
==== Front
MicroPubl Biol
MicroPubl Biol
microPublication Biology
2578-9430
Caltech Library

10.17912/micropub.biology.001287
New Finding
Genetic Screens
S. Pombe
Characterization of a valproic acid-sensitive mutant allele of the Golgi GDP-mannose transmembrane transporter Vrg4 in Schizosaccharomyces pombe
Takasaki Teruaki 1
Yamada Minami 1
Ikeda Haruka 1
Fang Yue 2
Sugiura Reiko 1§
1 Department of Pharmaceutical Sciences, Faculty of Pharmacy, Kindai University, Osaka, Japan
2 Department of Microbial and Biochemical Pharmacy, School of Pharmacy, China Medical University, Shenyang, Liaoning, China

§ Correspondence to: Reiko Sugiura ( sugiurar@phar.kindai.ac.jp )
The authors declare that there are no conflicts of interest present.

23 8 2024
2024
2024 10.17912/micropub.biology.00128717 7 2024
10 8 2024
20 8 2024
Copyright: © 2024 by the authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Valproic acid (VPA) is a widely used drug for epilepsy. However, precise molecular mechanisms relevant to VPA's side effects remain elusive. This study identifies a VPA-sensitive mutant strain ( vas21 ) in fission yeast with a missense mutation (T256I) in the nucleotide sugar-binding motif of the GDP-mannose transporter Vrg4 . This mutation impairs protein glycosylation, as evidenced by altered acid phosphatase mobility. We also found that Vrg4 overexpression deteriorates cell growth. Our results highlight the role of Vrg4 in glycosylation and implicate impaired glycosylation as a potential mechanism underlying VPA sensitivity. The new allele of vrg4 will be useful in glycobiology and pharmacology.

This study was supported by JSPS KAKENHI Grant Numbers JP20K07058 (T.T.), JP24K09826 (T.T.) and JP19H03376 (R.S.). This work was also supported by a grant from the Antiaging Project for Private Universities (R.S.).
==== Body
pmc Figure 1. Characterization of valproic acid sensitive mutant vas21 A: Wild-type (WT) and vas21 mutant strains transformed with pREP1-GFP vector were streaked onto the Edinburgh Minimal Media (EMM) plus thiamine (EMMT) plates with or without 6 mM VPA and incubated for 3 days at 27°C. B: WT and vas21 strains were transformed with the control vector (pREP1-GFP) or the vector containing vrg4 + and spotted as indicated on the EMM or EMMT plates with or without 6 mM VPA in serial 10-fold dilutions. The plates were incubated for 3 days at 27 °C. C: DNA sequencing revealed a missense mutation in the vrg4-21 allele. The arrow indicates the single nucleotide change from C to T in the 265 th codon. D: Positional relationship of the vrg4-21 and vas4-1 mutation sites. The images of the predicted 3D structure were obtained from PomBase (www.pombase.org) (Jumper et al. 2021; Varadi et al. 2024; Rutherford et al. 2024). E: Acid phosphatase glycosylation in WT and vas21 mutant cells. Cell lysates were separated by 6% native polyacrylamide gel electrophoresis and acid phosphatase was stained with Fast Blue B salt and 1-naphthyl phosphate.

Description

Valproic acid (VPA, 2-n-propyl pentanoic acid) is a short-chain fatty acid that is widely prescribed as a medication for the treatment of epilepsy, bipolar disorders, and migraine prophylaxis (Linde et al. 2013; Romoli et al. 2019) . It was first approved for use as an antiepileptic agent in France in 1967 and is now approved in more than one hundred countries (Bhushan 2003) . Although VPA activity as an anti-convulsant is considered to be mediated by a rise in glutamatergic and γ-aminobutyric acid in the brain, recent progress unraveled novel pharmacological activities associated with VPA, including inhibition of histone deacetylases (HDACs) or blockade of voltage-gated ion channels. Thus, VPA has attracted increasing attention as a versatile drug with multifaceted mechanisms of action promising for various diseases, including certain types of cancers, mellitus, kidney disorders, neurodegenerative diseases, cardiovascular disorders, and muscular dystrophy (Singh et al. 2021) .

VPA can induce various side effects, including vomiting, heartburn, nausea, weight gain, dermatological side effects dosage-related tremors, and neurological side effects including ataxia, sleepiness, and irritability. It can also induce some serious disorders, such as thrombocytopenia, hyperammonemia, Parkinsonism, and birth defects (DiLiberti et al. 1984; Nau et al. 1991; Ibadova 2017; Baddour et al. 2018; Muralidharan et al. 2020) . Predicting a patient's response to VPA remains difficult, in part because the relevance between side effects and genetic predisposition is unclear.

To gain insight into the molecular basis that could influence VPA's efficacy and side effects, we have previously established a genetic screening for V alproic A cid S ensitive ( vas ) strains in fission yeast that had been mutagenized with nitrosoguanidine (Zhang et al. 2000) . This screening has successfully identified several mutations that were mapped to the vps45 , aps1 , and vrg4 loci (Miyatake et al. 2007; Ma et al. 2009; Qiao et al. 2021) . Vrg4 is a GDP-mannose transporter localized to the Golgi, which is crucial for glycoprotein modification (Bredeston et al. 2016) . One of our vas strains vas4-1 has been shown to harbor double missense mutations (S263 and A271) in the nucleotide sugar-binding motif of Vrg4 . Furthermore, although the two mutation sites had little effect on the overall structure of Vrg4 , they impaired the glycosylation of proteins, including the cell surface glycoprotein acid phosphatase (Qiao et al. 2021) . In this study, we identified another allele of vrg4 by analyzing the previously uncharacterized vas strain ( vas 21).

As shown in Figure 1A, the vas21 mutant strain grew similarly (only slightly slower) to the wild-type cells under normal culture conditions. However, the vas21 mutant cells exhibited a significant reduction in growth in the medium containing 6 mM VPA, a concentration that did not influence the growth of WT cells. To identify the mutated gene, we screened a fission yeast genomic library and cloned the vrg4 + gene that complements the VPA sensitivity of vas21 mutant cells. The result was confirmed by subcloning the vrg4 + gene into the thiamine-regulatable expression vector pREP1, which induces a wide dynamic range of expression, with low expression in the presence of thiamine and high expression in the absence of thiamine (Maundrell 1993; Moreno et al. 2000) . The growth defect of vas21 on the VPA-containing medium was fully recovered by transformation with the vector containing vrg4 + ( Figure 1B, middle panels). Therefore, considering the involvement of vrg4 + in the VPA sensitivity of vas21, we designated vas21 as vrg4-21. As an unexpected finding, high-level induction of Vrg4 deteriorated cell growth in both WT and vas21 cells despite the absence of VPA ( Figure 1B, right panels). Therefore, overexpression of Vrg4 may induce a toxic effect on cell growth.

To identify the mutation site, the vrg4 locus of the vrg4-21 allele was isolated by PCR amplification and subjected to Sanger sequencing. A single nucleotide change was identified at the 256th codon, which causes a substitution from the hydrophilic Thr residue to hydrophobic Ile in the nucleotide sugar-binding motif ( Figure 1C ). Notably, the mutated residue in vrg4-21 is located between the two mutated residues found in vas4-1 ( Figure 1D ).

Given that Vrg4 is a putative Golgi-located GDP-mannose transporter, we examined the impact of the vrg4-21 mutation on glycosylation. For this purpose, we analyzed the mobility of acid phosphatase—a well-documented substrate for N -linked glycosylation (Schwaninger et al. 1990) and a well-established marker for investigating impairments in glycosylation status induced by mutations (Huang and Snider 1995; Ohashi et al. 2020; Tanaka et al. 2021) —using native gel electrophoresis. We found that acid phosphatase isolated from vas21 mutant cells migrated signiﬁcantly faster than that from WT cells ( Figure 1E ), suggesting the impaired protein glycosylation in vas21 mutant.

Collectively, our data are consistent with the previous finding that the amino acid sequences in the nucleotide sugar-binding motif of Vrg4 are important for conducting proper glycosylation. However, it is still unclear why the malfunction of Vrg4 affects the sensitivity to VPA. In budding yeast, Vrg4 p is essential for cell wall integrity (CWI) and normal Golgi function, and the null mutant is lethal (Poster and Dean 1996; Dean et al. 1997) . Fission yeast ∆ vrg4 mutant cells also display severe growth defects with impaired cell wall synthesis, morphological aberrations, and agglutination tendencies (Bredeston et al. 2016) . Considering that the null mutants are more severe than the missense alleles, VPA may exert the toxic effect by further attenuating the reduced function of Vrg4 , for example, by suppressing the expression or localization of Vrg4 to the Golgi. Alternatively, the impaired glycosylation may cause sensitivity to VPA. In eukaryotes, glycosylation serves a crucial role in cell physiology and impacts numerous processes, including quality control during protein folding, protein trafficking, cell recognition, developmental signaling, and immune system function (Reily et al. 2019) . Further studies will need to clarify the cell physiology that affects VPA sensitivity.

Methods

Yeast strains and medium. S. pombe strains used in this study are listed in the Reagents section. Strains were grown in Edinburgh minimal medium (EMM) as described previously (Sabatinos and Forsburg 2010) . Unless otherwise stated, media were supplemented with 5 µM thiamine. Valproic acid was purchased from Sigma (St. Louis). Spot assays were performed three times with reproducible results.

Isolation of the vas21 mutant and identification of the mutation site. The vas21 mutant was identified through a screening of cells that had been mutagenized with nitrosoguanidine as previously described (Zhang et al. 2000) . vrg4 + gene was cloned by complementation test using an S. pombe genomic DNA library constructed by the method described previously (Beach et al. 1982) . vrg4-21 allele was amplified by PCR with oligonucleotides (CGGGATCCATGGATAATCATATGCTAAACC and GACTTTGACAGACTATCGCG) and the PCR products were analyzed by Sanger DNA sequencing by Macrogen Japan Corp. (Tokyo, Japan).

Acid phosphatase staining Acid phosphatase from ﬁssion yeast was separated by a non-denaturing polyacrylamide gel electrophoresis (PAGE) and stained as described in (Schweingruber et al. 1986) , with some modiﬁcations. Briefly, cells were grown in 20 ml of EMM medium to mid-log phase and then replaced with phosphate-free EMM followed by 7 h incubation at 27˚C to induce the production of acid phosphatase. Cells were then collected by centrifugation, washed once with 62.5 mM Tris-HCl (pH 6.8), and suspended in ice-cold lysis buffer (62.5 mM Tris-HCl, 1 mM EDTA, 2 mM phenylmethylsulfonyl ﬂuoride, 0.1 mM dithiothreitol and 10% glycerol, pH 6.8) and homogenized with glass beads using Multi-beads Shocker (Yasui Kikai, Osaka, Japan). The lysates were cleared by centrifugation at 15,000 rpm for 10 min. The supernatant was mixed with a one-third volume of 0.01% bromophenol blue, 15% glycerol and 62.5 mm Tris-HCl (pH 6.8). Samples were separated by native-PAGE (6% polyacrylamide) and the gels were immersed in 100 mM sodium acetate (pH 4.0) for 15 min and then stained with Fast Blue B salt and 1-naphthyl phosphate as described in (Miyatake et al. 2007) . The mobility assays for acid phosphatase were performed four times with reproducible results.

Reagents

Strains

	Genotype

	Reference

	
HM123

	h - leu1-32

	Lab stock

	
KP1331

	h - leu1-32 vrg4-21

	Lab stock

	
			
Plasmids

	Description

	Reference

	
pKB2728

	pREP1-GFP

	Lab stock

	
pKB4886

	pREP1-GFP- vrg4 +

	This study

	

Acknowledgments

We thank the members of Kuno Lab, Sugiura Lab, and Fang Lab for their discussion and technical support.
==== Refs
Baddour E Tewksbury A Stauner N 2018 3 26 Valproic acid-induced hyperammonemia: Incidence, clinical significance, and treatment management. Ment Health Clin 8 2 73 77 10.9740/mhc.2018.03.073 29955549
Beach D Piper M Nurse P 1982 Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation. Mol Gen Genet 187 2 0026-8925 326 329 10.1007/BF00331138 6294466
Bhushan V. Antiepileptic Drugs, Fifth edition Rene H Levy, Richard H Mattson, Brian S Meldrum, Emilio Perucca (Eds); Lippincott Williams and Wilkins, Philadelphia, USA, 2002, 900 pages, hardback, ISBN: 0-7817-2321-3. Eur J Paediatr Neurol. 2003;7(5):243
Bredeston LM Marino-Buslje C Mattera VS Buzzi LI Parodi AJ D'Alessio C 2016 9 1 The conundrum of UDP-Glc entrance into the yeast ER lumen. Glycobiology 27 1 0959-6658 64 79 10.1093/glycob/cww092 27587357
Dean N Zhang YB Poster JB 1997 12 12 The VRG4 gene is required for GDP-mannose transport into the lumen of the Golgi in the yeast, Saccharomyces cerevisiae. J Biol Chem 272 50 0021-9258 31908 31914 10.1074/jbc.272.50.31908 9395539
DiLiberti JH Farndon PA Dennis NR Curry CJ 1984 11 1 The fetal valproate syndrome. Am J Med Genet 19 3 0148-7299 473 481 10.1002/ajmg.1320190308 6439041
Huang KM Snider MD 1995 5 1 Isolation of protein glycosylation mutants in the fission yeast Schizosaccharomyces pombe. Mol Biol Cell 6 5 1059-1524 485 496 10.1091/mbc.6.5.485 7663020
Ibadova Rima 2017 6 1 Valproic acid-induced thrombocytopenia European Journal of Paediatric Neurology 21 1090-3798 e31 e31 10.1016/j.ejpn.2017.04.792
Jumper J Evans R Pritzel A Green T Figurnov M Ronneberger O Tunyasuvunakool K Bates R Žídek A Potapenko A Bridgland A Meyer C Kohl SAA Ballard AJ Cowie A Romera-Paredes B Nikolov S Jain R Adler J Back T Petersen S Reiman D Clancy E Zielinski M Steinegger M Pacholska M Berghammer T Bodenstein S Silver D Vinyals O Senior AW Kavukcuoglu K Kohli P Hassabis D 2021 7 15 Highly accurate protein structure prediction with AlphaFold. Nature 596 7873 0028-0836 583 589 10.1038/s41586-021-03819-2 34265844
Linde Mattias Mulleners Wim M Chronicle Edward P McCrory Douglas C 2013 6 24 Valproate (valproic acid or sodium valproate or a combination of the two) for the prophylaxis of episodic migraine in adults Cochrane Database of Systematic Reviews 2016 7 1465-1858 10.1002/14651858.cd010611
Ma Y Takeuchi M Sugiura R Sio SO Kuno T 2009 7 14 Deletion mutants of AP-1 adaptin subunits display distinct phenotypes in fission yeast. Genes Cells 14 8 1356-9597 1015 1028 10.1111/j.1365-2443.2009.01327.x 19624755
Maundrell K 1993 1 15 Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123 1 0378-1119 127 130 10.1016/0378-1119(93)90551-d 8422996
Miyatake M Kuno T Kita A Katsura K Takegawa K Uno S Nabata T Sugiura R 2007 2 7 Valproic acid affects membrane trafficking and cell-wall integrity in fission yeast. Genetics 175 4 0016-6731 1695 1705 10.1534/genetics.107.070946 17287531
Moreno MB Durán A Ribas JC 2000 6 30 A family of multifunctional thiamine-repressible expression vectors for fission yeast. Yeast 16 9 0749-503X 861 872 10.1002/1097-0061(20000630)16:9<861::AID-YEA577>3.0.CO;2-9 10861909
Muralidharan A Rahman J Banerjee D Hakim Mohammed AR Malik BH 2020 6 23 Parkinsonism: A Rare Adverse Effect of Valproic Acid. Cureus 12 6 2168-8184 e8782 e8782 10.7759/cureus.8782 32724733
Nau H Hauck RS Ehlers K 1991 11 1 Valproic acid-induced neural tube defects in mouse and human: aspects of chirality, alternative drug development, pharmacokinetics and possible mechanisms. Pharmacol Toxicol 69 5 0901-9928 310 321 10.1111/j.1600-0773.1991.tb01303.x 1803343
Ohashi T Tanaka T Tanaka N Takegawa K 2020 7 7 SpMnn9p and SpAnp1p form a protein complex involved in mannan synthesis in the fission yeast Schizosaccharomyces pombe. J Biosci Bioeng 130 4 335 340 10.1016/j.jbiosc.2020.06.003 32650974
Poster JB Dean N 1996 2 16 The yeast VRG4 gene is required for normal Golgi functions and defines a new family of related genes. J Biol Chem 271 7 0021-9258 3837 3845 10.1074/jbc.271.7.3837 8632002
Qiao S Luo X Wang H Fang Y Zhang L 2021 6 29 Cell wall integrity is compromised under temperature stress in Schizosaccharomyces pombe expressing a valproic acid-sensitive vas4 mutant. Sci Rep 11 1 13483 13483 10.1038/s41598-021-92466-8 34188069
Reily C Stewart TJ Renfrow MB Novak J 2019 6 1 Glycosylation in health and disease. Nat Rev Nephrol 15 6 1759-5061 346 366 10.1038/s41581-019-0129-4 30858582
Romoli M Mazzocchetti P D'Alonzo R Siliquini S Rinaldi VE Verrotti A Calabresi P Costa C 2019 Valproic Acid and Epilepsy: From Molecular Mechanisms to Clinical Evidences. Curr Neuropharmacol 17 10 1570-159X 926 946 10.2174/1570159X17666181227165722 30592252
Rutherford KM Lera-Ramírez M Wood V 2024 5 7 PomBase: a Global Core Biodata Resource-growth, collaboration, and sustainability. Genetics 227 1 0016-6731 10.1093/genetics/iyae007 38376816
Sabatinos SA Forsburg SL 2010 3 1 Molecular genetics of Schizosaccharomyces pombe. Methods Enzymol 470 0076-6879 759 795 10.1016/S0076-6879(10)70032-X 20946835
Schwaninger R Dumermuth E Schweingruber ME 1990 5 1 Effects of seven different mutations in the pho1 gene on enzymatic activity, glycosylation and secretion of acid phosphatase in Schizosaccharomyces pombe. Mol Gen Genet 221 3 0026-8925 403 410 10.1007/BF00259405 2381421
Schweingruber AM Schoenholzer F Keller L Schwaninger R Trachsel H Schweingruber ME 1986 7 1 Glycosylation and secretion of acid phosphatase in Schizosaccharomyces pombe. Eur J Biochem 158 1 0014-2956 133 140 10.1111/j.1432-1033.1986.tb09730.x 3732265
Singh D Gupta S Verma I Morsy MA Nair AB Ahmed AF 2021 8 25 Hidden pharmacological activities of valproic acid: A new insight. Biomed Pharmacother 142 0753-3322 112021 112021 10.1016/j.biopha.2021.112021 34463268
Tanaka N Kagami A Hirai K Suzuki S Matsuura S Fukunaga T Tabuchi M Takegawa K 2021 2 3 The fission yeast gmn2(+) gene encodes an ERD1 homologue of Saccharomyces cerevisiae required for protein glycosylation and retention of luminal endoplasmic reticulum proteins. J Gen Appl Microbiol 67 2 0022-1260 67 76 10.2323/jgam.2020.07.002 33536395
Varadi M Bertoni D Magana P Paramval U Pidruchna I Radhakrishnan M Tsenkov M Nair S Mirdita M Yeo J Kovalevskiy O Tunyasuvunakool K Laydon A Žídek A Tomlinson H Hariharan D Abrahamson J Green T Jumper J Birney E Steinegger M Hassabis D Velankar S 2024 1 5 AlphaFold Protein Structure Database in 2024: providing structure coverage for over 214 million protein sequences. Nucleic Acids Res 52 D1 0305-1048 D368 D375 10.1093/nar/gkad1011 37933859
Zhang Y Sugiura R Lu Y Asami M Maeda T Itoh T Takenawa T Shuntoh H Kuno T 2000 11 10 Phosphatidylinositol 4-phosphate 5-kinase Its3 and calcineurin Ppb1 coordinately regulate cytokinesis in fission yeast. J Biol Chem 275 45 0021-9258 35600 35606 10.1074/jbc.M005575200 10950958
