liberated by DPTA/NO. We estimated concentration of nitric oxide released by DPTA/NO using Gepasi 3.30 Biochemical Simulation (Fig. 3G) and measured the levels released by ozone-chemiluminescence using a Sievers nitric oxide analyzer (Fig. 3H). Overall, the calculated levels of nitric oxide were approximately three times higher than the directly measured levels, but the overall levels fall in the range generally associated with levels of nitric oxide produced following iNOS induction. Specifically, the steady-state concentration of nitric oxide produced in response to 50 μM DPTA/NO at 3 h was calculated to be ∼1–1.5 µM or measured to be ∼0.5 µM, and this concentration is sufficient to initiate mRNA accumulation for most of the genes examined. Increasing DPTA/NO to 100 µM results in the liberation of steady-state nitric oxide levels at 1.5–2.5 µM calculated or 0.5–0.7 µM measured, during the first 3 h of incubation. Increasing DPTA/NO levels to 200 µM and 400 µM results in steady-state levels of nitric oxide generation greater than ∼2.5 µM calculated or ∼0.8 µM measured during the first 3 h of incubation, or concentrations that appear to exceed the levels sufficient to support nitric oxide-dependent gene expression. As the incubation time is increased to 6 h and 9 h, the steady-state levels of nitric oxide that are released fall to levels (1.5–2.5 µM calculated or 0.5–1 µM measured) that can support gene expression.

Figure 4. Concentration- and time-dependent effect of (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) on gene expression in dispersed rat islet cells. Isolated rat islets were dispersed into individual cells and then treated for 3–24 h with the indicated concentrations of DPTA/NO. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F). Results are the means ± SE of three to five independent experiments.

Concentration- and Time-Dependent Induction of Gene Expression by DPTA/NO in Rat Islet Cells

Using a similar approach, the time- and concentration-dependent effects of DPTA/NO on gene expression were explored in primary dispersed rat islet cells (Fig. 4). Much like INS 832/13 cells, there is a less than twofold increase in the accumulation of mRNA for all genes examined in response to 50 μM DPTA/NO, except Hmox1 and Hsp70 (Fig. 4, A–F). Increasing the concentration of DPTA/NO results in an increase in the mRNA accumulation of each gene examined (Fig. 4, A–F). Although Puma and Chop mRNA accumulate following a 3-h incubation (Fig. 4, B and E), induction of Gadd45α, Hmox1, Hsp70, and Ppargc1α require a longer 6-h incubation with DPTA/NO at 100 µM and 200 µM to stimulate maximal mRNA accumulation (Fig. 4, A, C, D, and F). When DPTA/NO is provided at 400 μM, the accumulation of each of the mRNAs is delayed with maximal mRNA accumulation of Gadd45α (2.5-fold), Puma (∼4-fold), Hmox1 (∼13-fold), Chop (∼2.5-fold), and Ppargc1α (3.5-fold) occurring following an 18-h incubation (Fig. 4, A–C, E, and F). Hsp70 mRNA accumulation was concentration dependent with peak accumulation at 6 h and remained elevated following an 18-h incubation with 400 µM DPTA/NO (Fig. 4D). Like the response of INS 832/13 cells, these findings indicate that iNOS-derived physiological concentrations of nitric oxide (1.5–2.5 µM calculated or 0.5–1 µM measured) facilitate gene expression in primary islet cells.

Buffering Nitric Oxide Levels Using CPTIO

The results presented in Figs. 1–4 suggest that there is a narrow concentration window in which nitric oxide stimulates gene expression in β-cells. To confirm these surprising results, we devised a second approach to examine whether this narrow but physiologically relevant iNOS-derived level of nitric oxide controls gene expression in β-cells. We reasoned that it should be possible to buffer the level of nitric oxide released from high concentrations of DPTA/NO using increasing concentrations of the nitric oxide scavenger, CPTIO. In this experiment, INS 832/13 cells were treated for 6 h with 400 μM DPTA/NO in the presence or absence of increasing concentrations (50–400 μM) of CPTIO (Fig. 5). DPTA/NO at 400 µM fails to stimulate the accumulation of Gadd45α, Puma, Hmox1, Chop, or Ppargc1α mRNA in INS 832/13 cells following a 6-h incubation (Fig. 5, A–C, E, and F), consistent with the effects of 400 µM DPTA/NO shown in Fig. 3, A–F. Under these conditions, the steady-state levels of nitric oxide liberated from this donor exceed the levels necessary for the induction of gene expression in INS 832/13 cells (Figs. 3G and 4H). If this interpretation is correct, then it should be possible to scavenge nitric oxide produced by DPTA/NO to levels that allow for gene expression. CPTIO functions as a stoichiometric scavenger of nitric oxide (55), whereas DPTA/NO releases two molecules of nitric oxide per molecule of donor (48). In the presence of 200 µM and 400 µM CPTIO, DPTA/NO stimulates a twofold increase in Gadd45α, 4- to 7-fold increase in Puma, 15- to ∼25-fold increase in Hmox1, and 2- to 3-fold increase in Chop mRNA accumulation (Fig. 5, A–C, and E). Furthermore, DPTA/NO (400 µM) alone stimulates Hsp70 mRNA accumulation following a 6-h treatment, and this is increased to ∼250-fold when cotreated with 200 μM CPTIO (Fig. 5D). Ppargc1α mRNA accumulation is decreased to 0.5-fold of basal with 400 μM DPTA/NO treatment, and cotreatment with 200 μM CPTIO returned Ppargc1α mRNA levels to slightly higher than those observed under basal conditions (Fig. 5F). Overall, these results support a narrow concentration range of between 1.5 and 2.5 µM calculated or 0.5–1 µM measured in which nitric oxide stimulates gene expression in β-cells.

Figure 5. Effects of the nitric oxide scavenger 2-(4-carboxyphenyl)-4,5-dihydro-4,4,5,5-tetramethyl-1H-imidazolyl-1-oxy-3-oxide (CPTIO) on (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) stimulated gene expression in INS 832/13 cells. INS 832/13 cells were treated for 6 h with 400 μM DPTA/NO in the presence or absence of the indicated concentrations of CPTIO. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F). Results are the means ± SE of three independent experiments and statistically significant changes in mRNA accumulation compared with the levels determined following a 400-µM treatment with DPTA/NO are indicated (*P < 0.05).

Cell Type Specificity of Nitric Oxide-Dependent Gene Expression

We have recently identified several signaling cascades and metabolic pathways that are regulated by nitric oxide in a β-cell-selective manner (36, 39–41). To explore the cell type selectivity of nitric oxide on gene expression, the concentration- (50–400 μM) and time-dependent (0–12 h) effects of DPTA/NO on the accumulation of target gene mRNA were evaluated by qPCR in mouse embryonic fibroblasts (MEF). Much like INS 832/13 cells, 50 μM DPTA/NO has minimal effects on the mRNA accumulation of each of the six target genes examined (Fig. 6, A–F). At 200 and 400 µM DPTA/NO there is an ∼2-fold increase in Gadd45α, Puma, and Chop mRNA accumulation (Fig. 6, A, B, and E), whereas DPTA/NO does not stimulate Hsp70 or Ppargc1α mRNA accumulation at any of the concentrations examined (Fig. 6, D and F). In fact, 200 and 400 μM DPTA/NO decrease the accumulation of Hsp70 and Ppargc1α mRNA by ∼50% following a 12-h treatment (Fig. 6, D and F). The most responsive nitric oxide-dependent gene in MEF was Hmox1, where a 6-h incubation of 200 and 400 µM DPTA/NO stimulate a 7- and 10-fold increase, respectively (Fig. 6C). Unlike β-cells, there was no delay in expression of any of the genes examined following treatment with 200 and 400 µM DPTA/NO in MEF.

Figure 6. Concentration- and time-dependent effect of (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) on gene expression in mouse embryonic fibroblasts (MEF). MEF were treated with DPTA/NO for the indicated times and concentrations. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F). Results are the means ± SE of three independent experiments.

The time- and concentration-dependent effects of nitric oxide on gene expression in glucagon expressing αTC1 cells (Fig. 7) were also examined. DPTA/NO fails to stimulate Gadd45α and Ppargc1α mRNA accumulation under any of the conditions examined (Fig. 7, A and F); however, this nitric oxide donor stimulates Puma, Hmox1, and Hsp70 mRNA expression with a maximal increase of approximately 5-fold following a 6-h incubation for Puma, ∼15-fold following a 12-h incubation for Hmox1, and ∼700-fold following a 6-h incubation for Hsp70 (Fig. 7, B–D). The actions of nitric oxide on Hsp70 mRNA accumulation are concentration dependent and maximal at 400 µM (Fig. 7D), whereas Puma and Hmox1 mRNA accumulation were concentration dependent and maximal at 200 µM DPTA/NO (Fig. 7, B and C). In response to 50–400 µM DPTA/NO, there is a 3- to 4-fold increase in Chop mRNA accumulation that remains elevated for 12 h (Fig. 7E). Unlike insulin containing cells (Figs. 3 and 4), we did not observe a delay in the expression of these genes in glucagon expressing αTC1 cells at higher nitric oxide concentrations.

Figure 7. Concentration- and time-dependent effect of (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) on gene expression in αTC1 cells. αTC1 cells were treated with DPTA/NO for the indicated times and concentrations. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), Chop (E), and Ppargc1α (F). Results are the means ± SE of three independent experiments.

RAW 264.7 macrophages represent the third non-β-cell in which the concentration- and time-dependent effects of nitric oxide on gene expression were examined (Fig. 8). In macrophages, nitric oxide does not stimulate Hsp70 mRNA accumulation (Fig. 8D). Also, Ppargc1α mRNA accumulation in response to DPTA/NO is near or below the limit of detection of the assay (data not shown). In a concentration-dependent manner, DPTA/NO stimulates Gadd45α mRNA accumulation with maximal expression observed following 3–6 h exposure to 400 µM donor (Fig. 8A). Similarly, Hmox1 and Chop mRNA accumulation increases in a concentration-dependent manner with maximal expression in response to a 3-h incubation with 400 µM DPTA/NO (Fig. 8, C and E). DPTA/NO had minimal effects on the accumulation of Puma mRNA (Fig. 8B). Like MEF and αTC1 cells, we did not observe any delays in the expression of target genes like those observed for β-cells treated with DPTA/NO at concentrations above 200 µM (Figs. 3 and 4). These findings suggest that the concentration-dependent actions of nitric oxide on gene expression are more tightly controlled in a narrow concentration range in β-cells as compared with the response of nonendocrine cells and α-cells.

Figure 8. Concentration- and time-dependent effect of (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) on gene expression in RAW 264.7 cells. RAW 264.7 macrophages were treated with DPTA/NO for the indicated times and concentrations. The cells were harvested, and mRNA accumulation was determined by RT qPCR for Gadd45α (A), Puma (B), Hmox1 (C), Hsp70 (D), and Chop (E). Results are the means ± SE of three independent experiments.

Role of Intermediary Metabolism in Regulating Nitric Oxide-Dependent Gene Expression in β-Cells

We have recently identified several cellular pathways that are regulated by nitric oxide via its inhibitory actions on intermediary metabolism in a β-cell selective manner. We have shown that nitric oxide inhibits DDR signaling in insulinoma cells and isolated islets, and camptothecin-induced apoptosis of insulinoma cells by attenuating mitochondrial oxidation (26, 36), reducing ATP levels and inhibiting glucose uptake in β-cells (40). Inhibitors of mitochondrial oxidative metabolism function much like nitric oxide to attenuate each of these responses (41). To determine if the β-cell selective inhibition of gene expression at high concentrations of nitric oxide is associated with the inhibition of mitochondrial oxidative metabolism, we examined the effects of rotenone on gene expression in response to stimulatory concentrations of DPTA/NO. As expected, based on previous studies from our laboratory (40, 41), nitric oxide attenuates oxygen consumption (OCR) in a concentration-related manner in both INS 832/13 cells and MEF (Fig. 9A). MEF overcome this inhibition of mitochondrial oxidative metabolism by shifting to glycolysis for energy needs, as evidenced by increasing the extracellular acidification rate (ECAR; Fig. 9B). β-Cells lack this metabolic flexibility and fail to increase ECAR in response to inhibitors of mitochondrial oxidative metabolism (Fig. 9B). In fact, INS 832/13 cell ECAR decreases in response to rotenone (1 µM) and DPTA/NO at concentrations that limit OCR (200 and 400 µM), and we have previously attributed this action to decreases in ATP to levels that fall below the Km for ATP of glucokinase and result in an inhibition of glucose uptake (40, 41).

Figure 9. Effect of rotenone and (Z)-1-[N-(3-aminopropyl)-N-(3-ammoniopropyl)amino]diazen-1-ium-1,2-diolate (DPTA/NO) on mitochondrial respiration, glycolytic flux, and gene expression in mouse embryonic fibroblasts (MEF) and INS 832/13 cells. Intermediary oxidative metabolism was evaluated by extracellular flux analysis. Cells were treated at 15 min with the indicated concentrations of DPTA/NO or 1 µM rotenone, and the oxygen consumption rate (OCR, A) and extracellular acidification rate (ECAR, B) were determined after 120 min. The effects of rotenone on nitric oxide-stimulated gene expression in MEF and INS 832/13 cells were evaluated by RT qPCR. Cells were treated with stimulatory concentrations of DPTA/NO (200 µM, MEF, or 100 µM INS 832/13) for 3 h in the presence or absence of 1 µM rotenone, and mRNA accumulation of Gadd45α (C and F), Hmox1 (D and G), and Chop (E and H) was determined by RT qPCR. Results are the means ± SE of two to three (A and B) or three (C–H) independent experiments. Statistically significant changes in OCR and ECAR relative to untreated control for each cell type (A and B) or mRNA accumulation for DPTA/NO plus rotenone relative to DPTA/NO alone (C–H) are as indicated (*P < 0.05).

Consistent with the inhibition of mitochondrial oxidative metabolism as a mechanism by which 200 µM and 400 µM DPTA/NO fail to stimulate gene expression in β-cells after a 3-h incubation, rotenone (1 µM) attenuates DPTA/NO (100 µM) induced Gadd45α, Hmox1, and Chop expression by INS832/13 cells (Fig. 9, F–H). Rotenone does not attenuate DPTA/NO-stimulated expression of any of these genes in MEF (Fig. 9, C–E). Alone, rotenone increases Gadd45α and Chop mRNA accumulation independent of the actions of nitric oxide. These findings, which are consistent with the β-cell selective inhibitory actions of nitric oxide on DDR signaling and caspase 3 activation, suggest that high concentrations of nitric oxide (in excess of 1 µM measured or 2 µM calculated, Fig. 3, G and H) limit nitric oxide-dependent gene expression in a β-cell selective manner by a mechanism that is associated with the inhibition of mitochondrial oxidative metabolism.

DISCUSSION

In 1985, Nerup and coworkers (8) first showed that IL-1 inhibits insulin secretion in a time- and concentration-dependent manner and that prolonged incubations of 4–7 days results in islet degeneration. Green and coworkers (17) first showed that these inhibitory actions of IL-1 are mediated by nitric oxide. Inhibitors of iNOS prevent the damaging actions of cytokines on insulin secretion (11, 18), and islets isolated from iNOS-deficient mice are resistant to cytokine-induced islet-cell death (56). Glucose-stimulated insulin secretion requires an increase in the ATP/ADP ratio that occurs in response to the oxidation of glucose to CO2 (57, 58). Nitric oxide inhibits the Krebs cycle enzyme aconitase and complex 4 of the electron transport chain, events that result in a decrease in the ATP/ADP ratio causing an inhibition in insulin secretion (13–16). Nitric oxide also induces DNA damage (59) and together with the inhibition of mitochondrial oxidative metabolism, nitric oxide is believed to be responsible for the loss of β-cell function and viability in response to IL-1 (60).

Based on this work, it is generally believed that cytokines such as IL-1 initiate or contribute to the loss of β-cell mass during the development of autoimmune diabetes (27); however, there are several lines of evidence that have led us to challenge this hypothesis. Islets have the capacity to recover from the damaging actions of IL-1 treatment if the cytokine is removed by washing and the islets are cultured in the absence of IL-1 for 4 days (30). Importantly, the time to complete recovery of insulin secretion following a 24-h IL-1 treatment can be reduced from 4 days to 8 h by inhibiting NOS, and this recovery occurs in the presence of IL-1 (31). In addition, β-cells (rat and human) maintain a FoxO1-dependent DNA repair pathway that is activated by nitric oxide and that requires GADD45α expression (33–35). Nitric oxide is also a strong activator of both the UPR and heat shock response (24, 61). When these responses are activated in β-cells, they become refractory to cytokine signaling (25, 62). These findings support a potential mechanism by which nitric oxide can temporally limit the inhibitory and damaging actions of cytokines on β-cells and allow for functional recovery.

The goal of the current study was to determine the concentration-dependent actions of nitric oxide on the expression of genes encoding proteins that participate in the physiological response of β-cells to this oxidant. We focused on six genes, the FoxO1-dependent genes Gadd45α and Puma (35), the NRF2-dependent gene Hmox1, the stress response genes Hsp70 (heat shock) and Chop (unfolded protein response), and the master regulator of mitochondrial biogenesis Ppargc1α (43). The time- and concentration-dependent effects of nitric oxide supplied using the short half-life donor DEA/NO (∼3 min) and the longer half-life donor DPTA/NO (3 h) on the expression of each gene in INS 832/13 insulinoma, rat islets, αTC1 cells, MEF, and RAW 264.7 macrophages were examined. DEA/NO rapidly produces a bolus of nitric oxide (calculated to be ∼15 µM at 100 µM donor, and 45 µM when treated with 800 µM donor) that following 45 min of incubation results in steady-state levels of nitric oxide <1 µM. DPTA/NO releases nitric oxide at more physiological concentrations that were calculated to be ∼1 µM following a 3-h incubation with 50 µM DPTA/NO and ∼3.5 µM when supplied using 400 µM DPTA/NO. The calculated levels were higher than the levels directly measured using the NO analyzer, where we found that 50 µM DPTA/NO produces <0.5 µM nitric oxide following a 3-h incubation and >1 µM using 400 µM DPTA/NO.

Overall, we find that nitric oxide stimulates the expression of Gadd45α, Puma, Hmox1, and Ppargc1α in a narrow steady-state concentration range (∼0.5–1 µM measured, 1.5–2.5 µM calculated) in insulin-producing INS 832/13 cells and rat islets. Using donor concentrations that generate nitric oxide below the steady-state threshold, nitric oxide fails to stimulate gene expression. When nitric oxide is produced at steady-state levels above this threshold, the expression of each of these genes is temporally delayed until nitric oxide levels fall into this narrow concentration range. These unique findings are summarized in schematic fashion in Fig. 10. Furthermore, under conditions in which nitric oxide is produced at levels above the threshold, it is possible to scavenge this free radical using CPTIO and reduce the concentration to levels that fall within the threshold that facilitates gene expression (Fig. 5). This threshold action of nitric oxide appears to be selective for β-cells (Figs. 6, 7, and 8). DPTA/NO stimulates the concentration-dependent expression of Gadd45α in MEF and RAW 264.7 (Figs. 6A and 8A), Puma in MEF and αTC1 cells (Figs. 6B and 7B), and Hmox1 in all three cell types (Figs. 6C, 7C, and 8C). Ppargc1α mRNA was not stimulated by nitric oxide in MEF or αTC1 cells (Figs. 6F and 7F) and was below the detection limits in RAW 264.7 (negative data not shown).

Figure 10. Concentration-dependent actions of nitric oxide on gene expression in β-cells. A schematic diagram illustrating the concentration- and time-dependent effects of nitric oxide on gene expression in β-cells.

The expression of stress response genes (Hsp70 and Chop) in β-cells in response to nitric oxide was found to behave slightly different (Figs. 3 and 4). DPTA/NO stimulates the concentration-dependent increase in Hsp70 mRNA accumulation that is maximal between 9 and 12 h of treatment with 200 µM and 400 µM donor, respectively (Figs. 3D and 4D). Nitric oxide, a known UPR activator in β-cells, stimulates maximal Chop mRNA expression following a 6-h incubation with 100 and 200 µM DPTA/NO in INS 832/13 cells and rat islet cells, respectively (Figs. 3E and 4E). Increasing the concentration of DPTA/NO to 200 and 400 µM (INS 832/13) or 400 µM (rat islets) delayed the accumulation of Chop mRNA and decreased maximal stimulation (Figs. 3E and 4E). These findings indicate that nitric oxide activates UPR gene expression in β-cells when produced at steady-state calculated concentrations of 1.5–2.5 µM or measured concentrations of ∼0.5 µM, and that the dampening of Chop expression at higher nitric oxide concentrations suggests that the β-cell response to misfolded proteins may shift from the UPR toward a heat shock response with increasing concentrations of nitric oxide. In support of this possibility, Hsp70 mRNA increases ∼550-fold in INS 832/13 cells and ∼65-fold in dispersed rat islets after treatment with 400 μM DPTA/NO (Figs. 3D and 4D). We also observed cell-type specificity in the activation of stress responses. Although nitric oxide stimulated Chop mRNA accumulation in all cell types (Figs. 3, 4, 6, 7, and 8), the induction of the heat shock response appears to be an endocrine cell-selective event. Nitric oxide does not stimulate Hsp70 mRNA accumulation in MEF (fibroblast) or RAW 264.7 macrophages (Figs. 6 and 8); however, insulin and glucagon containing cells respond to nitric oxide with robust expression of Hsp70 (Figs. 3, 4, and 7). These findings are consistent with single-cell RNA-seq analysis of cytokine and nitric oxide stimulated changes in gene expression in dispersed mouse islet cells, where iNOS-derived nitric oxide increased Hsp70 mRNA in endocrine cells but failed to do so in nonendocrine cell populations (52).

Nitric oxide binds to heme-containing proteins (63) and has been shown to stimulate expression of NRF2-dependent genes, such as Hmox1 (64, 65). Once expressed, heme oxygenase (HO)-1 enzymatically degrades heme to biliverdin, ferrous iron, and carbon monoxide (66). In all cell types examined, including β-cells, nitric oxide stimulates Hmox1 mRNA accumulation (Figs. 3, 4, 6, 7, and 8). This ubiquitous expression of Hmox1 is consistent with the stabilization of NRF2 in response to numerous oxidants (67), which allows for NRF2 nuclear translocation, binding to antioxidant response elements (AREs), and transcription of antioxidant genes (68).

Nitric oxide inhibits mitochondrial function through disruption of iron-sulfur clusters of aconitase and complex IV of the electron transport chain by competing with oxygen binding (13–16). Despite its inhibitory actions on mitochondrial function, nitric oxide stimulates mitochondrial biogenesis (69), in part, by the increased expression of peroxisome proliferator-activated receptor gamma coactivator 1α, an important transcriptional coactivator that regulates genes involved in mitochondrial biogenesis (43, 53). We report that Ppargc1α gene expression is delayed in β-cells when nitric oxide is generated at calculated concentrations above 3 μM or measured concentrations of 1 µM (Figs. 3F and 4F). The delay of Ppargc1α expression at higher DPTA/NO concentrations (200 and 400 µM) correlates with an inhibition of mitochondrial oxidative metabolism and loss of ATP (39–41). The increased expression of Ppargc1α at concentrations of DPTA/NO that do not inhibit mitochondrial oxidative metabolism may function to protect mitochondria from higher concentrations of nitric oxide that limit oxidative metabolism, and/or may facilitate the recovery of metabolic function when the levels of nitric oxide fall below the concentrations that limit mitochondrial oxidative metabolism (31, 70).

Perspectives and Significance

It is well established that nitric oxide causes DNA damage in β-cells (33, 59), and we have shown that β-cells utilize the BER pathway gene, Gadd45α, to repair DNA damage in response to nitric oxide (34). Nitric oxide stimulates Gadd45α, in a FoxO1-dependent manner (35). FoxO1 is also required for nitric oxide-stimulated Puma expression in β-cells (35). Puma binds antiapoptotic Bcl-2 family members, allowing proapoptotic proteins such as Bax/Bak to initiate cytochrome C release from the mitochondria to activate caspases (71). Both Gadd45α and Puma mRNA accumulation were observed after a 6-h treatment of INS 832/13 cells with 100 μM DPTA/NO, and expression is delayed at higher nitric oxide concentrations (Fig. 3, A and B). We view these findings to suggest that β-cells are prepared for two responses. One is base excision repair of damaged DNA (Gadd45α) and subsequent recovery, or if the DNA damage is too extensive for repair, apoptosis (Puma). Although somewhat controversial in the literature, it has been our experience (33, 72) and that of others (56, 73, 74), that it is challenging to induce apoptosis in primary β-cells in response to cytokines or nitric oxide. In fact, nitric oxide inhibits apoptosis in insulinoma cells in response to apoptosis activators (36) or chemical endoplasmic reticulum (ER) stress inducers, such as tunicamycin (24).

Recently, we have shown that nitric oxide inhibits DDR signaling (ATM, ataxia telangiectasia mutated and ATR, ataxia telangiectasia and Rad3-related) by a mechanism that is associated with the inhibition of mitochondrial oxidative metabolism and decreases in cellular levels of ATP (39, 41). Nitric oxide reduces the concentrations of ATP in β-cells to levels that are 2-fold below the KmATP of glucokinase resulting in an inhibition in glucose uptake (40). The inhibitory actions of nitric oxide on glucose uptake are selective for β-cells (40, 41), which we believe functions as a physiologically relevant protective mechanism. In support of this hypothesis, we have shown that nitric oxide inhibits picornavirus replication in β-cells by attenuating mitochondrial oxidative metabolism (37, 75). Importantly, the inhibitory actions of nitric oxide on oxidative metabolism are completely reversible (31), and we hypothesize that the inhibition of mitochondrial oxidative metabolism by nitric oxide, while appearing to be a damaging action due to the inhibition of insulin secretion, may function as a protective host-defense mechanism limiting virus replication and attenuating β-cell death by apoptosis. At concentrations that do not inhibit mitochondrial oxidative metabolism (∼1.5–2.5 µM calculated or 0.5–1 µM measured) nitric oxide stimulates the expression of genes that participate in the recovery of metabolic and secretory function (Gadd45α, Ppargc1α), the defense against oxidant damage (Hmox1), and functions as an off switch limiting cytokine signaling by activating stress responses (evidenced by Hsp70 and Chop expression). We and others have shown that heat shock, and islets expressing the inducible heat shock protein HSP70 are resistant to cytokine signaling (25, 52, 62, 72, 76). These protective actions are stimulated by sustained production of nitric oxide at concentrations calculated to be ∼1.5–2.5 μM or measured levels of 0.5–1 µM, or iNOS-derived levels of nitric oxide (Fig. 10). When the concentration increases above these levels, nitric oxide inhibits mitochondrial oxidative metabolism and limits protective gene expression until the levels of this free radical dissipate into the stimulatory concentration range (Fig. 10). The concentration-dependence of nitric oxide-stimulated gene expression is a phenomenon that appears to be selective to β-cells and is associated with several protective responses that include the induction of DNA repair, the activation of mitochondrial biogenesis pathways, attenuation of virus replication, and the inhibition of β-cell apoptosis.

DATA AVAILABILITY

Data will be made available upon reasonable request.

GRANTS

This work was supported by the National Institute of Diabetes and Digestive and Kidney Diseases Grant R01DK052194 (to J.A.C.), by the National Institute of Allergy and Infectious Diseases Grant R01AI044458 (to J.A.C.), the Juvenile Diabetes Research Foundation Grant Key: 3-SRA-2023-1281-S-B, and gifts from the Scott Tilton Foundation and Forest County Potawatomi Foundation (to J.A.C.).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the authors.

AUTHOR CONTRIBUTIONS

A.N., C.T.Y., and J.A.C. conceived and designed research; A.N., C.T.Y., and N.H. performed experiments; A.N., N.H., and J.A.C. analyzed data; A.N., C.T.Y., and J.A.C. interpreted results of experiments; A.N. prepared figures; A.N. and J.A.C. drafted manuscript; A.N., C.T.Y., and J.A.C. edited and revised manuscript; A.N., C.T.Y., N.H., and J.A.C. approved final version of manuscript.

ACKNOWLEDGMENTS

The authors additionally thank Dr. Polly Hansen, Alyssa Gehant, and Jacob Bartosiak (Department of Biochemistry, Medical College of Wisconsin, Milwaukee, WI) and Dr. Agnes Keszler (Department of Biophysics, Medical College of Wisconsin, Milwaukee, WI) for assistance with nitric oxide determinations using the NO analyzer.
==== Refs
REFERENCES

1. Gepts W. Pathologic anatomy of the pancreas in juvenile diabetes mellitus. Diabetes 14 : 619–633, 1965. doi:10.2337/diab.14.10.619. 5318831
2. Atkinson MA, Mirmira RG. The pathogenic “symphony” in type 1 diabetes: a disorder of the immune system, beta cells, and exocrine pancreas. Cell Metab 35 : 1500–1518, 2023. doi:10.1016/j.cmet.2023.06.018. 37478842
3. Like AA, Weringer EJ, Holdash A, McGill P, Atkinson D, Rossini AA. Adoptive transfer of autoimmune diabetes mellitus in biobreeding/Worcester (BB/W) inbred and hybrid rats. J Immunol 134 : 1583–1587, 1985. 3968427
4. Wicker LS, Miller BJ, Mullen Y. Transfer of autoimmune diabetes mellitus with splenocytes from nonobese diabetic (NOD) mice. Diabetes 35 : 855–860, 1986. doi:10.2337/diab.35.8.855. 3525284
5. Bergman B, Haskins K. Autoreactive T-cell clones from the nonobese diabetic mouse. Proc Soc Exp Biol Med 214 : 41–48, 1997. doi:10.3181/00379727-214-44067. 9012359
6. Redondo MJ, Rewers M, Yu L, Garg S, Pilcher CC, Elliott RB, Eisenbarth GS. Genetic determination of islet cell autoimmunity in monozygotic twin, dizygotic twin, and non-twin siblings of patients with type 1 diabetes: prospective twin study. BMJ 318 : 698–702, 1999. doi:10.1136/bmj.318.7185.698. 10074012
7. Hyttinen V, Kaprio J, Kinnunen L, Koskenvuo M, Tuomilehto J. Genetic liability of type 1 diabetes and the onset age among 22,650 young Finnish twin pairs: a nationwide follow-up study. Diabetes 52 : 1052–1055, 2003. doi:10.2337/diabetes.52.4.1052. 12663480
8. Mandrup-Poulsen T, Bendtzen K, Nielsen JH, Bendixen G, Nerup J. Cytokines cause functional and structural damage to isolated islets of Langerhans. Allergy 40 : 424–429, 1985. doi:10.1111/j.1398-9995.1985.tb02681.x. 3901813
9. Mandrup-Poulsen T, Bendtzen K, Nerup J, Dinarello CA, Svenson M, Nielsen JH. Affinity-purified human interleukin I is cytotoxic to isolated islets of Langerhans. Diabetologia 29 : 63–67, 1986. doi:10.1007/BF02427283. 3514344
10. Thomas HE, Darwiche R, Corbett JA, Kay TW. Interleukin-1 plus γ-interferon-induced pancreatic β-cell dysfunction is mediated by β-cell nitric oxide production. Diabetes 51 : 311–316, 2002. doi:10.2337/diabetes.51.2.311. 11812737
11. Corbett JA, Sweetland MA, Wang JL, Lancaster JR, McDaniel ML. Nitric oxide mediates cytokine-induced inhibition of insulin secretion by human islets of Langerhans. Proc Natl Acad Sci USA 90 : 1731–1735, 1993. doi:10.1073/pnas.90.5.1731. 8383325
12. Hughes JH, Colca JR, Easom RA, Turk J, McDaniel ML. Interleukin 1 inhibits insulin secretion from isolated rat pancreatic islets by a process that requires gene transcription and mRNA translation. J Clin Invest 86 : 856–863, 1990. doi:10.1172/JCI114785. 2203826
13. Welsh N, Eizirik DL, Bendtzen K, Sandler S. Interleukin-1 β-induced nitric oxide production in isolated rat pancreatic islets requires gene transcription and may lead to inhibition of the Krebs cycle enzyme aconitase. Endocrinology 129 : 3167–3173, 1991. doi:10.1210/endo-129-6-3167. 1720090
14. Corbett JA, Lancaster JR, Sweetland MA, McDaniel ML. Interleukin-1 β-induced formation of EPR-detectable iron-nitrosyl complexes in islets of Langerhans. Role of nitric oxide in interleukin-1 β-induced inhibition of insulin secretion. J Biol Chem 266 : 21351–21354, 1991. 1657959
15. Corbett JA, Wang JL, Sweetland MA, Lancaster JR, McDaniel ML. Interleukin 1 β induces the formation of nitric oxide by β-cells purified from rodent islets of Langerhans. Evidence for the beta-cell as a source and site of action of nitric oxide. J Clin Invest 90 : 2384–2391, 1992. doi:10.1172/JCI116129. 1334975
16. Cleeter MW, Cooper JM, Darley-Usmar VM, Moncada S, Schapira AH. Reversible inhibition of cytochrome c oxidase, the terminal enzyme of the mitochondrial respiratory chain, by nitric oxide. Implications for neurodegenerative diseases. FEBS Lett 345 : 50–54, 1994. doi:10.1016/0014-5793(94)00424-2. 8194600
17. Southern C, Schulster D, Green IC. Inhibition of insulin secretion by interleukin-1 β and tumour necrosis factor-α via an l-arginine-dependent nitric oxide generating mechanism. FEBS Lett 276 : 42–44, 1990. doi:10.1016/0014-5793(90)80502-a. 2265709
18. Corbett JA, Wang JL, Hughes JH, Wolf BA, Sweetland MA, Lancaster JR, McDaniel ML. Nitric oxide and cyclic GMP formation induced by interleukin 1 β in islets of Langerhans. Evidence for an effector role of nitric oxide in islet dysfunction. Biochem J 287 : 229–235, 1992. doi:10.1042/bj2870229. 1384465
19. Delaney CA, Green MH, Lowe JE, Green IC. Endogenous nitric oxide induced by interleukin-1 β in rat islets of Langerhans and HIT-T15 cells causes significant DNA damage as measured by the 'comet' assay. FEBS Lett 333 : 291–295, 1993. doi:10.1016/0014-5793(93)80673-i. 8224196
20. Green IC, Cunningham JM, Delaney CA, Elphick MR, Mabley JG, Green MH. Effects of cytokines and nitric oxide donors on insulin secretion, cyclic GMP and DNA damage: relation to nitric oxide production. Biochem Soc Trans 22 : 30–37, 1994. doi:10.1042/bst0220030. 7515831
21. Wink DA, Kasprzak KS, Maragos CM, Elespuru RK, Misra M, Dunams TM, Cebula TA, Koch WH, Andrews AW, Allen JS. DNA deaminating ability and genotoxicity of nitric oxide and its progenitors. Science 254 : 1001–1003, 1991. doi:10.1126/science.1948068. 1948068
22. Curran RD, Billiar TR, Stuehr DJ, Hofmann K, Simmons RL. Hepatocytes produce nitrogen oxides from l-arginine in response to inflammatory products of Kupffer cells. J Exp Med 170 : 1769–1774, 1989. doi:10.1084/jem.170.5.1769. 2509627
23. Oyadomari S, Takeda K, Takiguchi M, Gotoh T, Matsumoto M, Wada I, Akira S, Araki E, Mori M. Nitric oxide-induced apoptosis in pancreatic beta cells is mediated by the endoplasmic reticulum stress pathway. Proc Natl Acad Sci USA 98 : 10845–10850, 2001. doi:10.1073/pnas.191207498. 11526215
24. Chambers KT, Unverferth JA, Weber SM, Wek RC, Urano F, Corbett JA. The role of nitric oxide and the unfolded protein response in cytokine-induced β-cell death. Diabetes 57 : 124–132, 2008. doi:10.2337/db07-0944. 17928398
25. Scarim AL, Heitmeier MR, Corbett JA. Heat shock inhibits cytokine-induced nitric oxide synthase expression by rat and human islets. Endocrinology 139 : 5050–5057, 1998. doi:10.1210/endo.139.12.6366. 9832444
26. Oleson BJ, Broniowska KA, Schreiber KH, Tarakanova VL, Corbett JA. Nitric oxide induces ataxia telangiectasia mutated (ATM) protein-dependent γH2AX protein formation in pancreatic β cells. J Biol Chem 289 : 11454–11464, 2014. doi:10.1074/jbc.M113.531228. 24610783
27. Mandrup-Poulsen T. The role of interleukin-1 in the pathogenesis of IDDM. Diabetologia 39 : 1005–1029, 1996. doi:10.1007/BF00400649. 8877284
28. Jansson L, Hellerström C. Glucose-induced changes in pancreatic islet blood flow mediated by central nervous system. Am J Physiol Endocrinol Metab 251 : E644–E647, 1986. doi:10.1152/ajpendo.1986.251.6.E644. 3538897
29. Lundgren M, Darnerud PO, Blomberg J, Friman G, Ilbäck NG. Sequential changes in serum cytokines reflect viral RNA kinetics in target organs of a coxsackievirus B infection in mice. J Clin Immunol 29 : 611–619, 2009. doi:10.1007/s10875-009-9294-8. 19430896
30. Comens PG, Wolf BA, Unanue ER, Lacy PE, McDaniel ML. Interleukin 1 is potent modulator of insulin secretion from isolated rat islets of Langerhans. Diabetes 36 : 963–970, 1987. doi:10.2337/diab.36.8.963. 3297891
31. Corbett JA, McDaniel ML. Reversibility of interleukin-1 beta-induced islet destruction and dysfunction by the inhibition of nitric oxide synthase. Biochem J 299 : 719–724, 1994. doi:10.1042/bj2990719. 7514870
32. Rosales AL, Cunningham JM, Bone AJ, Green IC, Green MH. Repair of cytokine-induced DNA damage in cultured rat islets of Langerhans. Free Radic Res 38 : 665–674, 2004. doi:10.1080/10715760410001697609. 15453631
33. Hughes KJ, Chambers KT, Meares GP, Corbett JA. Nitric oxides mediates a shift from early necrosis to late apoptosis in cytokine-treated β-cells that is associated with irreversible DNA damage. Am J Physiol Endocrinol Metab 297 : E1187–E1196, 2009. doi:10.1152/ajpendo.00214.2009. 19738038
34. Hughes KJ, Meares GP, Chambers KT, Corbett JA. Repair of nitric oxide-damaged DNA in beta-cells requires JNK-dependent GADD45α expression. J Biol Chem 284 : 27402–27408, 2009. doi:10.1074/jbc.M109.046912. 19648647
35. Hughes KJ, Meares GP, Hansen PA, Corbett JA. FoxO1 and SIRT1 regulate β-cell responses to nitric oxide. J Biol Chem 286 : 8338–8348, 2011. doi:10.1074/jbc.M110.204768. 21196578
36. Oleson BJ, Broniowska KA, Naatz A, Hogg N, Tarakanova VL, Corbett JA. Nitric oxide suppresses β-cell apoptosis by inhibiting the DNA damage response. Mol Cell Biol 36 : 2067–2077, 2016. doi:10.1128/MCB.00262-16. 27185882
37. Stafford JD, Shaheen ZR, Yeo CT, Corbett JA. Inhibition of mitochondrial oxidative metabolism attenuates EMCV replication and protects β-cells from virally mediated lysis. J Biol Chem 295 : 16655–16664, 2020. doi:10.1074/jbc.RA120.014851. 32972972
38. Oleson BJ, Corbett JA. Dual role of nitric oxide in regulating the response of β cells to DNA damage. Antioxid Redox Signal 29 : 1432–1445, 2018. doi:10.1089/ars.2017.7351. 28978225
39. Yeo CT, Stancill JS, Oleson BJ, Schnuck JK, Stafford JD, Naatz A, Hansen PA, Corbett JA. Regulation of ATR-dependent DNA damage response by nitric oxide. J Biol Chem 296 : 100388, 2021. doi:10.1016/j.jbc.2021.100388. 33567339
40. Yeo CT, Kropp EM, Hansen PA, Pereckas M, Oleson BJ, Naatz A, Stancill JS, Ross KA, Gundry RL, Corbett JA. β-Cell-selective inhibition of DNA damage response signaling by nitric oxide is associated with an attenuation in glucose uptake. J Biol Chem 299 : 102994, 2023. doi:10.1016/j.jbc.2023.102994. 36773802
41. Oleson BJ, Broniowska KA, Yeo CT, Flancher M, Naatz A, Hogg N, Tarakanova VL, Corbett JA. The role of metabolic flexibility in the regulation of the DNA damage response by nitric oxide. Mol Cell Biol 39 : e00153-19, 2019. doi:10.1128/MCB.00153-19. 31235477
42. Goffart S, Wiesner RJ. Regulation and co-ordination of nuclear gene expression during mitochondrial biogenesis. Exp Physiol 88 : 33–40, 2003. doi:10.1113/eph8802500. 12525853
43. Kelly DP, Scarpulla RC. Transcriptional regulatory circuits controlling mitochondrial biogenesis and function. Genes Dev 18 : 357–368, 2004. doi:10.1101/gad.1177604. 15004004
44. Kelly CB, Blair LA, Corbett JA, Scarim AL. Isolation of islets of Langerhans from rodent pancreas. Methods Mol Med 83 : 3–14, 2003. doi:10.1385/1-59259-377-1:003. 12619711
45. Scarim AL, Arnush M, Blair LA, Concepcion J, Heitmeier MR, Scheuner D, Kaufman RJ, Ryerse J, Buller RM, Corbett JA. Mechanisms of β-cell death in response to double-stranded (ds) RNA and interferon-gamma: dsRNA-dependent protein kinase apoptosis and nitric oxide-dependent necrosis. Am J Pathol 159 : 273–283, 2001. doi:10.1016/s0002-9440(10)61693-8. 11438474
46. Nolan T, Hands RE, Bustin SA. Quantification of mRNA using real-time RT-PCR. Nat Protoc 1 : 1559–1582, 2006. doi:10.1038/nprot.2006.236. 17406449
47. Mokry RL, Schumacher ML, Hogg N, Terhune SS. Nitric oxide circumvents virus-mediated metabolic regulation during human cytomegalovirus infection. mBio 11 : e02630-20, 2020. doi:10.1128/mBio.02630-20. 33323506
48. Keefer LK, Nims RW, Davies KM, Wink DA. NONOates” (1-substituted diazen-1-ium-1,2-diolates) as nitric oxide donors: convenient nitric oxide dosage forms. Methods Enzymol 268 : 281–293, 1996. doi:10.1016/s0076-6879(96)68030-6. 8782594
49. Lewis RS, Deen WM. Kinetics of the reaction of nitric oxide with oxygen in aqueous solutions. Chem Res Toxicol 7 : 568–574, 1994. doi:10.1021/tx00040a013. 7981422
50. Grätzel M, Taniguchi S, Henglein A. Pulsradiolytische Untersuchung der NO-Oxydation und des Gleichgewichts N2O3 ⇄ NO + NO2 in wäßriger Lösung. Ber Bunsenges Phys Chem 74 : 488–492, 1970. doi:10.1002/bbpc.19700740513.
51. Diers AR, Broniowska KA, Darley-Usmar VM, Hogg N. Differential regulation of metabolism by nitric oxide and S-nitrosothiols in endothelial cells. Am J Physiol Heart Circ Physiol 301 : H803–H812, 2011. doi:10.1152/ajpheart.00210.2011. 21685262
52. Stancill JS, Kasmani MY, Khatun A, Cui W, Corbett JA. Cytokine and nitric oxide-dependent gene regulation in islet endocrine and nonendocrine cells. Function (Oxf) 3 : zqab063, 2022. doi:10.1093/function/zqab063. 34927076
53. Meares GP, Hughes KJ, Jaimes KF, Salvatori AS, Rhodes CJ, Corbett JA. AMP-activated protein kinase attenuates nitric oxide-induced β-cell death. J Biol Chem 285 : 3191–3200, 2010. doi:10.1074/jbc.M109.047365. 19933272
54. Oleson BJ, Corbett JA. Can insulin secreting pancreatic β-cells provide novel insights into the metabolic regulation of the DNA damage response? Biochem Pharmacol 176 : 113907, 2020. doi:10.1016/j.bcp.2020.113907. 32171728
55. Akaike T, Yoshida M, Miyamoto Y, Sato K, Kohno M, Sasamoto K, Miyazaki K, Ueda S, Maeda H. Antagonistic action of imidazolineoxyl N-oxides against endothelium-derived relaxing factor/.NO through a radical reaction. Biochemistry 32 : 827–832, 1993. doi:10.1021/bi00054a013. 8422387
56. Liu D, Pavlovic D, Chen MC, Flodström M, Sandler S, Eizirik DL. Cytokines induce apoptosis in β-cells isolated from mice lacking the inducible isoform of nitric oxide synthase (iNOS−/−). Diabetes 49 : 1116–1122, 2000. doi:10.2337/diabetes.49.7.1116. 10909967
57. Ashcroft SJ, Weerasinghe LC, Randle PJ. Interrelationship of islet metabolism, adenosine triphosphate content and insulin release. Biochem J 132 : 223–231, 1973. doi:10.1042/bj1320223. 4199014
58. Schuit F, De Vos A, Farfari S, Moens K, Pipeleers D, Brun T, Prentki M. Metabolic fate of glucose in purified islet cells. Glucose-regulated anaplerosis in β cells. J Biol Chem 272 : 18572–18579, 1997. doi:10.1074/jbc.272.30.18572. 9228023
59. Fehsel K, Jalowy A, Qi S, Burkart V, Hartmann B, Kolb H. Islet cell DNA is a target of inflammatory attack by nitric oxide. Diabetes 42 : 496–500, 1993. doi:10.2337/diab.42.3.496. 8432420
60. Padgett LE, Broniowska KA, Hansen PA, Corbett JA, Tse HM. The role of reactive oxygen species and proinflammatory cytokines in type 1 diabetes pathogenesis. Ann N Y Acad Sci 1281 : 16–35, 2013. doi:10.1111/j.1749-6632.2012.06826.x. 23323860
61. Xu Q, Hu Y, Kleindienst R, Wick G. Nitric oxide induces heat-shock protein 70 expression in vascular smooth muscle cells via activation of heat shock factor 1. J Clin Invest 100 : 1089–1097, 1997. doi:10.1172/JCI119619. 9276725
62. Weber SM, Chambers KT, Bensch KG, Scarim AL, Corbett JA. PPARγ ligands induce ER stress in pancreatic β-cells: ER stress activation results in attenuation of cytokine signaling. Am J Physiol Endocrinol Metab 287 : E1171–E1177, 2004. doi:10.1152/ajpendo.00331.2004. 15315910
63. Sharma VS, Traylor TG, Gardiner R, Mizukami H. Reaction of nitric oxide with heme proteins and model compounds of hemoglobin. Biochemistry 26 : 3837–3843, 1987. doi:10.1021/bi00387a015. 3651417
64. Durante W, Kroll MH, Christodoulides N, Peyton KJ, Schafer AI. Nitric oxide induces heme oxygenase-1 gene expression and carbon monoxide production in vascular smooth muscle cells. Circ Res 80 : 557–564, 1997. doi:10.1161/01.res.80.4.557. 9118487
65. Buckley BJ, Marshall ZM, Whorton AR. Nitric oxide stimulates Nrf2 nuclear translocation in vascular endothelium. Biochem Biophys Res Commun 307 : 973–979, 2003. doi:10.1016/s0006-291x(03)01308-1. 12878207
66. Maines MD. The heme oxygenase system: a regulator of second messenger gases. Annu Rev Pharmacol Toxicol 37 : 517–554, 1997. doi:10.1146/annurev.pharmtox.37.1.517. 9131263
67. Ma Q. Role of nrf2 in oxidative stress and toxicity. Annu Rev Pharmacol Toxicol 53 : 401–426, 2013. doi:10.1146/annurev-pharmtox-011112-140320. 23294312
68. Jaiswal AK. Nrf2 signaling in coordinated activation of antioxidant gene expression. Free Radic Biol Med 36 : 1199–1207, 2004. doi:10.1016/j.freeradbiomed.2004.02.074. 15110384
69. Nisoli E, Carruba MO. Nitric oxide and mitochondrial biogenesis. J Cell Sci 119 : 2855–2862, 2006. doi:10.1242/jcs.03062. 16825426
70. Scarim AL, Heitmeier MR, Corbett JA. Irreversible inhibition of metabolic function and islet destruction after a 36-hour exposure to interleukin-1β. Endocrinology 138 : 5301–5307, 1997. doi:10.1210/endo.138.12.5583. 9389514
71. Willis SN, Adams JM. Life in the balance: how BH3-only proteins induce apoptosis. Curr Opin Cell Biol 17 : 617–625, 2005. doi:10.1016/j.ceb.2005.10.001. 16243507
72. Steer SA, Scarim AL, Chambers KT, Corbett JA. Interleukin-1 stimulates beta-cell necrosis and release of the immunological adjuvant HMGB1. PLoS Med 3 : e17, 2006. doi:10.1371/journal.pmed.0030017. 16354107
73. Collier JJ, Fueger PT, Hohmeier HE, Newgard CB. Pro- and antiapoptotic proteins regulate apoptosis but do not protect against cytokine-mediated cytotoxicity in rat islets and β-cell lines. Diabetes 55 : 1398–1406, 2006. doi:10.2337/db05-1000. 16644697
74. Collier JJ, Burke SJ, Eisenhauer ME, Lu D, Sapp RC, Frydman CJ, Campagna SR. Pancreatic β-cell death in response to pro-inflammatory cytokines is distinct from genuine apoptosis. PLoS One 6 : e22485, 2011. doi:10.1371/journal.pone.0022485. 21829464
75. Stafford JD, Yeo CT, Corbett JA. Inhibition of oxidative metabolism by nitric oxide restricts EMCV replication selectively in pancreatic β-cells. J Biol Chem 295 : 18189–18198, 2020. doi:10.1074/jbc.RA120.015893. 33100269
76. Bellmann K, Wenz A, Radons J, Burkart V, Kleemann R, Kolb H. Heat shock induces resistance in rat pancreatic islet cells against nitric oxide, oxygen radicals and streptozotocin toxicity in vitro. J Clin Invest 95 : 2840–2845, 1995. doi:10.1172/JCI117989. 7769124
