
==== Front
Pan Afr Med J
Pan Afr Med J
PAMJ
The Pan African Medical Journal
1937-8688
The African Field Epidemiology Network

PAMJ-47-204
10.11604/pamj.2024.47.204.39135
Research
Characterization of Helicobacter pylori iceA and babA2 virulence genes in dyspeptic patients at a teaching hospital in Ghana
Asmah Richard Harry 1
Archampong Timothy 2&
King Gabriel 1
Eyison Benjamin 3
Teye Andrew Kwablah 3
Adjei Christopher 1
Amegatcher Gloria 3
Aidoo Ebenezer Krampah 4
Attoh Seth 5https://orcid.org/0000-0002-1352-4175

1 Department of Biomedical Sciences, School of Basic and Biomedical Sciences, University of Health and Allied Sciences, Ho, Ghana,
2 Department of Medicine and Therapeutics, University of Ghana Medical School, Accra, Ghana,
3 Department of Medical Laboratory Sciences, School of Biomedical and Allied Health Sciences, University of Ghana, Accra, Ghana,
4 Department of Medical Laboratory Technology, Accra Technical University, Accra, Ghana,
5 Division of Pathology, Military Hospital, Accra, Ghana
& Corresponding author: Timothy Archampong, Department of Medicine and Therapeutics, University of Ghana Medical School, Accra, Ghana. tnaa@doctors.net.uk
22 4 2024
2024
47 20431 1 2023
25 2 2024
Copyright: Richard Harry Asmah et al.
2024
https://creativecommons.org/licenses/by/4.0/ The Pan African Medical Journal (ISSN: 1937-8688). This is an Open Access article distributed under the terms of the Creative Commons Attribution International 4.0 License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Introduction

Helicobacter pylori (H. pylori) infection is endemic in Africa. It is a major aetiological factor in the development of peptic ulcer disease and distal gastric cancers. Existing data shows that clinical outcomes are dependent on the virulence of the infecting strain, host´s susceptibility, and environmental factors. In Ghana, a previous study showed that the majority of symptomatic individuals harboured cagA and vacA virulent strains. The main objective of this study was to characterize and assess the significance of other virulence factors, specifically iceA and babA2 in Ghana.

Methods

H. pylori iceA and babA2 genes were investigated in dyspeptic patients at the Korle Bu Teaching Hospital (KBTH), Accra, Ghana. The study employed a cross-sectional design consecutively recruiting patients with upper gastrointestinal symptoms for endoscopy. Nucleic acid was extracted from gastric biopsies using a commercial kit (QIAGEN DNeasy tissue kit). H. pylori babA2 and iceA genes were amplified using extracted deoxyribonucleic acid (DNA) and primers by polymerase chain reaction (PCR).

Results

majority, (71.1%), of the study participants, were H. pylori positive when tested with urease-campylobacter-like organism (CLO). In total, 46 H. pylori urease CLO-positive samples were randomly analyzed by PCR for iceA, of which, 12 (26%) and 7 (15%) were found to have iceA1 and iceA2 respectively. Of the CLO-positive samples, 9 were randomly analysed for babA2 by PCR. Three samples were babA2 positive and 6 were babA2 negative.

Conclusion

in Ghana, although H. pylori is endemic, iceA prevalence is rather low and probably exerts a limited effect on bacterial virulence. Further evaluation would be required, not only to determine association with other virulence factors but more importantly, inter-relationships with wider host and environmental factors that impact on disease pathogenesis.

Helicobacter pylori
endoscopy
iceA
babA2
Ghana
==== Body
pmcIntroduction

Helicobacter pylori is a microaerophilic, gram-negative bacterium that thrives in the gastric epithelium of a number of vertebrates including humans [1]. Studies have shown that H. pylori infection is the most common chronic bacterial infection known to humans [2], with approximately, 50% of the world´s population infected [2]. In Africa, Helicobacter pylori infection is endemic with prevalence high across all age groups studied [3]. It is known to be a major cause of peptic ulcer disease and one of the leading independent risk factors for distal gastric cancer. It is the first formally recognized bacterial carcinogen [2]. Additionally, it is also known to be linked to gastric mucosa-associated tissue lymphoma [4,5]. If not treated, the infection or colonization can last a lifetime [2]. However, only a small percentage (10-15%) of the world´s population is affected with H. pylori develop disease [6].

Although infection is universally associated with gastritis, the development of clinical and endoscopic disease is dependent on a number of factors, including the virulence of the infecting strain, the susceptibility of the host, and environmental co-factors [7]. A recent study demonstrated the influence of Helicobacter pylori virulence factors cagA and vacA on clinical and endoscopic disease in Accra, Ghana, an endemic sub-Saharan African country [8]. Most biopsies harboured H. pylori expressing both cagA and vacA virulent genes [8], but sparse information is available about the presence of iceA and babA2 genes in patients with dyspepsia in the region.

The objective of this study was to characterize other key virulence factors, H. pylori iceA and babA2 genes to ascertain their significance in dyspeptic Ghanaian patients.

Methods

Study design: this research study received ethical approval from the University of Health and Allied Sciences Research Committee, Ho, Ghana. This study employed a cross-sectional design consecutively recruiting eligible participants. Patient sampling occurred during one endoscopy session per week (Friday mornings), from June - September 2019. Informed consent was obtained from all subjects who met the inclusion criteria by means of either a signature or thumbprint following which the study questionnaire was completed. Recruitment, data collection, and analysis occurred between June 2019 and April 2020.

Setting: the study setting was the Korle-Bu Teaching Hospital in Accra which has 2,500 beds and is the main tertiary referral centre in Accra serving the majority of the southern half of Ghana.

Participants: patients were eligible if they were medical inpatients or clinic out-patients attending the Endoscopy Unit, Korle Bu Teaching Hospital having been referred with upper gastrointestinal symptoms for endoscopy.

Variables: the study questionnaire gathered categorical data on patients´ demographics, bio-data, associated symptoms, lifestyle/dietary habits, signs and endoscopic diagnoses (gastritis, gastric ulcer, duodenal ulcer, gastric cancer). Categorical outcome variables included H. pylori status by urease-CLO test and iceA, babA positivity by PCR.

Measurements: all experiments were performed in accordance with relevant guidelines and regulations. Helicobacter status was defined by urease-CLO rapid urease testing on gastric antral biopsies performed at endoscopy. Following upper-gastro-intestinal endoscopy, three systematic gastric antral biopsies per patient were preserved in 0.5 ml DNA-gard solution (Biometrica In, San Deigo, USA).

Determination of Helicobacter pylori status with rapid urease testing: in the Endoscopy Unit, Korle-Bu Teaching Hospital, a gastric antral biopsy sample following upper gastrointestinal endoscopy was tested by the rapid urease CLO-test (Cambridge Life Sciences Ltd, Cambridge, UK) to determine the presence of Helicobacter pylori in samples.

Genomic DNA extraction: genomic DNA was extracted from stored tissue samples collected from patients using a QIAGEN DNA mini kit (Qiagen Co Ltd, USA). After extraction, genomic DNA was stored at -20° C until further analysis.

Molecular analysis of Helicobacter pylori virulence genes: gastric antral biopsies obtained by endoscopy were stored in specimen tubes containing DNA gard solution (Biomatrica, Inc, Oberlin Drive, San Diego, USA) which preserves DNA at room temperature.

Polymerase Chain Reaction (PCR) analysis of iceA gene: the primers described by Smith et al. [9], for iceA gene 1 and 2 were used in this work. PCR amplification was performed under the following conditions: 5X PCR buffer (New England, Biolab Inc), 1.0µl of each primer (for iceA1; 5' CATTGTATATCCTATCATTAC3' and 5' GTTGGGTAAGCGTTACAGAATTT 3') for iceA2, 5'GTTGGGTATATCACAATTTAT3'; 5' TTRCCCTATTTTCTAGTAGGT3'). Five µl of template DNA, and 0.125 µl Taq polymerase, 2 mM MgCl2, 0.5 mM dNTPs (dATP, dTTP, dGTP, dCTP) in 25 µl of reaction. The amplification program included an initial denaturation cycle at 95°C for 2 min, 40 cycles at 94°C for 30s, 50°C for 30s, 72°C for 30s, and a final extension cycle at 72°C for 5 min. The product of amplification was 567 and 229/334 bp fragments of iceA gene 1 and 2, respectively. After the reaction 10µL of the PCR product was run by electrophoresis at 100 volts using 2% agarose gel (Biopioneer Co, USA) stained with 0-5 ug/mL ethidium bromide (Life Technologies Co, USA) in 1X Tris-acetate EDTA (TAE) running buffer (Biopioneer Co, USA) using 2 µl of blue/orange DNA loading dye (6X) (Promega Co, USA). A hundred nucleotide base pair molecular size marker (Sigma Mo, USA) was run alongside the PCR products on the gel. The gel was photographed using UV illumination (UVIsave gel documentation system, model GAS9200/1/2/3, version 12) and analyzed.

Polymerase Chain Reaction (PCR) analysis of babA2 gene: the primers described by Gerhard et al. [10] was used in this work. PCR amplification was performed under the following conditions: 5X PCR buffer (New England, Biolab Inc), 8.5 pmol of each primer (F5'AATCCAAAAAGGAGAAAAAACATGAAA-3' and R5' TGTTAGTGATTTCGGTGTAGGACA-3'), 5 µl of template DNA, and 0.5 U Taq polymerase, 1.5 mM MgCl2, 0.2 mM dNTPs (dATP, dTTP, dGTP, dCTP) in 25 µl of reaction. The amplification program included an initial denaturation cycle at 95°C for 3 min, 40 cycles at 95°C for 30s, 57°C for 40s, 72°C for 45s, and a final extension cycle at 72°C for 5 min. The product of amplification was 850 bp fragment of the babA2 gene. After the reaction, 10 µl of the PCR product was run by electrophoresis at 120 volts using in 2% agarose gel (Biopioneer Co, USA) stained with 0-5 ug/ml ethidium bromide (Life Technologies Co, USA) in 1X Tris acetate EDTA (TAE) running buffer (Biopioneer Co, USA) using 2 µl of blue/orange DNA loading dye (6X) (Promega Co, USA). A hundred nucleotide base pair molecular size marker (Sigma Mo, USA) was run alongside the PCR products on the gel. The gel was photographed using UV illumination (UVIsave gel documentation system, model GAS9200/1/2/3, version 12) and analysed.

Bias: in order to address bias, patients with prior Helicobacter eradication treatment or proton-pump inhibitor use two weeks preceding endoscopic analysis were excluded as they were potential confounders and likely to reduce or modify H. pylori prevalence.

Study size: a total of 100 dyspeptic patients were recruited.

Statistical methods: data obtained from questionnaires were stored and analysed using Microsoft Excel software. To avoid missing data, data collection was done by trained research staff with follow-up contact details of participants included in the questionnaire. Percentages were used to analyse qualitative variables. Statistical significance was set at p < 0.05.

Results

Participants: approximately eighty patients attended the Endoscopy Unit, KBTH for upper GI endoscopy on a weekly basis during the study period. Ten patients were examined each week for eligibility on Fridays (160 during the study sampling period), of whom 115 patients were confirmed eligible. The main reasons for non-participation in the study included recent antibiotic or proton-pump inhibitor use. Out of the 115 eligible patients, 100 consented and were recruited (Figure 1).

Figure 1 study recruitment flow diagram

Descriptive data: the prevalence of H. pylori using the CLO-urease test in the study population was 71% of which 56.3% were male (n=40). The greater majority were in the age range of 31-40 representing 23% followed by the age group 41-50 with 20 participants (20%) (Table 1). Neither age, gender, smoking status, dietary preference, herbal preparation, alcohol intake, nor household composition was associated with H. pylori positivity (Table 2). Patients with all the endoscopic diagnoses (gastritis, gastric ulcer, duodenal ulcer, gastric cancer) had an increased prevalence of H. pylori (60.5 - 90.1%) in comparison with patients with normal endoscopy (Table 3).

Table 1 age distribution of study participants

Age group (yrs)	N	%	
Below 20	2	2	
21 30	15	15	
31-40	23	23	
41-50	20	20	
51-60	14	14	
60-70	13	13	
Above 70	13	13	

Table 2 risk factors for H. pylori among the study population

Risk factors	CLO-positive	%	CLO-negative	%	P-value	
Sex	  	  	  	  	  	
Male	40	56.3	13	44.8	0.378	
Female	31	43.7	16	55.2		
Smoking history	  	  	  	  	  	
Smokers	4	5.6	1	3.8	1	
Non-smokers	67	94.4	28	96.2		
Spicy foods	  	  	  	  	  	
Yes	30	42.3	6	20.7	0.065	
No	41	57.7	23	79.3		
Herbal preparation	  	  	  	  	  	
Yes	23	32.4	7	24.1	0.478	
No	48	67.6	22	75.9		
Alcohol	  	  	  	  	  	
Yes	23	32.4	7	24.1	0.478	
No	48	67.6	22	75.9		
Household	  	  	  	  	  	
Compound	44	61.9	13	44.8	0.065	
Detached	19	26.8	9	31		
Semi-detached	8	11.3	7	24.2		
Age	  	  	  	  	  	
<40 yrs	28	39.4	12	41.4	1	
≥40 yrs	43	60.6	17	58.6		
CLO: campylobacter-like organism

Table 3 endoscopic diagnoses and H. pylori status of study participants

Diagnosis	H. pylori-positive	%	H. pylori-negative	%	Total	
Gastritis	26	60.5	17	39.5	43	
Gastric ulcer	21	87.5	3	12.5	24	
Duodenal ulcer	10	90.1	1	9.9	11	
Gastric cancer	4	100	0	0	4	
PUD	10	100	0	0	10	
Normal	0	0	8	100	8	
PUD: peptic ulcer disease

Outcome data: in total, 46 CLO-positive samples were randomly analysed by PCR to characterize H. pylori iceA gene (Figure 2), of which, 12 (26%) and 7 (15%) were found to have iceA1 gene and iceA2 genotypes respectively. Figure 2 illustrates the 576 bp PCR amplicon obtained for the iceA1 gene following 2% gel electrophoresis. Of the CLO-positive samples, 9 were randomly selected and taken through PCR analysis for the babA2 gene (Table 4). Three samples were babA2 positive and 6 were babA2 negative.

Figure 2 amplicon size of 567 bp obtained from iceA1 gene PCR analysis (ethidium bromide-stained 2.0% agarose gel electropherogram of amplified iceA1 DNA fragments (567 bp) with gene primers; lane M is a 100 bp DNA ladder; lane 4 and 7 PCR positives and lane 5 negative control)

Table 4 prevalence of iceA1, iceA2 and babA2 H. pylori virulence genes in dyspeptic patients

Genotype	Positive	%	Negative	%	Total	
iceA1	12	26.1	34	73.9	46	
iceA2	7	15.2	39	12.5	46	
babA2	3	33.3	6	66.7	9	

Discussion

In Ghana, there was a high prevalence of infection from H. pylori, 71.1%, as previously identified [8]. The pathogenesis of H. pylori is orchestrated by a myriad of virulence factors that facilitate colonization, inflammation, and host injury [11]. The cag pathogenicity island (cagPAI) and vacuolating cytotoxin A (vacA) are undoubtedly some of the most evaluated virulence factors of H. pylori [12]. The risk of peptic ulcer disease, pre-malignant gastric pathology (intestinal metaplasia and gastric atrophy) and ultimately distal gastric adenocarcinoma have a higher incidence in patients infected with cagA-positive strains when compared with persons infected with cagA-negative strains [13,14]. Furthermore, strains containing vacA alleles with s1, i1, or m1 sub-type have been demonstrated to have significantly elevated vacuolating activity than those with s2, i2, or m2 and are associated with an increased risk of peptic ulcer disease, pre-malignant lesions as well as gastric cancer [15,16]. A previous study in Ghana, showed that the majority of infected dyspeptic individuals at the tertiary centre harboured cagA and vacA virulent strains [8].

It is noteworthy that other virulence factors have been implicated in H. pylori disease pathogenesis [17]. Specifically, iceA has been reported by van Doorn LJ et al. [18] as significantly associated with peptic ulcer, with this relationship independent of the cagA and vacA status. IceA has two main allelic forms, iceA1 and iceA2 [17]. The expression of iceA1 has been shown to be upregulated when H. pylori adheres to human epithelial cells, with the iceA1 genotype associated with increased mucosal interleukin (IL)-8 expression and gastric inflammation [19,20]. However, the prevalence and clinical influence of iceA varies across populations [17]. The overall prevalence of iceA1 was significantly higher in Asian countries than in Western countries (64.6% vs. 42.1%), whereas the prevalence of iceA2 was more prevalent in Western countries than in Asian countries (45.1% vs. 25.8%) [17]. By contrast, iceA was clinically significant in Western populations and not Asian countries. Further correlation analysis showed differing relationships with the two isoforms of iceA, iceA1 being significantly associated with peptic ulcer but iceA2 rather inversely associated with peptic ulcer [17].

This study was designed to characterize H. pylori iceA genotypes in Ghana. Of the 46-CLO positive samples analyzed, 12 (26%) and 7 (15%) were found to have iceA1 and iceA2 genotypes respectively (Table 4). IceA prevalence in this study in Accra, Ghana was markedly lower than its prevalence in a previous study of 86 dyspeptic South African studies where iceA1 was detected in 68% and iceA2 in 80% of all clinical isolates [21]. Genetic analysis of iceA1 in the South African study demonstrated significant homology (92-95%) with the USA type strain 26695 [21], implying it is likely aligned to Western strains. Another study in Nigeria found iceA1 prevalence of 94.7% and 86.4% in isolates from duodenal ulcer and non-ulcer dyspepsia respectively [9]. In Ghana, although vacA and cagA are endemic, iceA prevalence is rather low and probably exerts a limited effect on bacterial virulence.

The H. pylori genome has several outer membrane proteins (OMP) related genes [13]. Most OMP-encoding genes are preserved in all H. pylori strains; however, some may be differentially present across isolates [13]. One of the most widely studied OMPs, babA adheres to the fucosylated Lewis b histoblood group antigen on host cells [22]. These adhesion proteins vary in prevalence globally. High prevalence regions include Eastern Asia where all express babA2 while low prevalence areas were Western and Southern Europe which had rates of 44.0% and 44.6% respectively [23]. Of the CLO-positive samples in this present study, 9 were randomly selected and taken through PCR analysis for the babA2 gene (Table 4). Three samples were babA2 positive and 6 were babA2 negative.

Limitations: babA2 had a low prevalence in this study but given the small number of samples, no further inferences can be made as it is unlikely to be generalizable to the larger population. This study being descriptive, did not provide a correlation between iceA and clinical phenotype or cagA/vacA status.

Conclusion

In Ghana, although H. pylori is endemic, iceA prevalence is rather low and probably exerts a limited effect on bacterial virulence. Further evaluation would be required, not only to determine association with other virulence factors but more importantly, inter-relationships with wider host and environmental factors which can impact on disease pathogenesis.

What is known about this topic

The iceA1 genotype is associated with increased mucosal interleukin (IL)-8 expression and an increase in gastric inflammation;

The prevalence and clinical influence of iceA varies across populations, iceA1 being significantly higher in Asian countries than in Western countries (64.6% vs. 42.1%), whereas iceA2 was more prevalent in Western countries than in Asian countries (45.1% vs. 25.8%);

H. pylori iceA has been shown to be clinically significant in Western populations and not Asian countries.

What this study adds

Patients with all the endoscopic diagnoses (gastritis, gastric ulcer, duodenal ulcer, gastric cancer) had an increased prevalence of H. pylori (60.5 - 90.1%) in comparison with patients with normal endoscopy;

In Ghana, although vacA and cagA are endemic, iceA prevalence is rather low; of the 46-CLO-positive samples analysed, 12 (26%) and 7 (15%) were found to have iceA1 and iceA2 genotypes respectively.

Competing interests

The authors declare no competing interests.

Authors' contributions

Richard Harry Asmah and Timothy Archampong contributed to the conception and the study design; Gabriel King, Benjamin Eyison, and Andrew Kwablah Teye performed genetic analysis, supervised by Richard Harry Asmah and Timothy Archampong; Timothy Archampong, Richard Harry Asmah, Gabriel King, Christopher Adjei, and Gloria Amegatcher contributed to the initial manuscript draft; Ebenezer Krampah Aidoo and Seth Attoh provided review of analyses and contributed to manuscript development. All the authors read, reviewed, and approved the final version of this manuscript.

Cite this article: Richard Harry Asmah et al. Characterization of Helicobacter pylori iceA and babA2 virulence genes in dyspeptic patients at a teaching hospital in Ghana. Pan African Medical Journal. 2024;47(204). 10.11604/pamj.2024.47.204.39135
==== Refs
1 Bury-Moné S Kaakoush NO Asencio C Mégraud F Thibonnier M De Reuse H et al Is Helicobacter pylori a true microaerophile? Helicobacter 2006 11 4 296 303 16882333
2 Kusters JG van Vliet AH Kuipers EJ Pathogenesis of Helicobacter pylori infection Clin Microbiol Rev 2006 Jul 19 3 449 90 16847081
3 Perez-Perez GI Rothenbacher D Brenner H Epidemiology of Helicobacter pylori infection Helicobacter 2004 9 Suppl 1 1 6
4 Hu Q Zhang Y Zhang X Fu K Gastric mucosa-associated lymphoid tissue lymphoma and Helicobacter pylori infection: a review of current diagnosis and management Biomark Res 2016 Jul 27 4 15 27468353
5 Bravo D Hoare A Soto C Valenzuela MA Quest AF Helicobacter pylori in human health and disease: Mechanisms for local gastric and systemic effects World J Gastroenterol 2018 Jul 28 24 28 3071 3089 30065554
6 Wen S Moss SF Helicobacter pylori virulence factors in gastric carcinogenesis Cancer Lett 2009 Sep 8 282 1 1 8 19111390
7 Atherton JC The clinical relevance of strain types of Helicobacter pylori Gut 1997 Jun 40 6 701 3 9245920
8 Archampong TN Asmah RH Aidoo EK Wiredu EK Gyasi RK Adjei DN et al Helicobacter pylori cagA and vacA genes in dyspeptic Ghanaian patients BMC Res Notes 2017 10 1 231 28655347
9 Smith SI Kirsch C Oyedeji KS Arigbabu AO Coker AO Bayerdöffer E et al Prevalence of Helicobacter pylori vacA, cagA and iceA genotypes in Nigerian patients with duodenal ulcer disease J Med Microbiol 2002 51 10 851 4 12435064
10 Gerhard M Lehn N Neumayer N Borén T Rad R Schepp W et al Clinical relevance of the Helicobacter pylori gene for blood-group antigen-binding adhesin Proc Natl Acad Sci U S A 1999 Oct 26 96 22 12778 83 10535999
11 Yamaoka Y Mechanisms of disease: Helicobacter pylori virulence factors Nat Rev Gastroenterol Hepatol 2010 7 11 629 41 20938460
12 Olbermann P Josenhans C Moodley Y Uhr M Stamer C Vauterin M et al A global overview of the genetic and functional diversity in the Helicobacter pylori cag pathogenicity island PLoS Genet 2010 6 8 e1001069 20808891
13 Cover TL Helicobacter pylori Diversity and Gastric Cancer Risk mBio 2016 Jan 26 7 1 e01869 15 26814181
14 Blaser MJ Perez-Perez GI Kleanthous H Cover TL Peek RM Chyou PH et al Infection with Helicobacter pylori strains possessing cagA is associated with an increased risk of developing adenocarcinoma of the stomach Cancer Res 1995 May 15 55 10 2111 5 7743510
15 Atherton JC Cao P Peek RM Tummuru MK Blaser MJ Cover TL Mosaicism in vacuolating cytotoxin alleles of Helicobacter pylori. Association of specific vacA types with cytotoxin production and peptic ulceration J Biol Chem 1995 270 30 17771 7 7629077
16 Winter JA Letley DP Cook KW Rhead JL Zaitoun AA Ingram RJ et al A role for the vacuolating cytotoxin, VacA, in colonization and Helicobacter pylori-induced metaplasia in the stomach J Infect Dis 2014 Sep 15 210 6 954 63 24625807
17 Shiota S Suzuki R Yamaoka Y The significance of virulence factors in Helicobacter pylori J Dig Dis 2013 14 7 341 9 23452293
18 van Doorn LJ Figueiredo C Sanna R Plaisier A Schneeberger P de Boer W et al Clinical relevance of the cagA, vacA, and iceA status of Helicobacter pylori Gastroenterology 1998 115 1 58 66 9649459
19 Peek RM Jr Thompson SA Donahue JP Tham KT Atherton JC Blaser MJ et al Adherence to gastric epithelial cells induces expression of a Helicobacter pylori gene, iceA, that is associated with clinical outcome Proc Assoc Am Physicians 1998 Nov-Dec 110 6 531 44 9824536
20 Xu Q Morgan RD Roberts RJ Xu SY van Doorn LJ Donahue JP et al Functional analysis of iceA1, a CATG-recognizing restriction endonuclease gene in Helicobacter pylori Nucleic Acids Res 2002 30 17 3839 47 12202769
21 Kidd M Peek RM Lastovica AJ Israel DA Kummer AF Louw JA Analysis of iceA genotypes in South African Helicobacter pylori strains and relationship to clinically significant disease Gut 2001 Nov 49 5 629 35 11600464
22 Mahdavi J Sondén B Hurtig M Olfat FO Forsberg L Roche N et al Helicobacter pylori SabA adhesin in persistent infection and chronic inflammation Science 2002 297 5581 573 8 12142529
23 Chen MY He CY Meng X Yuan Y Association of Helicobacter pylori babA2 with peptic ulcer disease and gastric cancer World J Gastroenterol 2013 19 26 4242 51 23864790
