
==== Front
J Microbiol Biotechnol
J Microbiol Biotechnol
Journal of Microbiology and Biotechnology
1017-7825
1738-8872
The Korean Society for Microbiology and Biotechnology

39081257
10.4014/jmb.2402.02044
jmb-34-8-1599
Research article
Molecular and Cellular Microbiology (MCM)
Microbial Genetics, Physiology, and Metabolism
Functional Identification and Genetic Analysis of O-Antigen Gene Clusters of Food-Borne Pathogen Yersinia enterocolitica O:10 and Other Uncommon Serotypes, Further Revealing Their Virulence Profiles
Hu Bin 1†
Wang Jing 2†
Li Linxing 2†
Wang Qin 3
Qin Jingliang 2
Chi Yingxin 1
Yan Junxiang 2
Sun Wenkui 1
Cao Boyang 2*
Guo Xi 2*
1 Shandong Center for Disease Control and Prevention, 16992 City Ten Road, Jinan 250014, Shandong, P.R. China
2 TEDA Institute of Biological Sciences and Biotechnology, Nankai University, 23 Hongda Street, TEDA, Tianjin 300457, P.R. China
3 Disease Prevention and Control Center of Ganzhou District, 27 Xianfu Street, Ganzhou District, Zhangye City, Gansu Province, P.R. China
* Corresponding authors B Cao Phone: +86-22-66229583 Fax: +86-22-66229584 E-mail: boyangcao@nankai.edu.cn
X Guo Phone: +86-22-66229574 Fax: +86-22-66229584 E-mail: guoxi@nankai.edu.cn
† These authors contributed equally to this work.

28 8 2024
15 7 2024
15 7 2024
34 8 15991608
26 2 2024
9 6 2024
25 6 2024
Copyright © 2024 by the authors. Licensee KMB
2024
https://creativecommons.org/licenses/by/4.0/ This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license
Yersinia enterocolitica is a globally distributed food-borne gastrointestinal pathogen. The O-antigen variation-determined serotype is an important characteristic of Y. enterocolitica, allowing intraspecies classification for diagnosis and epidemiology purposes. Among the 11 serotypes associated with human yersiniosis, O:3, O:5,27, O:8, and O:9 are the most prevalent, and their O-antigen gene clusters have been well defined. In addition to the O-antigen, several virulence factors are involved in infection and pathogenesis of Y. enterocolitica strains, and these are closely related to their biotypes, reflecting pathogenic properties. In this study, we identified the O-AGC of a Y. enterocolitica strain WL-21 of serotype O:10, and confirmed its functionality in O-antigen synthesis. Furthermore, we analyzed in silico the putative O-AGCs of uncommon serotypes, and found that the O-AGCs of Y. enterocolitica were divided into two genetic patterns: (1) O-AGC within the hemH-gsk locus, possibly synthesizing the O-antigen via the Wzx/Wzy dependent pathway, and (2) O-AGC within the dcuC-galU-galF locus, very likely assembling the O-antigen via the ABC transporter dependent pathway. By screening the virulence genes against genomes from GenBank, we discovered that strains representing different serotypes were grouped according to different virulence gene profiles, indicating strong links between serotypes and virulence markers and implying an interaction between them and the synergistic effect in pathogenicity. Our study provides a framework for further research on the origin and evolution of O-AGCs from Y. enterocolitica, as well as on differences in virulent mechanisms among distinct serotypes.

Yersinia enterocolitica
serotype
O-antigen gene cluster
virulence gene
pathogenicity
==== Body
pmcIntroduction

Yersinia enterocolitica is a Gram-negative, food-borne, zoonotic pathogen with worldwide distribution [1]. It is the causative agent of yersiniosis, which is mainly characterized by gastrointestinal disorders; however, extraintestinal systemic manifestations and septic complications have also been recognized occasionally [2]. According to their biochemical features and pathogenic properties, Y. enterocolitica strains are divided into six biotypes: the highly pathogenic biotype 1B; the weakly pathogenic biotypes 2–5; and the non-pathogenic biotype 1A [3]. In addition, with regard to the antigenic scheme, more than 70 serotypes of Y. enterocolitica have been identified to date [4]. Among these, only 11 serotypes have been reported to be associated with human yersiniosis, with O:3, O:9, O:8 and O:5,27 being the most prevalent, according to clinical evidence [4, 5].

In Gram-negative bacteria, lipopolysaccharide (LPS) is a major component of the outer membrane. The full LPS molecule includes three structurally distinct regions: the lipid A; an oligosaccharide core; and the O-antigenic polysaccharide (O-antigen) [6]. The O-antigen is made of oligosaccharide repeats (O-units) each consisting of two to eight different monosaccharide residues (heteroglycans) or, in some bacteria, identical sugars (homoglycans)[7]. The O-antigen is the most variable LPS component in terms of composition and structure, and thus provides the molecular basis for serotyping, one of the main useful tools for epidemiological, diagnostic, and phylogenetic purposes [8]. Enzymes involved in O-antigen synthesis are encoded in a number of genes, which are always located within a chromosome-encoded locus, namely, the O-antigen gene cluster (O-AGC), and the high variability of O-antigens results normally from the genetic diversity of O-AGC [9,10]. The synthesis of O-antigen depends on one of two classical pathways: the Wzx/Wzy dependent pathway [11] and the ABC transporter (Wzm/Wzt) dependent pathway [12].

The O-antigen chemical structures have been reported for several Y. enterocolitica serotypes, including O:1 to O:3, O:5,27, O:6, and O:8 to O:10 [13-18], and the O-AGCs are known for serotypes O:3, O:9, O:8, O:5 and O:5,27 [19]. In serotype O:8, the O-AGC is located between the hemH and gsk genes. In other serotypes, however, the hemH-gsk locus is occupied by the outer core gene cluster, and the O-AGCs are located elsewhere, always along with several transposase genes; this probably indicates a hotspot region of lateral gene transfer [20, 21]. Since serotyping is one of the main characteristics of Y. enterocolitica, a number of PCR-based methods have been developed for the detection of clinically prevalent serotypes of Y. enterocolitica with higher efficiency and specificity based on the comprehensive elucidation of their O-AGCs [19, 22, 23]. In addition to the main serotypes which are strongly associated with human infection, a few minor serotypes have also been reported as causal agents in sporadic cases [24, 25].

Besides the O-antigen that has been demonstrated to be a virulence factor in Y. enterocolitica [26, 27], pathogenic Y. enterocolitica strains harbor many other chromosome- and plasmid-encoded virulence determinants that are essential for pathogenesis [28]. The main chromosomal virulence genes include the following: ail, encoding the protein which plays a key role during attachment and invasion processes, and which also confers serum resistance [29]; inv, whose product is required in the early phase of infection [30]; myfA, encoding a fibrillar submit of Myf, an important factor at the beginning of infection [31]; and yst, encoding an enterotoxin [32]. In addition, several genes located within a virulence plasmid, pYV, are directly involved in the pathogenicity of Y. enterocolitica, including yadA, encoding Yersinia adhesin, and the yop virulon genes, encoding a type III secretion system (T3SS), namely, Ysc-Yops, translocator YopB/D, control element YopN, and effector YopE/H/M/O/P/T [33]. Normally, high-virulence strains of biotypes 1B and low-virulence strains of biotypes 2–5 carry the chromosome-encoded virulence markers ail, inv, and ystA, in addition to pYV, for their full virulence expression. In contrast, nonvirulent strains belonging to biotype 1A lack pYV-encoding virulence factors, but mainly possess ystB, another type of yst gene [19]. Many studies showed that Y. enterocolitica strains of different biotypes exhibit disparate pathogenic properties and virulence profiles [34-36]. However, the link between serotypes and virulence gene distribution in Y. enterocolitica has not yet been reported.

During the routine epidemiological surveillance, a Y. enterocolitica strain, which was numbered WL-21, was isolated from the stool sample of a chicken by the Shandong Centre for Disease Control and Prevention. Further agglutination test by using antisera (provided by Chinese Center for Disease Control and Prevention) showed that WL-21 was serotype O:10, and biotyping test according to a previous study [37] showed that this isolate belonged to biotype 1A. As an uncommon serotype, neither the O-AGC nor the virulence patterns of O:10 was revealed. The first objective of the present study was to characterize the O-AGC of WL-21, and certify its role in O-antigen synthesis. Secondly, through comprehensive in silico analysis of the O-AGCs, we produced a blueprint that may contribute to elucidating the origin and evolution of O-AGC in Y. enterocolitica. Finally, we sought to recognize any interactions between O-antigen and other virulence factors in the pathogenicity of Y. enterocolitica.

Materials and Methods

Bacterial Strains, Plasmids, and Growth Conditions

Details of WL-21 and its derivatives, plasmids, and primers which were used in this study are given in Table 1. All strains used for sequencing and gene manipulation were cultured in Luria–Bertani (LB) medium at 30°C. When necessary, the cultures were supplemented with chloramphenicol (25 μg/ml).

LB medium (Cat. no. R20214) and chloramphenicol (Cat. no. S17022) were purchased from YuanYe Bio-Technology Co., Ltd. (China). The DNA extraction kit (Cat. no. DP302-02) was purchased from Tiangen Biotech Co., Ltd. (China). High-Fidelity DNA Polymerase (Cat. no. M0530S), restriction enzymes (Cat. nos. R3142V and R3104V) and T4 DNA ligase (Cat. no. M0202V) were purchased from New England Biolab (USA). Sucrose (Cat. no. A610498), L-arabinose (Cat. no. A610071), and reagents for LPS preparation and sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS-PAGE) were purchased from Sangon Co., Ltd. (China). Primers were synthesized by Genewiz (China).

Genome Sequencing and Annotation

The genomic DNA of Y. enterocolitica strain WL-21 was extracted from 5 ml of the overnight bacterial culture. Then, the genomic DNA was sheared, polished, and prepared using the Nextera XT DNA library prep kit (Illumina, USA). Genomic libraries containing 500-bp paired-end inserts were constructed, and sequencing was then performed using Solexa sequencing technologies (Illumina) to produce approximately 100-fold coverage. The obtained reads were assembled using the de novo genome assembly program Velvet to generate a multi-contig draft genome [38]. For gene prediction and annotation, Prokka (v1.12) was used [39], and for additional annotation, the assembled sequences were searched against GenBank non-redundant (NR), UniProt, and Pfam database using BLAST (v2.5.0+) [40]. The TMHMM v2.0 analysis program (http://www.cbs.dtu.dk/services/TMHMM-2.0/) was used to identify potential transmembrane domains within the protein sequences. The sequence data were submitted to GenBank under accession number PP132002. Meanwhile, the genome sequence of a strain IP2222 (O:36) was downloaded from GenBank (GCA_000285015.1) and annotated using the above procedures.

Construction of Plasmids and Strains

Gene deletion in the WL-21 chromosome was performed according to a two-step homologous recombination with pRE112 containing the sacB counter-selectable marker, as described previously [41]. The upstream and downstream fragments of the wzm gene were amplified from the WL-21 genome using primer pairs upF/upR and downF/downR. Next, the two fragments were combined with each other using primers upF and downR, followed by fusion with the linearized pRE112 to yield the suicide plasmid pRE112-updown, which was introduced into the S-17 strain by electroporation, generating the donor strain S-17-pRE112-updown. For conjugation, S-17-pRE112-updown and the recipient strain WL-21 were grown at 30°C with shaking overnight. Then, the cultures were diluted as a ratio of 1:100 into fresh LB medium and incubated at 30°C with shaking until the optical density at 600 nm (OD600) reached approximately 0.6. Next, the donor and the recipient strains were mixed at a ratio of 3:1 (v/v), and the mixture was resuspended in 100 μl of LB medium and was spotted on a LB plate with incubation at 30°C for 48h. After conjugation, the cells were collected and transferred to chloramphenicol containing LB plate to screen for clones via a single crossover event. The growing clones were then transferred into fresh LB medium and incubated at 30°C overnight to induce the second homologous recombination. The overnight culture was diluted and spread on LB plates containing 10% sucrose and grown at 30°C for 24 h. Finally, the resultant clones were transferred onto LB plates and LB plates with chloramphenicol simultaneously, and clones sensitive to chloramphenicol were selected and confirmed by PCR and sequencing.

For the complementation test, the wzm gene was amplified from the WL-21 genome using primers wzm-cF and wzm-cR. The PCR fragment was digested with restriction enzymes KpnI and HindIII, and the digested fragment was cloned into pBAD33, which was also treated with the same enzymes, resulting in plasmid pBAD33-wzm. Expression of the cloned wzm gene is under the control of the PBAD promoter, which could be activated by arabinose. Then, pBAD33-wzm was introduced into WL-21Δwzm by electroporation, generating the complementary strain WL-21Δwzm::wzm.

LPS Extraction and SDS-PAGE Analysis

Strains were grown overnight at 22°C with shaking, and cultures were diluted into 20 ml of fresh LB broth at a ratio of 1:100 and incubated at 22°C to mid-log phase at a final OD600 = 0.8. To induce wzm expression under the control of pBAD33, L-arabinose (0.5 mg/ml) was added to cultures at the OD600 = 0.4, and the cultures were incubated continuously to mid-log phase at the OD600 = 0.8. Then, LPS used for SDS-PAGE analysis was prepared using the hot aqueous-phenol method, as previously described [42]. The extracted LPSs were separated using 12%SDS-PAGE at 50 V for 30 min and 100 V for 2 h; subsequently, they were visualized by silver staining using the Fast Silver Stain Kit (Cat. no. P0017S; Beyotime, China), according to the manufacturer’s protocol. The gel image was captured using a GS900 calibrated densitometer (BioRad Laboratories, USA).

Analysis of Putative O-AGCs and Virulence Marker Profiles

Genomes of those isolates with the serotypes assigned to by the other submitters were downloaded from the GenBank database. Putative O-AGCs of serotypes were characterized using the in-house Bacterial Surface Polysaccharide Gene Database. In general, query genome sequences in GenBank format were searched against the database using BLASTp with the cutoff %coverage > 60 and %identity > 30. An O-AGC candidate could be defined using the following criteria: (1) the smallest number of successive genes is six; (2) the number of successive genes annotated “No hits” is no more than three; and (3) there must be glycosyl transferase gene(s), in addition to wzm/wzt or at least one of wzx and wzy genes. Schematic diagram of genes (Fig. 3) was generated using ChiPlot [43].

The downloaded genome sequences, along with that of WL-21, were also compared with the selected virulence genes, including ail [29], inv [30], myfA [31], ystA/B [32], yadA and yop virulon [33], ymoA [44], yplA [45], fliA and flh/C/D [46], fyuA and ybtP/Q [47], and ysa genes [48], which have been identified previously. Nucleotide sequences were compared using BLASTn, and genes with >90% coverage match and >85% identity match were classified as present. Isolates were clustered according to their virulence profiles, and the pattern was visualized by ChiPlot [43].

Results and Discussion

The Putative O-AGC of WL-21 Correlates Well with the O-Antigen Structure of Y. enterocolitica O:10

The putative O-AGC of WL-21 is 16,137 bp in length, and consists of 11 open reading frames (orfs). These orfs were located between the dcuC and galU-galF genes, and the transcribed direction of orf2 to 11 was from dcuC to galU, with the exception of orf1 just downstream of dcuC (Fig. 1), in line with the evidence for O:3 and very similar to that for O:9.

Details of proposed functions of the 11 orfs were summarized in Table 2. Orf1, a TerC family protein (Pfam03741), was assigned to the function of transporter in O:3 and O:8. TerC protein may be implicated in resistance to tellurium [49]; however, no involvement of this protein in O-antigen synthesis has yet been reported. Orf2, 3, 8, and 9 were annotated as mannose-1-phosphate guanylyltransferase (ManC), phosphoglucomutase (ManB), GDP-mannose 4,6-dehydratase (Gmd), and GDP-6-deoxy-D-talose 4-dehydrogenase (Rmd), respectively. These four enzymes, along with mannose-6-phosphate isomerase (ManA), whose coding gene is always outside the O-AGC, are responsible for the synthesis of GDP-D-rhamnose (GDP-D-Rhap), the nucleotide precursor of D-Rhap [50]. This is consistent with the existence of D-Rhap, which is the only sugar component in the backbone of O:10-antigen. Orf4 and 5 were proposed as the ABC transporter permease (Wzm) and the ABC transporter ATP-binding protein (Wzt), respectively, suggesting that it is very likely that the O-antigen of WL-21 was generated via the ABC transporter dependent pathway. orf6, just downstream of wzt, was annotated a methyltransferase gene. This is very common in O-AGCs containing wzm/wzt genes, and its function has been identified as adding a methyl group to the non-reducing terminus of the O-antigen, thus halting polymerization and regulating chain length [51, 52]. Finally, Orf7, 10, and 11 were all recognized as glycosyl transferases. These enzymes could presumably be involved in the sequential transfer of GDP-D-Rhap to D-Rhap polymers, forming the backbone, and the transfer of L-xylulose (L-Xulf) to D-Rhap, forming the side-chain linkage L-Xulf-(β2→2)-D-Rhap. However, the exact functions of these glycosyl transferases should be confirmed biochemically in the future.

We also observed the hemH-gsk locus at the WL-21 genome (Fig. 1), within which the genetic organization was identical to the outer core gene clusters of O:3 and O:9. This finding also indicated that the genetic elements between dcuC and galU-galF were the candidates for WL-21 O-antigen synthesis genes.

Deletion and Complementation Test Confirmed the Functionality of WL-21 O-AGC

To confirm the role of dcuC-galU-galF locus in O-antigen synthesis, a wzm knockout strain WL-21Δwzm was constructed. As can obviously be seen in the LPS profile, the WL-21 wide-type strain exhibited a complete LPS, while WL-21Δwzm only generated an O-antigen-depleted LPS (Fig. 2). Within the ABC transporter dependent pathway, the translocation of O-antigen is mediated by the integral membrane protein (Wzm)/hydrophilic protein complex (Wzt) [53]. Therefore, WL-21Δwzm lost the ability to produce the Wzm/Wzt complex for O-antigen translocation, thus only the lipid A-core band was generated without O-antigen. Moreover, the complete LPS profile could be restored from the wzm complemented strain, WL-21Δwzm::wzm. However, we noticed that the chain-length of O-anitgen increased slightly in WL-21Δwzm::wzm compared to that in the wide type strain (Fig. 2). There is no clear-cut explanation, as polysaccharide structural studies always tend to focus on repeating units, rather than chain-length regulation. A study demonstrated that in Escherichia coli O9a, a prototype for the biosynthesis of O-antigens by the ABC transporter dependent pathway, the occurrence of distinct chain-length of O-antigens was dependent on the relative concentration of two enzymes, the glycosyl transferase WbdA and the bifunctional kinase–methyl transferase WbdD [54]. As a methyltransferase UbiG and three glycosyl transferases were also annotated in WL21, we propose that there might be similar chain-length regulating mechanism in Y. enterocolitica. Together, these results still proved that the dcuC-galU-galF locus is the O-AGC of WL21, and that the WL21 O-antigen is synthesized by the ABC transporter dependent pathway.

The Putative O-AGCs of Most Y. enterocolitica Are Generally Divided into Two Genetic Patterns

A total of 137 Y. enterocolitica isolates from GenBank were assigned to certain serotypes by the submitters, the majority of which are prevalent serotypes with their O-AGCs being reported before this study: 41 for serotype O:3, eight for serotype O:5, 17 for serotype O:5,27, ten for serotype O:8, and 31 for serotype O:9. The remainder are isolates with uncharacterized O-AGCs, including isolates of serotypes O:1, O:2, O:4, O:6, O:7, O:13, O:19, O:21, and O:36. We next derived the putative O-AGCs from their genomes. Our analysis indicated that (1) isolates with the same serotype possess identical genetic organization within the putative O-AGC; and (2) most serotypes exhibit unique O-AGC profiles with the exception of O:1, O:2, O:7 and O:19.

Consequently, we selected one isolate within each serotype as a type strain for further analysis and found the genetic loci of these O-AGCs exhibited two patterns: within the hemH-gsk locus or somewhere else (Fig. 3). In addition, the O-AGCs shared by O:1 and O:2 were similar to that of O:3, and their O-AGCs were located between or adjacent to insertion sequence (IS), as was also the case in O:5 and O:5,27. Another common feature of the above-mentioned serotypes, along with O:9 and O:10 (strain WL-21 in this study), is that the O-AGCs were all located outside the hemH-gsk locus, and that their O-antigens seem to be synthesized by the ABC transporter dependent pathway. The putative O-AGCs of serotypes O:4, O:7/O:19, O:13, and O:21 were all mapped between hemH and gsk, as was also the case with O:8, and genes in each serotype were transcribed from hemH to gsk. However, in the case of O:36, the putative O-AGC genes were located between hemH and gsk, with the exception of four genes which were upstream of hemH and transcribed in the opposite direction. Another probably shared characteristic of these serotypes was that they produce their O-antigens via the Wzx/Wzy dependent pathway, except in the case of O:7/O:19. In particular, all strains of the latter pattern had a DDH sugar synthesis gene set which was present at the 5’ end within their O-AGCs (Fig. 3). All these features resembled those found in Y. pseudotuberculosis [55]. This evidence implied that the O-AGCs of Y. enterocolitica serotypes with hemH-gsk patterns, and those of Y. pseudotuberculosis, very likely originated from a common ancestor, followed by separate evolutionary events under the pressure of different niches, whereas the O-AGCs with the wzm/wzt gene set underwent a distinct evolutionary history.

Intriguingly, strains of O:7/O:19 possessed wzm/wzt and wzx/wzy simultaneously within their hemH-gsk loci (Fig. 3); this has not been previously reported among the O-AGCs of Y. enterocolitica and other Yersinia species. In a Vibrio cholera strain, the co-location of O-AGC and capsular synthesis genes containing both wzm/wzt and wzx/wzy was revealed, suggesting co-evolution of new O- and capsular-antigens [56]. However, no evidence of capsule has been reported in Y. enterocolitica. Therefore, the elucidation of the O-antigen processing mechanism in O:7/O:19 may arouse more interests in our next study. Another piece of evidence which attracted our attention was that none of the serotype O:6 isolates possessed standard O-AGC; only the outer core gene cluster within the hemH-gsk locus was discovered. In a few species, for example, in Vibrio parahaemolyticus, the O-antigen is deficient in the LPS molecule and the antigenic scheme is based on the variation of core oligosaccharide [57]. Thus, we propose that the antigenic property of O:6 may be determined by its core oligosaccharide, instead of O-antigen. This hypothesis in Y. enterocolitica O:6 could be addressed by fully elucidating the LPS structure.

Strains of Serotypes are Grouped according to Their Virulence Profiles

A total of 138 genomes representing 15 serotypes were investigated for virulence gene screening (Fig. 4). Among these virulence genes, inv, ymoA, yplA, filA, flhC, and filD were distributed in all or almost all isolates; no differences among serotypes were therefore exhibited. According to the pattern of other virulence genes, the 15 serotypes could be clearly divided into three groups: Group 1, consisting of serotypes O:1, O:2, O:3, O:5,27 and O:9; Group 2, mainly composed of serotypes O:5, O:6,30, and a few other minor serotypes including O:10 of this study; and Group 3, with serotype O:8 as its main member, along with O:4, O:21, one strain of O13, and one strain of O7 (Fig. 4).

In Group 1, the largest group, all isolates were characterized by the presence of ail and ystA, and the absence of myfA, yadA, ystB, fyuA, ybtP, ybtQ, and yas genes. Clearly, isolates of Group 1 could be further divided into two subgroups: 1a and 1b. Except for serotype O:2 strains which were located in Group 1b, other strains assigned to serotypes O:1, O:3, O:5,27 and O:9 were distributed into two subgroups. Obviously, the two subgroups were differentiated only by the presence/absence of the yop virulon. The yop virulon is the core of Yersinia pathogenicity machinery and is located within the Pyv [33]; unfortunately, it may be lost during prolonged storage, frequent passaging, or temperatures higher than 37°C [58], which, we propose, may lead to the absence of yop virulon in Group 1a. myfA, encoding a factor important for the beginning of infection, was originally found in bioserotype 4/O:3 strains isolated from clinical cases of yersiniosis, as well as some biotype 1A strains from patients with diarrhea [59]; however, no myfA was found in the O:3 strains in this study.

Within Group 2, all isolates possessed ystB instead of ystA, and most isolates possess myfA and yadA, the two genes absent in all isolates of Group 1. While ystB, instead of ystA, is known as a classical virulence marker of biotype 1A strain [19], the strong implication of ystB in serotypes O:5 and O:6, the main members of Group 2, has not been recorded previously. Another feature of Group 2 is that none of the isolates held ail or yop virulons. In contrast to the situation in subgroup 1a, the absence of yop virulon in Group 2 was unlikely to be attributed to the loss of PYv, since none of the Group 2 isolates were yop virulon positive. In terms of clinical manifestation, O:5/O:6 strains may partially or wholly lose the ability to cause the formation of necrotic abscesses; this is mainly mediated by the functionality of Pyv [60].

The main characteristics of Group 3 were that fyuA, ybtP, ybtQ, and yas genes were only present in the relevant isolates of this group, and thus the virulence factors were most abundant. fyuA, ybtP and ybtQ are the most representative genes of a pathogenicity island termed the high-pathogenicity island (HPI), and most of the genes of HPI are involved in the biosynthesis, transport, and regulation of yersiniabactin [61]. In addition, yas genes located within a Ysa pathogenicity island (Ysa-PI) encoding another T3SS play an important role in the colonization of gastrointestinal tissues during the earliest stage of infection [62]. HPI and Ysa-PI have been reported to be present only in Y. enterocolitica biotype 1B, the highly virulent biotype [63]. Our genome-wide analysis also showed that these two PIs were only present in isolates of Group 3 (three of these were assigned to biotype 1B), suggesting that strains of Group 3 must have unique pathogenic characteristics and mechanisms.

Herein, the in silico O-AGC characterization of non-prevalent serotypes provides the genetic basis for the design of novel geno-serotyping targets, and for the development of novel assays for subtyping and epidemiological surveillance. The revealing of different patterns of O-AGC locations indicates that there must be distinct evolutionary route among Y. enterocolitica strains, the mechanism of which needs further investigation. The O-antigen is a key virulence determinant, and its role in the pathogenesis of Y. enterocolitica has also been identified [26, 27]. In particular, the relationship between certain serotypes and specific virulence factors has been investigated in several bacteria species, for instance, in enterohemorrhagic E. coli O157:H7 [64]. Moreover, the regulation role of O-antigen in pathogenic promotion and environmental tolerance has also been confirmed [65, 66]. Here, we revealed a strong association between O-serotypes and the profile of virulence genes in Y. enterocolitica as a whole; this finding, we believe, will advance research into the role of O-antigens and other virulence factors, including their synergistic effect in the pathogenicity of this important food-borne pathogen.

Acknowledgments

This work was supported by the Shandong Provincial Natural Science Foundation General Project (grant number ZR2022MH318), the Tianjin Municipal Natural Science Foundation (grant number 17JCYBJC24300), and the National Key Program for Infectious Diseases of China (grant number 2017ZX10303405).

Fig. 1 Representation of the O-antigen genetic cluster of Y. enterocolitica WL-21, with the O-antigen structure of serotype O:10 [18] shown at the top (left), as well as the outer core gene cluster (right).

Fig. 2 LPS profiles of WL21 and its derivatives. LPS extracts were electrophoresed on sodium dodecyl sulfate–polyacrylamide gel electrophoresis gels, and stained by silver staining.

Lane 1, WL21 wide-type strain; lane 2, WL-21Δwzm; and lane 3, WL-21Δwzm::wzm.

Fig. 3 Representation of the O-antigen genetic clusters that have not been reported previously from uncommon serotypes.

Gene names are given (where possible) for the schematic of each serotype, as well as the genetic locus tag of each strain being provided. Serotype names are indicated on the left, with strain names in the brackets. The O-antigen structures of O:1, O:2, O:3 [13], and O10 [18] are also shown. Regions conserved between strains are indicated as light pink blocks. aThe O:3 antigen gene cluster is drawn from nucleotide sequence under accession number Z118920; bThe genome of IP2222 (O:36) was annotated in this study; *Truncated gene.

Fig. 4 Virulence profiles of strains with serotypes derived from GenBank data.

From left to right: virulence genes, with black indicating presence and white indicating absence; serotype highlighted in different colors; strain name with biotype from meta data if available. aPlasmid-borne genes.

Table 1 Strains, plasmids, and primers used in this study.

Strain/plasmid/primer	Description	
Strain		
WL-21	Yersinia enterocolitica 1A/O:10	
WL-21Δwzm	WL-21 wzm gene deletion	
WL-21Δwzm::wzm	WL-21Δwzm complemented with pBAD33-wzm	
S-17	Escherichia coli S17-1/λpir strain	
Plasmid		
pRE112	Allelic exchange vector with sacB, chloramphenicol resistant	
pRE112-updown	pRE112 fused with WL-21 wzm up- and down- homologous sequences	
pBAD33	araC, promoter PBAD, chloramphenicol resistant	
pBAD33-wzm	pBAD33 inserted with WL-21 wzm gene	
Primer	Nucleotide sequences (5'-3')a	
112F	TACACTCGTTAGCATTTACCAGCACCCTGATAAATGCTTCAATAATGG, forward primer for pRE112 linearization	
112R	TACAGCGGCTCCTACTGAGGGTCAACAGCTCATTTCAGAATGG, reverse primer for pRE112 linearization	
upF	CCATTATTGAAGCATTTATCAGGGTGCTGGTAAATGCTAACGAGTGTA, forward primer for wzy upload sequence	
upR	CTGAACCCACATAGGTAGAATAGATACACGAGCCACAGAGGTCCAAG, reverse primer for wzy upload sequence	
downF	CTTGGACCTCTGTGGCTCGTGTATCTATTCTACCTATGTGGGTTCAG, forward primer for wzy download sequence	
downR	CCATTCTGAAATGAGCTGTTGACCCTCAGTAGGAGCCGCTGTA, reverse primer for wzy download sequence	
wzm-cF	CGGGGTACCAGGAGGAAAAGTGAAAGAGATGTTATTAGCGAT, forward primer for wzm cloning, digested with KnpI	
wzm-cR	CCCAAGCTTTCATAATTCATCTACCATATCTTTG, reverse primer for wzm cloning, digested with HindIII	
aBoldface characters indicate the Shine–Dalgarno box, and restriction sites are in italics.

Table 2 Details of proposed functions of the putative WL-21 O-AGC.

orf No.	Gene name	Species (Accession No.)	% Identical/% Similar	Putative function of protein	
1	orf1	Y. enterocolitica (WP_005168322.1)	99/100	TerC family protein	
2	manC	Y. enterocolitica (WP_076707092.1)	98/99	Mannose-1-phosphate guanylyltransferase/ mannose-6-phosphate isomerase	
3	manB	Y. enterocolitica (WP_077174857.1)	99/100	Phosphomannomutase	
4	wzm	Y. enterocolitica (WP_260505577.1)	90/96	ABC transporter permease	
5	wzt	Y. enterocolitica (WP_221866130.1)	91/95	ABC transporter ATP-binding protein	
6	ubiG	Y. enterocolitica (WP_221866131.1)	70/81	Class I SAM-dependent methyltransferase	
7	gtr1	Y. enterocolitica (WP_221866132.1 )	79/89	Glycosyltransferase family 1 protein	
8	gmd	Y. enterocolitica (WP_221866133.1 )	98/99	GDP-mannose 4,6-dehydratase	
9	rmd	Y. enterocolitica (WP_076707088.1 )	93/96	GDP-mannose 4,6-dehydratase	
10	gtr2	Y. enterocolitica (WP_076707087.1 )	88/94	Glycosyltransferase family 1 protein	
11	gtr3	HDL6886110.1 )	93/97	Glycosyltransferase family 4 protein	

Author Contributions

B.H., J.W., L.L., B.Y.C., Conceptualization; B.H., Investigation; B.H., J.W., Q.W., Y.X.C., J.X.Y., Methodology; J.W., L.L., Q.W., Y.X.C., W.K.S., Formal analysis; J.W., L.L., Writing-Original Draft Preparation; J.L.Q., Software; B.Y.C., X.G., Review& Editing; B.Y.C., X.G., Supervision; B.H., X.G., Funding Acquisition.

Conflict of Interest

The authors have no financial conflicts of interest to declare.
==== Refs
References

1 Sabina Y Rahman A Ray RC Montet D 2011 Yersinia enterocolitica: mode of transmission, molecular insights of virulence, and pathogenesis of infection J. Pathog. 2011 429069 10.4061/2011/429069 22567333
2 Bottone EJ 1997 Yersinia enterocolitica: the charisma continues Clin. Microbiol. Rev. 10 257 276 10.1128/CMR.10.2.257 9105754
3 Bancerz-Kisiel A Szczerba-Turek A Platt-Samoraj A Michalczyk M Szweda W 2018 Characterisation of ail-positive Yersinia enterocolitica of different biotypes using HRMA Int. J. Food Microbiol. 269 46 51 10.1016/j.ijfoodmicro.2018.01.016 29421357
4 Bottone EJ 2015 Yersinia enterocolitica: revisitation of an enduring human pathogen Clin. Microbiol. Newslett. 37 1 8 10.1016/j.clinmicnews.2014.12.003
5 Fabrega A Vila J 2012 Yersinia enterocolitica: pathogenesis, virulence and antimicrobial resistance Enferm. Infect. Microbiol. Clin. 30 24 32 10.1016/j.eimc.2011.07.017 22019131
6 Whitfield C Williams DM Kelly SD 2020 Lipopolysaccharide O-antigens-bacterial glycans made to measure J. Biol. Chem. 295 10593 10609 10.1074/jbc.REV120.009402 32424042
7 Knirel Y Valvano M Bacterial Lipopolysaccharides Vienna: Springer 2011 1 20 10.1007/978-3-7091-0733-1
8 Liu B Furevi A Perepelov AV Guo X Cao H Wang Q 2020 Structure and genetics of Escherichia coli O antigens FEMS Microbiol. Rev. 44 655 683 10.1093/femsre/fuz028 31778182
9 Raymond CK Sims EH Kas A Spencer DH Kutyavin TV Ivey RG 2002 Genetic variation at the O-antigen biosynthetic locus in Pseudomonas aeruginosa J. Bacteriol. 184 3614 3622 10.1128/JB.184.13.3614-3622.2002 12057956
10 Liu B Knirel YA Feng L Perepelov AV Senchenkova SN Reeves PR 2014 Structural diversity in Salmonella O antigens and its genetic basis FEMS Microbiol. Rev. 38 56 89 10.1111/1574-6976.12034 23848592
11 Islam ST Lam JS 2014 Synthesis of bacterial polysaccharides via the Wzx/Wzy-dependent pathway Can. J. Microbiol. 60 697 716 10.1139/cjm-2014-0595 25358682
12 Greenfield LK Whitfield C 2012 Synthesis of lipopolysaccharide O-antigens by ABC transporter-dependent pathways Carbohydr. Res. 356 12 24 10.1016/j.carres.2012.02.027 22475157
13 Gorshkova RP Kalmykova EN Isakov VV Ovodov YS 1985 Structural studies on O-specific polysaccharides of lipopolysaccharides from Yersinia enterocolitica serovars O:1,2a,3, O:2a,2b,3 and O:3 Eur. J. Biochem. 150 527 531 10.1111/j.1432-1033.1985.tb09053.x 2410273
14 Gorshkova RP Kalmykova EN Isakov VV Ovodov YS 1986 Structural studies on O-specific polysaccharides of lipopolysaccharides from Yersinia enterocolitica serovars O:5 and O:5,27 Eur. J. Biochem. 156 391 397 10.1111/j.1432-1033.1986.tb09595.x 2422030
15 Kalmykova EN Gorshkova RP Isakov VV Ovodov I.uS 1988 The structure of O-specific polysaccharide from Yersinia enterocolitica serotype O:6.31 lipopolysaccharide Bioorg. Khim. 14 652 657 2458735
16 Zhang L Radziejewska-Lebrecht J Krajewska-Pietrasik D Toivanen P Skurnik M 1997 Molecular and chemical characterization of the lipopolysaccharide O-antigen and its role in the virulence of Yersinia enterocolitica serotype O:8 Mol. Microbiol. 23 63 76 10.1046/j.1365-2958.1997.1871558.x 9004221
17 Caroff M Bundle DR Perry MB 1984 Structure of the O-chain of the phenol-phase soluble cellular lipopolysaccharide of Yersinia enterocolitica serotype O:9 Eur. J. Biochem. 139 195 200 10.1111/j.1432-1033.1984.tb07994.x 6199199
18 Gorshkova RP Isakov VV Kalmykova EN Ovodov YS 1995 Structural studies of O-specific polysaccharide chains of the lipopolysaccharide from Yersinia Enterocolitica serovar O:10 Carbohydr. Res. 268 249 255 10.1016/0008-6215(94)00339-H 7537629
19 Garzetti D Susen R Fruth A Tietze E Heesemann J Rakin A 2014 A molecular scheme for Yersinia enterocolitica patho-serotyping derived from genome-wide analysis Int. J. Med. Microbiol. 304 275 283 10.1016/j.ijmm.2013.10.007 24246413
20 Skurnik M Bengoechea JA 2003 The biosynthesis and biological role of lipopolysaccharide O-antigens of pathogenic yersiniae Carbohydr. Res. 338 2521 2529 10.1016/S0008-6215(03)00305-7 14670713
21 Skurnik M Venho R Toivanen P al-Hendy A 1995 A novel locus of Yersinia enterocolitica serotype O3 involved in lipopolysaccharide outer core biosynthesis Mol. Microbiol. 17 575 594 10.1111/j.1365-2958.1995.mmi_17030575.x 8559076
22 Jacobsen NR Bogdanovich T Skurnik M Lubeck PS Ahrens P Hoorfar J 2005 A real-time PCR assay for the specific identification of serotype O:9 of Yersinia enterocolitica J. Microbiol. Methods 63 151 156 10.1016/j.mimet.2005.03.003 16226639
23 Rusak LA de Castro Lisboa Pereira R Freitag IG Hofer CB Hofer E Asensi MD 2018 Rapid detection of Yersinia enterocolitica serotype O:3 using a duplex PCR assay J. Microbiol. Methods 154 107 111 10.1016/j.mimet.2018.10.014 30366064
24 Bottone EJ 1999 Yersinia enterocolitica: overview and epidemiologic correlates Microbes Infect. 1 323 333 10.1016/S1286-4579(99)80028-8 10602666
25 Hunter E Greig DR Schaefer U Wright MJ Dallman TJ McNally A Jenkins C 2019 Identification and typing of Yersinia enterocolitica and Yersinia pseudotuberculosis isolated from human clinical specimens in England between 2004 and 2018 J. Med. Microbiol. 68 538 548 10.1099/jmm.0.000943 30888316
26 Bengoechea JA Najdenski H Skurnik M 2004 Lipopolysaccharide O antigen status of Yersinia enterocolitica O:8 is essential for virulence and absence of O antigen affects the expression of other Yersinia virulence factors Mol. Microbiol. 52 451 469 10.1111/j.1365-2958.2004.03987.x 15066033
27 al-Hendy A Toivanen P Skurnik M 1992 Lipopolysaccharide O side chain of Yersinia enterocolitica O:3 is an essential virulence factor in an orally infected murine model Infect. Immun. 60 870 875 10.1128/iai.60.3.870-875.1992 1311707
28 Seabaugh JA Anderson DM 2024 Pathogenicity and virulence of Yersinia Virulence 15 2316439 10.1080/21505594.2024.2316439 38389313
29 Felek S Krukonis ES 2009 The Yersinia pestis Ail protein mediates binding and Yop delivery to host cells required for plague virulence Infect. Immun. 77 825 836 10.1128/IAI.00913-08 19064637
30 Grützkau A Hanski C Hahn H Riecken EO 1990 Involvement of M cells in the bacterial invasion of Peyer's patches: a common mechanism shared by Yersinia enterocolitica and other enteroinvasive bacteria Gut 31 1011 1015 10.1136/gut.31.9.1011 2210445
31 Schmid Y Grassl GA Buhler OT Skurnik M Autenrieth IB Bohn E 2004 Yersinia enterocolitica adhesin A induces production of interleukin-8 in epithelial cells Infect. Immun. 72 6780 6789 10.1128/IAI.72.12.6780-6789.2004 15557598
32 Tennant SM Skinner NA Joe A Robins-Browne RM 2005 Homologues of insecticidal toxin complex genes in Yersinia enterocolitica biotype 1A and their contribution to virulence Infect. Immun. 73 6860 6867 10.1128/IAI.73.10.6860-6867.2005 16177365
33 Gierczyński R 2000 Evaluation of the usefulness of selected virulence markers for identification of virulent Yersinia enterocolitica strains. II. Genotypic markers associated with the pYV plasmid Med. Dosw Mikrobiol. 52 35 49 11107778
34 Peruzy MF Murru N Perugini AG Capuano F Delibato E Mercogliano R 2017 Evaluation of virulence genes in Yersinia enterocolitica strains using SYBR green real-time PCR Food Microbiol. 65 231 235 10.1016/j.fm.2017.03.004 28400007
35 Platt-Samoraj A Syczylo K Szczerba-Turek A Bancerz-Kisiel A Jablonski A Labuc S 2017 Presence of ail and ystB genes in Yersinia enterocolitica biotype 1A isolates from game animals in Poland Vet. J. 221 11 13 10.1016/j.tvjl.2017.01.013 28283072
36 Wannet WJ Reessink M Brunings HA Maas HM 2001 Detection of pathogenic Yersinia enterocolitica by a rapid and sensitive duplex PCR assay J. Clin. Microbiol. 39 4483 4486 10.1128/JCM.39.12.4483-4486.2001 11724866
37 Hassanzadeh P Ghasemzadeh Limoee E Nouri Gharajalar S 2022 Molecular detection, biotyping and serotyping of Yersinia enterocolitica isolated from chicken livers in Tabriz Comp. Immunol. Microbiol. Infect. Dis. 83 101777 10.1016/j.cimid.2022.101777 35228160
38 Zerbino DR Birney E 2008 Velvet: algorithms for de novo short read assembly using de Bruijn graphs Genome Res. 18 821 829 10.1101/gr.074492.107 18349386
39 Seemann T 2014 Prokka: rapid prokaryotic genome annotation Bioinformatics 30 2068 2069 10.1093/bioinformatics/btu153 24642063
40 Boratyn GM Camacho C Cooper PS Coulouris G Fong A Ma N 2013 BLAST: a more efficient report with usability improvements Nucleic Acids Res. 41 Web Server issue W29 W33 10.1093/nar/gkt282 23609542
41 Liu Y Xu T Wang Q Huang J Zhu Y Liu X 2022 Vibrio cholerae senses human enteric alpha-defensin 5 through a CarSR twocomponent system to promote bacterial pathogenicity Commun. Biol. 5 559 10.1038/s42003-022-03525-3 35676416
42 Wang J Xu Y Qin C Hu J Yin J Guo X 2021 Structural determination and genetic identification of the O-antigen from an Escherichia coli strain, LL004, representing a novel serogroup Int. J. Mol. Sci. 22 12746 10.3390/ijms222312746 34884549
43 Xie J Chen Y Cai G Cai R Hu Z Wang H 2023 Tree visualization by one table (tvBOT): a web application for visualizing, modifying and annotating phylogenetic trees Nucleic Acids Res. 51 W587 W592 10.1093/nar/gkad359 37144476
44 Cornelis GR Sluiters C Delor I Geib D Kaniga K Lambert de Rouvroit C 1991 ymoA, a Yersinia enterocolitica chromosomal gene modulating the expression of virulence functions Mol. Microbiol. 5 1023 1034 10.1111/j.1365-2958.1991.tb01875.x 1956283
45 Thomson NR Howard S Wren BW 2006 The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081 PLoS Genet. 2 e206 10.1371/journal.pgen.0020206 17173484
46 Young GM Badger JL Miller VL 2000 Motility is required to initiate host cell invasion by Yersinia enterocolitica Infect. Immun. 68 4323 4326 10.1128/IAI.68.7.4323-4326.2000 10858252
47 Brem D Pelludat C Rakin A Jacobi CA Heesemann J 2001 Functional analysis of yersiniabactin transport genes of Yersinia enterocolitica Microbiology (Reading) 147 1115 1127 10.1099/00221287-147-5-1115 11320115
48 Haller JC Carlson S Pederson KJ Pierson DE 2000 A chromosomally encoded type III secretion pathway in Yersinia enterocolitica is important in virulence Mol. Microbiol. 36 1436 1446 10.1046/j.1365-2958.2000.01964.x 10931293
49 Turkovicova L Smidak R Jung G Turna J Lubec G Aradska J 2016 Proteomic analysis of the TerC interactome: novel links to tellurite resistance and pathogenicity J. Proteomics 136 167 173 10.1016/j.jprot.2016.01.003 26778143
50 Samuel G Reeves P 2003 Biosynthesis of O-antigens: genes and pathways involved in nucleotide sugar precursor synthesis and Oantigen assembly Carbohydr. Res. 338 2503 2519 10.1016/j.carres.2003.07.009 14670712
51 Feng L Senchenkova SN Yang J Shashkov AS Tao J Guo H 2004 Synthesis of the heteropolysaccharide O antigen of Escherichia coli O52 requires an ABC transporter: structural and genetic evidence J. Bacteriol. 186 4510 4519 10.1128/JB.186.14.4510-4519.2004 15231783
52 Vinogradov E Frirdich E MacLean LL Perry MB Petersen BO Duus JO 2002 Structures of lipopolysaccharides from Klebsiella pneumoniae. Eluicidation of the structure of the linkage region between core and polysaccharide O chain and identification of the residues at the non-reducing termini of the O chains J. Biol. Chem. 277 25070 25081 10.1074/jbc.M202683200 11986326
53 Whitfield C Trent MS 2014 Biosynthesis and export of bacterial lipopolysaccharides Annu. Rev. Biochem. 83 99 128 10.1146/annurev-biochem-060713-035600 24580642
54 King JD Berry S Clarke BR Morris RJ Whitfield C 2014 Lipopolysaccharide O antigen size distribution is determined by a chain extension complex of variable stoichiometry in Escherichia coli O9a Proc. Natl. Acad. Sci. USA 111 6407 6412 10.1073/pnas.1400814111 24733938
55 Kenyon JJ Cunneen MM Reeves PR 2017 Genetics and evolution of Yersinia pseudotuberculosis O-specific polysaccharides: a novel pattern of O-antigen diversity FEMS Microbiol. Rev. 41 200 217 10.1093/femsre/fux002 28364730
56 Chen Y Bystricky P Adeyeye J Panigrahi P Ali A Johnson JA 2007 The capsule polysaccharide structure and biogenesis for non-O1 Vibrio cholerae NRT36S: genes are embedded in the LPS region BMC Microbiol. 7 20 10.1186/1471-2180-7-20 17362509
57 Guo X Liu B Chen M Wang Y Wang L Chen H Wang Y 2017 Genetic and serological identification of three Vibrio parahaemolyticus strains as candidates for novel provisional O serotypes Int. J. Food Microbiol. 245 53 58 10.1016/j.ijfoodmicro.2017.01.010 28129570
58 Gierczyński R 2000 Evaluation of the usefulness of selected virulence markers for identification of virulent strains of Yersinia enterocolitica strains. III. Chromosome markers of virulence Med. Dosw Mikrobiol. 52 51 65 11107779
59 Bhagat N Virdi JS 2007 Distribution of virulence-associated genes in Yersinia enterocolitica biovar 1A correlates with clonal groups and not the source of isolation FEMS Microbiol. Lett. 266 177 183 10.1111/j.1574-6968.2006.00524.x 17233728
60 Hein J Kempf VA Diebold J Bücheler N Preger S Horak I 2000 Interferon consensus sequence binding protein confers resistance against Yersinia enterocolitica Infect. Immun. 68 1408 1417 10.1128/IAI.68.3.1408-1417.2000 10678954
61 Brem D Pelludat C Rakin A Jacobi CA Heesemann J 2001 Functional analysis of yersiniabactin transport genes of Yersinia enterocolitica Microbiology (Reading) 147 1115 1127 10.1099/00221287-147-5-1115 11320115
62 Haller JC Carlson S Pederson KJ Pierson DE 2000 A chromosomally encoded type III secretion pathway in Yersinia enterocolitica is important in virulence Mol. Microbiol. 36 1436 1446 10.1046/j.1365-2958.2000.01964.x 10931293
63 Venecia K Young GM 2005 Environmental regulation and virulence attributes of the Ysa type III secretion system of Yersinia enterocolitica biovar 1B Infect. Immun. 73 5961 5977 10.1128/IAI.73.9.5961-5977.2005 16113317
64 Jiang L Yang W Jiang X Yao T Wang L Yang B 2021 Virulence-related O islands in enterohemorrhagic Escherichia coli O157:H7 Gut Microbes 13 1992237 10.1080/19490976.2021.1992237 34711138
65 Liu B Qian C Wu P Li X Liu Y Mu H 2021 Attachment of enterohemorrhagic Escherichia coli to host cells reduces O antigen chain length at the infection site that promotes infection mBio 12 e0269221 10.1128/mBio.02692-21 34903041
66 Qian C Huang M Du Y Song J Mu H Wei Y 2021 Chemotaxis and shorter O-antigen chain length contribute to the strong desiccation tolerance of a food-isolated Cronobacter sakazakii strain Front. Microbiol. 12 779538 10.3389/fmicb.2021.779538 35058898
