
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

71160
10.1038/s41598-024-71160-5
Article
PROTAC-mediated conditional degradation of the WRN helicase as a potential strategy for selective killing of cancer cells with microsatellite instability
Tejwani Vikram 1
Carroll Thomas 1
Macartney Thomas 1
Bandau Susanne 2
Alabert Constance 2
Saredi Giulia 1
Toth Rachel 1
Rouse John j.rouse@dundee.ac.uk

1
1 grid.8241.f 0000 0004 0397 2876 MRC Protein Phosphorylation and Ubiquitylation Unit, University of Dundee, Dundee, DD1 5EH UK
2 https://ror.org/03h2bxq36 grid.8241.f 0000 0004 0397 2876 Division of Molecular, Cell and Developmental Biology, School of Life Sciences, Wellcome Trust Biocentre, University of Dundee, Dundee, DD1 5EH UK
6 9 2024
6 9 2024
2024
14 208245 6 2024
26 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Multiple studies have demonstrated that cancer cells with microsatellite instability (MSI) are intolerant to loss of the Werner syndrome helicase (WRN), whereas microsatellite-stable (MSS) cancer cells are not. Therefore, WRN represents a promising new synthetic lethal target for developing drugs to treat cancers with MSI. Given the uncertainty of how effective inhibitors of WRN activity will prove in clinical trials, and the likelihood of tumours developing resistance to WRN inhibitors, alternative strategies for impeding WRN function are needed. Proteolysis-targeting chimeras (PROTACs) are heterobifunctional small molecules that target specific proteins for degradation. Here, we engineered the WRN locus so that the gene product is fused to a bromodomain (Bd)-tag, enabling conditional WRN degradation with the AGB-1 PROTAC specific for the Bd-tag. Our data revealed that WRN degradation is highly toxic in MSI but not MSS cell lines. In MSI cells, WRN degradation caused G2/M arrest, chromosome breakage and ATM kinase activation. We also describe a multi-colour cell-based platform for facile testing of selective toxicity in MSI versus MSS cell lines. Together, our data show that a degrader approach is a potentially powerful way of targeting WRN in MSI cancers and paves the way for the development of WRN-specific PROTAC compounds.

Keywords

WRN
Werner syndrome
MSI
Microsatellite instability
Cancer
PROTAC
Degrader
Subject terms

DNA
Targeted therapies
DNA damage response
DNA mismatch repair
DNA repair enzymes
http://dx.doi.org/10.13039/501100000265 Medical Research Council MC_UU_00038/5 http://dx.doi.org/10.13039/501100000289 Cancer Research UK CDF C57404/A21782 http://dx.doi.org/10.13039/501100000781 European Research Council Stg no. IDRE-715127 issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

To prevent the potentially genome-destabilizing effects of DNA damage, cells are equipped with a range of DNA damage repair (DDR) pathways. The DNA mismatch repair (MMR) pathway, for example, detects and repairs mismatches introduced during genome replication1,2. Efficient MMR requires the products of several key genes including MLH1, PMS2, MSH2 and MSH63. MSH2/6 dimers bind to mismatched base errors, while MLH1-PMS2 direct the excision step and fill-in synthesis4,5. Germline mutations in MMR genes cause diseases such as Lynch syndrome, which is associated with a predisposition to multiple cancers including colon and endometrial cancers6,7. In regions of the genome containing microsatellites—short tracts of repetitive sequences, inappropriate primer-template annealing and/or polymerase slippage can lead to insertion/deletions loops (IDLs) which can be repaired by MMR8,9. Microsatellites become unstable in MMR-defective cells, in the form of expansions that can be detected in PCR-based assays10. Microsatellite instability (MSI) has been observed in approximately 15% of all colorectal cancers, and in endometrial, ovarian and gastric cancers11,12. It has also been estimated that 22% of all western gastric cancers are MSI + . While it is not well understood whether genetic or environmental factors drive this phenomenon, gastric cancers occur at particularly high frequencies in South Korea (42 per 100K age-standardized rate), Mongolia (32 per 100K age-standardized rate), Japan (30 per 100K age-standardized rate), and China (23 per 100K age-standardized rate)13,14.

There are currently no therapies for MSI cancers that directly target deficiencies in the MMR system15,16. There is evidence however, that MSI tumours are amenable to immune checkpoint blockade17–20. For example, combinatorial blockage of cytotoxic T lymphocyte associated protein 4 (CTLA-4) and programmed cell death protein 1 (PD-1) checkpoint receptors led to increased progression-free survival (PFS) and overall survival (OS) rates in MSI colorectal cancer patients19,20. While it is not exactly clear why MSI tumours are more responsive to immune checkpoint blockade, increased neoantigen production in cells with MMR defects may potentiate this vulnerability17,18. Although MSI tumours are amenable to immune checkpoint blockade, there are examples of MSI colorectal cancer patients being refractory or having intrinsic resistance18,19,21. Furthermore, toxicity associated with immune checkpoint blockade agents in MSI patients is a major limitation22. Therefore, there is a need for novel therapies that exploit the vulnerabilities of MSI cancers.

Several independent studies recently identified a member of the RecQ family of helicases, the Werner syndrome helicase (WRN), as a “synthetic lethal” (SL) target in MSI cancer cells15,16,23,24. Depletion of WRN in MSI cells led to an increase in DNA double strand breaks (DSBs), alterations in cell cycle progression and a decrease in overall cell viability and proliferation compared with WRN-depleted microsatellite-stable (MSS) cells15,16,24. While it is not explicitly clear why MSI cells are so critically dependent on WRN for survival, recent studies suggest a link to the role of WRN at (TA)n dinucleotide repeats. These repeat sequences can self-anneal to form DNA cruciform structures, which are efficiently detected and removed by MMR25–27. In cells with MMR defects however, these structures accumulate and WRN activity becomes vital for resolving them25,26. When WRN is depleted from MSI cells, these cruciform structures are thought to persist into mitosis and are eventually cleaved by the SLX4 complex, leading to DNA breaks in regions of the genome that contain (TA)n repeats25–27. Furthermore, inhibiting WRN activity results in the helicase being trapped on chromatin and subsequently targeted for proteasomal degradation via the p97/VCP axis only in MSI but not MSS cell lines28.

Taken together, the findings described above point to WRN helicase as an exciting drug target for the treatment of MSI + cancers. The development of potent and specific WRN helicase inhibitors for cancer treatment is challenging in principle, not least because of the high level of similarity between the helicase domains of other RecQ family members29–31. There have been attempts made to generate translational small molecule inhibitors of WRN in the past like NSC1963032, ML21633 and NSC61714534. However, these molecules have failed to progress to clinical studies due to selectivity and potency issues31. More recently, high-throughput screens have yielded non-covalent35 and covalent36 small-molecule WRN inhibitors. Currently, there are at least two compounds, VVD-21437 and HRO76138 that are in early-stage clinical trials for WRN inhibition in MSI + cancers, and it remains to be seen how effective and well tolerated they are in patient populations.

Proteolysis-targeting chimeras (PROTACs) offer several distinct advantages over activity-based inhibitors39,40. PROTACS are heterobifunctional molecules comprised of a ligand for the protein of interest connected via a linker to an E3 ubiquitin ligase-recruiting ligand (Fig. 1A)—the VHL or CRBN substrate-targeting subunits of CRL-type E3 ligases being the most prevalent41,42. The degradation of the target protein is induced by the formation of a ternary complex between the PROTAC, the E3, and the target, resulting in target ubiquitination and degradation by the 26S proteasome. This can result in rapid and persistent depletion of the target protein42,43.Fig. 1 Using the Bd-Tag system to achieve conditional WRN degradation. (A) Schematic representing the mechanism of Bd-WRN degradation, upon addition of the AGB-1 PROTAC, via the 26S proteasome. (B) Representation of the WRN locus after CRISPR Cas/9 mediated knock-in of the Bd-Tag construct, comprised of EGFP for the purposes of selecting single cell clones where the construct has integrated in the genome, an IRES site and the Bd-Tag cassette, on the N-terminus of the WRN gene product.

Here, we describe a study wherein we engineered the WRN locus in MSI and MSS cell lines so that the WRN gene product is fused with a Bromo-domain (Bd)-tag. This is recognized by the AGB-1 PROTAC which recruits Bd-tagged proteins to the VHL subunit of the cullin RING ligase (CRL) CUL2VHL (Fig. 1A)44. Tagging WRN in this manner enabled rapid time- and dose-dependent WRN degradation upon addition of AGB-1 to cells, in a manner that was dependent on the 26S proteasome. WRN degradation was cytotoxic in MSI but not MSS cells, and was accompanied by DNA breakage, checkpoint activation and increased nuclear size. We also describe the development of a quantitative multicolour competition assay (MCA) for testing candidate compounds for preferential killing of MSI versus MSS cells. Our findings serve as a proof-of-concept that a PROTAC approach could be a suitable alternative to WRN inhibition, addressing an unmet clinical need for the treatment of MSI cancers.

Results

Conditional degradation of WRN in MSI and MSS cells

We used CRISPR/Cas9 to modify the WRN locus to add an inducible degron to the N-terminus of the WRN gene product. The Bd-tag is a modified Bromo-domain from Brd4 that binds to the small molecule proteolysis targeting chimera (PROTAC) AGB-1. This in turn, recruits the E3 ligase, VHL, to enable target degradation, in this case, WRN (Fig. 1A)44. Two MSS (SW620 and Caov-3) and two MSI (HCT-116 and SW48) cell lines were transfected with two plasmids encoding the WRN-specific sense and antisense guide (g) RNA pair, the Cas9 D10A nickase45,46 and a dsDNA donor construct bearing an EGFP tag for single cell isolation, an IRES and Bd-tag, flanked by homology arms to direct integration of the cassette at the WRN locus (Fig. 1B). After selecting GFP + cells by FACS, single cell clones were tested for AGB-1-dependent WRN degradation and candidate positive knock-in (KI) clones were verified using PCR analysis (Fig. S1A–F; see “Materials and methods”). Candidate Bd-WRN clones were then selected for further validation. As shown in Fig. 2A, Bd-WRN in HCT-116 clone 24 showed a 15 kDa size shift compared with the untagged form of WRN seen in parental cells. Exposure of HCT-116 clone 24 to increasing concentrations of AGB-1 induced a dramatic decrease in Bd-WRN band intensity, with maximal degradation observed at 100 nM (Fig. 2A, B). Similar dose response results were obtained for Bd-WRN in SW620 clone 1 and other HCT-116, SW620, Caov-3 and SW48 Bd-WRN cell lines (Figs. 2A, B, S2A, B and S3A). Treatment of cells with Cis-AGB-1, a derivative of AGB-1 containing cis- instead of trans-hydroxyproline which abrogates binding to VHL44, had no apparent effect on Bd-WRN band intensity. Time course experiments revealed rapid, time-dependent Bd-WRN degradation in all four cell lines, with maximal degradation evident between 1 and 2 h of AGB-1 exposure. Again, Cis-AGB-1 had no effect on Bd-WRN intensity even after 8 h and untagged WRN was not affected after treating parental cell lines with AGB-1 (Figs. 2A, C, S2A-D and S3A, B). Similar time course results were obtained for Bd-WRN in SW620 clone 1, and other HCT-116, SW620, Caov-3 and SW48 Bd-WRN cell lines (Figs. 2C, D, S2C, D and S3B).Fig. 2 Rapid, PROTAC-inducible and proteasome dependent WRN degradation in MSI HCT-116 clone 24 and MSS SW620 clone 1. (A) Representative SDS-PAGE and western blot analysis of lysates from HCT-116 clone 24 (top) and SW620 clone 1 (bottom) showing degradation of Bd-WRN with increasing concentrations of AGB-1, after 3 h of treatment. 3 h Cis-AGB-1 (1 μM) and DMSO (0.1%) treatments were used as controls. Blots from one of three biological repeats are shown. (B) Densitometric quantification of WRN normalised to the loading control, GAPDH in response to AGB-1 dose response in (A) for HCT-116 clone 24 (red) and SW620 clone 1 (green). Data are represented as mean ± SEM from three biological repeats (n = 3). (C) Western blot analysis showing the time-dependent degradation of Bd-WRN in the same clones as in (A), at a fixed AGB-1 concentration (0.3 μM). Parental cells were also included for each cell type. 8 h Cis-AGB-1 (1 μM) and DMSO (0.1%) treatments were used as controls. Blots from one of three biological repeats are shown. (D) Densitometric quantification of WRN normalised to the loading control, GAPDH in response to AGB-1 time course in (C) for HCT-116 clone 24 (red) and SW620 clone 1 (green). Data are represented as mean ± SEM from three biological repeats (n = 3). (E) Western blot analysis showing that AGB-1 mediated degradation of Bd-WRN is dependent on the proteasome in HCT-116 parental cells (P), clone 3 (untagged and Bd-tagged WRN) and clone 24 (Bd-tagged WRN only). Cells were preincubated for 1 h with the 26S proteasome inhibitor MG132 (50 μM) or the NEDDylation inhibitor MLN4924 (3 μM) or DMSO (0.1%) before treatment with 0.3 μM AGB-1 or Cis-AGB-1 for a further 3 h. Blots from one of three biological repeats are shown. Quantification (mean ± SEM) of WRN: GAPDH intensity from three biological repeats (n = 3) is shown in the panel below for HCT-116 P (gray) and HCT-116 clone 24 (red). (F) The same as in (E) done with SW620 parental cells (P), clone 40 (untagged and Bd-tagged WRN) and clone 1 (Bd-tagged WRN only). Quantification (mean ± SEM) of WRN: GAPDH intensity from three biological repeats (n = 3) is shown in the panel below for SW620 P (gray) and SW620 clone 1 (green).

AGB-1 recruits Bd-tagged target proteins to the cullin-based E3 ligase CUL2VHL which ubiquitylates target proteins for proteasomal degradation44. We next tested the dependence of Bd-WRN degradation on the 26S proteasome and on NEDDylation, a post-translational modification required for cullin activity47,48. As shown in Figs. 2E and S2E, degradation of Bd-WRN after AGB-1 exposure to HCT-116 clone 24 is blocked by the 26S proteasome inhibitor MG132 and by the NEDDylation inhibitor MLN4924. We also tested HCT-116 clone 3, which has both untagged and Bd-tagged WRN, revealing MG132 and MLN4924-sensitive degradation of Bd-WRN without affecting the untagged allele (Figs. 2E and S2E). Similar results were obtained with SW620 clone 1, and other HCT-116, SW620, Caov-3 and SW48 Bd-WRN cell lines (Figs. 2F, S2F and S4A–F). Thus, AGB-1 enables rapid, conditional, proteasome-dependent degradation of Bd-WRN in cells.

Conditional WRN degradation is cytotoxic in MSI cells but not in MSS cells

We next investigated the impact of conditional WRN degradation on the viability of MSI and MSS cell lines described above. We first compared HCT-116 (MSI) with SW620 (MSS) cells, testing parental cells and two independent clones for each cell line. When cells were subjected to increasing concentrations of AGB-1, but not Cis-AGB-1, for 72 h, HCT-116 Bd-WRN clones 24 and 44 showed a statistically significant, dose-dependent decrease in cell viability, with a maximal cytotoxic effect observed at around 100 nM (Fig. 3A). In contrast, AGB-1 had no significant effect on the viability of SW620 Bd-WRN clones analysed in parallel, or on parental HCT-116 cells (Fig. 3A). Blinded time course experiments (see “Materials and methods”) revealed that the viability of HCT-116 Bd-WRN clones had decreased significantly 48 h after AGB-1 exposure with maximal effects at 72 h, whereas SW620 cells were unaffected (Fig. 3B). Similar results were obtained when the Bd-WRN MSI cell line SW48 was compared with the Bd-WRN MSS cell line Caov-3 (Fig. 3C). Taken together, these data show that conditional PROTAC-mediated WRN degradation is a valid approach for treating MSI tumours.Fig. 3 WRN degradation is selectively toxic in MSI cancer cells. Cell viability was determined through MTT analysis, and “Cell Viability” was calculated by normalising values for Cis-AGB-1- or AGB-1-treated cells to DMSO treated cells. (A) HCT-116 parental (P) cells, and clones 24 and 44 and SW620 parental cells (P) and clones 1 and 17 were treated with increasing concentrations of Cis-AGB-1 (left) or AGB-1 (right) for 72 h and subjected to MTT assay. All values are mean ± SEM from 4 biological repeats (n = 4). (B) Same cells as in (A) were treated with Cis-AGB-1 (0.3 μM; left) or AGB-1 (0.3 μM; right) for 24 h, 48 h, 72 h and 96 h in a blind manner. All values are mean ± SEM from 3 biological repeats (n = 3). (C) SW48 parental (P) cells and clones 12 and 17 and Caov-3 parental (P) cells and clones 85 and 90 were treated with 0.3 μM of Cis-AGB-1 (left) or 0.3 μM AGB-1 (right) as in (B) except with an extra timepoint at 120 h. Datapoints shown represent mean ± SEM from 4 biological repeats (n = 4). Statistical significance was analysed through a one-way ANOVA with a Šidák post-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Conditional WRN degradation results in DNA double strand breaks, cell cycle arrest and DNA damage signalling in MSI cells but not MSS cells

To investigate the basis for cell death upon conditional WRN degradation in MSI cells, we checked genome integrity by measuring the levels of DNA double-strand breaks (DSBs). We used the formation of 53BP1 and γH2AX subnuclear foci as surrogate markers of DSBs49–51. We observed a striking, time-dependent increase in the proportion of cells with more than ten 53BP1 foci in both HCT-116 Bd-WRN clones (24 and 44) treated with AGB-1 but not Cis-AGB-1, reaching a maximum between 12 and 24 h (Fig. 4A). The maximal effect observed was similar in intensity to the effect of treating cells with low-dose aphidicolin that causes DNA replication stress and increased 53BP1 foci52. AGB-1 did not affect 53BP1 foci number in parental HCT-116 cells (Fig. 4A) or in SW620 cells expressing Bd-WRN (Fig. 4C). Similar results were obtained when γH2AX was used as a surrogate marker of DSBs (Fig. 4B, D). Representative images, from one biological repeat, used for γH2AX intensity and 53BP1 foci quantification after AGB-1 treatment in HCT-116 and SW620 Bd-WRN cells are shown in Figs. S5A and B. Labelling of cells with EdU revealed that after 24 h of AGB-1 treatment, most HCT-116 Bd-WRN cells are no longer in S-phase, instead accumulating in G2/M phases (Figs. 4E, F and S5C). Furthermore, there is a strong correlation between G2/M-arrested HCT-116 Bd-WRN cells and 53BP1 foci, 24 h after AGB-1 exposure (Fig. 4E, F). Increased DNA damage has been previously reported to contribute to increased nuclear size, perhaps due to resulting chromatin decondensation28,53,54. In accordance with this, we noted that after AGB-1 treatment, the G2/M-arrested population of HCT-116 Bd-WRN cells have enlarged nuclei—approximately 1.4 to 1.6 times larger nuclei than their Cis-AGB-1 treated counterparts (Fig. S5D). This was not observed in SW620 Bd-WRN cells.Fig. 4 WRN degradation in MSI, but not MSS, cells causes chromosome breaks. (A) Quantification of the % cells with ≥ 10 53BP1 foci in HCT-116 parental cells, clones 24 and 44. Cells were treated for 0 h, 2 h, 12 h or 24 h with Cis-AGB-1 (0.3 μM) or AGB-1 (0.3 μM) and pulsed with EdU for 30 min before the end of each timepoint. Aphidicolin (0.5 μM) treatment for 24 h was used as a positive control for 53BP1 foci number. (B) Quantification of mean γH2AX intensity in the same cells as in (A). Here, cells were treated with etoposide (25 μM) for 2 h as a positive control for γH2AX foci formation. Mean intensities for all timepoints and conditions were normalised to the value for Cis-AGB-1 at 0 h. Data are represented as mean ± SEM from four biological repeats (n = 4) with each repeat represented by a different symbol. (C), (D) Quantification of % cells with ≥ 10 53BP1 foci (C) and mean γH2AX intensity (D), in SW620 parental cells, clones 1 and 17. Statistical significance was analysed by comparing all timepoints to the 0 h timepoint within each treatment group (Cis-AGB-1 or AGB-1) through a one-way ANOVA with a Šidák post-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001. (E) Representative cell cycle analysis, from one biological repeat of HCT-116 parental cells, clones 24 and 44 and SW620 parental cells, clones 1 and 17 treated with Cis-AGB-1 (0.3 μM) or AGB-1 (0.3 μM) at 0 h. (F) Same as in (E) after 24 h of treatment. Each dot represents a single cell; colour-coding (red) indicates cells with more than 10 53BP1 foci. P indicated parental cells.

The ATM-CHK2 DNA damage response pathway is activated in response to DSBs51,55. Additionally, ATM mediated phosphorylation of SMC1 at Ser957 and Ser966 is a key event that drives pro-survival responses in cells that have accumulated DSBs56. Two HCT-116 Bd-WRN clones examined showed a significant time dependent increase in the levels of pCHK2 pThr68 and SMC1 pSer966, known markers of ATM activation, after exposure to AGB-1 but not Cis-AGB-1, with maximal induction evident at around 24 h (Figs. 5A, B and S6A, B). AGB-1 treatment had no significant effect on the levels of pCHK2 and pSMC1 in SW620 cells (Figs. 5C, D, and S6C, D). Taken together, the data above show that conditional WRN degradation caused DNA breakage, G2/M arrest, increased nuclear size, and DNA damage signalling in MSI but not MSS cells.Fig. 5 WRN degradation in MSI but not MSS, cells causes checkpoint activation. (A) Representative SDS-PAGE and western blot analysis of lysates from HCT-116 clone 24 treated with 0.3 μM AGB-1 for 0 h, 2 h, 4 h, 8 h or 24 h and blotted with WRN, pSMC1, total SMC1, pCHK2, total CHK2 and GAPDH, as a loading control. Blots from one of three biological repeats are shown. Cis-AGB-1 (0.3 μM) and DMSO (0.1%) treatments for 24 h were used as negative controls for WRN degradation. Cells treated with 5 grays (Gy) of ionising radiation (IR) were used as a positive control for SMC1 and CHK2 phosphorylation. Quantification (mean ± SEM) from all three repeats (n = 3) are shown alongside with pCHK2: total CHK2 (left) and pSMC1: total SMC1 (right). (B), (C), (D) same as in (A) for HCT-116 clone 44, SW620 clone 1 and SW620 clone 17, respectively. Statistical significance was analysed through a one-way ANOVA with a Dunnett post-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

A cell-based assay for monitoring the selective killing of MSI versus MSS cells

We sought to develop a method that would allow medium to high throughput screening of early stage WRN PROTACs—and other small molecule inhibitors—for selective toxicity in MSI versus MSS cells. To this end, we exploited the multi-colour cell-based assay (MCA) developed by others57, and adapted it to our purposes. To achieve this, HCT-116 (MSI) and SW620 (MSS) Bd-WRN cells were transduced with lentiviral vectors to induce stable expression of nuclear mCherry and BFP, respectively (Fig. 6A). mCherry HCT-116 MSI clones and BFP SW620 MSS clones were then isolated from the transduced pools via FACS and sensitivity of these clones to AGB-1 was verified by western blot (Fig. S7A–D). Clones were then mixed in a 1:1 ratio and grown for 48 h and 96 h in the presence of either Cis-AGB-1 or AGB-1, at which point, the ratio of mCherry to BFP cells was measured by flow cytometry. In the first experiment, mCherry HCT-116 Bd-WRN clone 24 was mixed with BFP SW620 Bd-WRN clone 1. As shown in Figs. 6B and S8A, exposure of this mixed population to AGB-1 led to selective, time-dependent elimination of the mCherry HCT-116 Bd-WRN clone 24, evident at 48 h and 96 h. Cis-AGB1 had no such effect. Similar data were obtained when using mCherry HCT-116 Bd-WRN clone 44 and BFP SW620 Bd-WRN clone 17 (Figs. 6C and S8B). Furthermore, AGB-1 treatment resulted in an equivalent or marginally greater elimination of the mCherry HCT-116 Bd-WRN cells when compared with HRO761 (Fig. 6D, E), an allosteric WRN inhibitor with a growth inhibitory 50% (GI50) of 40 nM, currently in phase I clinical trials for MSI colorectal cancers58. Therefore, the multicolour platform can be used for screening compounds, or gene deletions through CRISPR screens, that are selectively toxic in MSI cells compared with MSS cells.Fig. 6 A multicolour cell-based platform for screening compound toxicity in MSI versus MSS cells. (A) Schematic representation of the multicolour competition assay (MCA). HCT-116 and SW620 Bd-WRN clones were transduced with lentiviruses carrying either a mCherry or BFP nuclear localisation signal (NLS), respectively. Single cell clones were isolated from transduced pools via FACS. mCherry or BFP Bd-WRN clones were then mixed in a 1:1 ratio and the ratio of mCherry to BFP cells was measured at 0 h, 48 h and 96 h after treatment with either 0.3 μM Cis-AGB-1 or AGB-1. (B) Graph representing the ratio of mCherry HCT-116 Bd-WRN clone 24 to BFP SW620 Bd-WRN clone 1 at 0 h, 48 h and 96 h after treatment with 0.3 μM Cis-AGB-1 or 0.3 μM AGB-1 from four biological repeats (n = 4). Ratios at each timepoint were normalised to ratios at 0 h. (C) Graph representing the same as in (B) with mCherry HCT-116 Bd-WRN clone 44 and BFP SW620 Bd-WRN clone 17. (D) Graph representing the ratio of mCherry HCT-116 Bd-WRN clone 24 to BFP SW620 Bd-WRN clone 1 at 0 h, 48 h and 96 h after treatment with 0.1% DMSO (UT), 0.3 μM AGB-1 or 40 nM and 400 nM HRO761 from four biological repeats (n = 4). Ratios at each timepoint were normalised to ratios at 0 h. (E) Graph representing the same as in (D) with mCherry HCT-116 Bd-WRN clone 44 and BFP SW620 Bd-WRN clone 17. Data shown are means ± SEM and statistical significance was analysed through a one-way ANOVA with a Šidák post-test. *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Discussion

WRN helicase inhibitors are currently in clinical trials for treatment of solid tumours with MSI. In this study, we demonstrated that conditional degradation of WRN is a promising alternative approach for targeting WRN in MSI cancers. PROTAC-mediated WRN degradation had a selective and potently toxic effect on MSI cells compared with MSS cells, leading to high levels of chromosome breakage, G2/M phase arrest, activation of DNA damage signalling and increased nuclear size. These results make a strong case for screening compound libraries for ligands that bind to WRN to enable the development of WRN-specific PROTACs for the treatment of MSI cancers. Our data are consistent with another report that was published while the current study was in progress, which employed a D-tag to achieve conditional WRN degradation59.

While small molecule inhibitors dampen enzymatic activity through stoichiometric targeting of enzyme active sites, PROTACs act in a catalytic manner because they can participate in multiple successive rounds of target degradation41. Besides this feature, there are a range of other advantages to PROTACs such as enhanced target selectivity, and a decreased likelihood of mutation-induced drug resistance. Recent studies have shown that PROTACs specific for the oestrogen receptor60 or for BET domain proteins61–63 markedly attenuate cancer progression in xenograft models. Furthermore, PROTACs that target receptor tyrosine kinases result in stronger inhibition of cancer cell proliferation compared to small molecule activity-based kinase inhibitors64. From this point of view, it would be highly desirable to develop a WRN-specific PROTAC. We have developed a multi-colour assay platform that will enable facile, high-throughput testing of candidate WRN PROTACs for selective toxicity towards MSI versus MSS cells. This platform could be used, in principle, to carry out genome wide CRISPR screening for alternative targets to WRN that could be used to selectively kill MSI cancer cells. Regulators of WRN function fall into this category, or factors that influence the stability of the cruciform structures that arise at TA nucleotide repeats in MSI cells, for example.

It remains to be seen how well small molecule WRN helicase inhibitors perform in clinical trials, and whether off target effects will lead to toxicity. Either way, drug resistance could be a major issue for the clinical use of WRN helicase inhibitors; the major limitation of PARP inhibitors, for example, is the emergence of drug resistance in tumours exposed to these drugs65. Not only might WRN degraders be more potent in killing MSI cancers, but they could also be used to treat MSI tumours that become resistant to helicase inhibitors.

Materials and methods

Plasmids, oligonucleotides, and antibodies

All plasmids used in this study are listed in Table 1. These plasmids were designed and synthesised by the MRC PPU, University of Dundee. Plasmid sequences, maps and constructs can be obtained from https://mrcppureagents.dundee.ac.uk/, except for the pLenti-mCherry-NLS which was obtained from66. Primers used for junction PCRs and genotyping clones are listed in Table 2. All primary and secondary antibodies used in this study are listed in Tables 3, 4, 5, 6.Table 1 List of plasmids and CRISPR guides used in this project.

Construct	Vector	
Bd-Tag WRN Anti-sense + Cas9 (D10A)	pX335	
Bd-Tag WRN Donor	pMK	
Bd-Tag WRN Sense + Puro	pBABED	
BFP-NLS	pLenti	
mCherry-NLS66	pLenti	
VSV-G	pCMV	
VSV-GP (lenti gag and pol)	pCMV	

Table 2 List of primers used in this project.

Primer	Direction	Sequence (5′–3′)	
Bd-Tag	Fwd	GCATCCTCAAGGAGATGTTTGCC	
Rev	ACTTGATTGTGCTCATGTCCATGG	
EGFP	Fwd	GCATCAAGGTGAACTTCAAGATCCG	
Rev	CTCGTTGGGGTCTTTGCTCAGG	
IRES	Fwd	CTGTCTTCTTGACGAGCATTCCTAGG	
Rev	CTTGCATTCCTTTGGCGAGAGG	
M13	Fwd	GTAAAACGACGGCCAGTG	
Rev	GGAAACAGCTATGACCATG	
WRN Nter	Fwd	ACTTGAATTTTGGTTTACATTGAGGAGTC	
Rev	GATCCAGTGAATTCTAAGAAGGGGAGG	
WRN Nter2	Fwd	AGTATGAGTCATATCAGGGTACGGATCC	
Rev	TCAAAAACACTCTTCCGAACACATGC	

Table 3 List of primary antibodies used for western blots in this project.

Target Protein/Name	Species	Dilution	Manufacturer	Catalogue No	
CHK2 (D9C6)	Rabbit	1:5000	Cell Signalling	6334S	
GAPDH	Rabbit	1:10,000	Cell Signalling	2118S	
Phospho CHK2 (Thr68)	Rabbit	1:5000	Cell Signalling	2661S	
Phospho SMC1 (S966)	Rabbit	1:5000	Bethyl	A300-050A	
SMC1 (8E6)	Mouse	1:5000	Cell Signalling	6892S	
WRN Monoclonal [195C]	Mouse	1:5,000	Abcam	Ab241545	
α-Tubulin (DM1A)	Mouse	1:10,000	Cell Signalling	3873S	

Table 4 List of primary antibodies used for immunofluorescence in this project.

Target Protein/Name	Species	Dilution	Manufacturer	Catalogue No	
53BP1	Rabbit	1:5000	Novus Bio	NB100-304	
Phospho γH2AX (S139)	Mouse	1:2000	Merck	05–636	

Table 5 List of secondary antibodies used for western blots in this project.

Name	Species	Dilution	Manufacturer	Catalogue No.	
Anti-Mouse 680	Goat	1:10,000	LI-COR	926-68070	
Anti-Mouse 680	Donkey	1:10,000	LI-COR	926-68072	
Anti-Mouse 800	Goat	1:10,000	LI-COR	926-32210	
Anti-Mouse 800	Donkey	1:10,000	LI-COR	926-32212	
Anti-Rabbit 680	Goat	1:10,000	LI-COR	926-68071	
Anti-Rabbit 680	Donkey	1:10,000	LI-COR	926-68073	
Anti-Rabbit 800	Goat	1:10,000	LI-COR	926-32211	
Anti-Rabbit 800	Donkey	1:10,000	LI-COR	926-32213	

Table 6 List of secondary antibodies used for immunofluorescence in this project.

Name	Species	Dilution	Manufacturer	Catalogue No.	
Anti-Mouse Alexa Fluor™ 488	Donkey	1:1000	Thermo Fisher	A-21202	
Anti-Rabbit Alexa Fluor™ 546	Goat	1:1000	Thermo Fisher	A-11035	

Cell culture

HEK293 FT cells, and HCT-116, SW620 and SW48 colorectal cancer cells were obtained from the MRC PPU stocks at University of Dundee. Caov-3 ovarian cancer cells were kindly provided by Gillian Smith, Jacqui Wood Cancer Centre, Dundee. HEK293 FT, SW620 and SW48 cells were cultured in DMEM (Sigma). HCT-116 and Caov-3 cells were maintained in McCoy’s 5A (sigma) and RPMI (Gibco) media, respectively. All media were supplemented with 10% (v/v) foetal bovine serum (FBS) (Gibco), 1% (v/v) penicillin/streptomycin (pen/strep) (Gibco) and 2 mM L-glutamine (Gibco). DMEM was also supplemented with 1 mM sodium pyruvate (Gibco) and 1X Non-Essential Amino Acids (NEAA) (Gibco). RPMI was supplemented with 20% (v/v) FBS. All cells were grown at 37 °C, 5% CO2, and 95% humidity. Cells were regularly checked to be negative for Mycoplasma contamination.

Generating Bd-tagged WRN knock-in cell lines

Approximately 1 × 106 HCT-116, SW620, SW48 and Caov-3 cells were seeded in 10 cm cell culture dishes 24 h prior to transfection. Cells were transfected using 20 μg PEI (Polysciences), 3 μg of the pMK vector containing the knock-in EGFP-IRES-BdTag-WRN donor sequence, 1 μg of the px335 vector containing the antisense sgRNA (5′-TTCTGCACATTCATCCATTC) and spCas9n (D10A) expression cassette and 1 μg of the pBabeD P U6 Puro vector containing the sense sgRNA (5′-ATGTGCTGTAGAAGAAAGAA) and puromycin resistance expression cassette (Table 1). The pMK donor plasmid consisted of a pair of homology arms 518 bp upstream and 594 bp downstream of the N-terminal WRN insertion site. The next day, 2 μg/ml of puromycin was added to cell media to begin selection. After 48 h of puromycin selection, cells were washed with PBS and replenished with fresh media without puromycin. Cells were allowed to recover in normal media for 1 week prior to cell sorting.

Single cell cloning

Genome edited knock-in cell pools were harvested using 0.05% Trypsin–EDTA (Gibco) and resuspended in DMEM supplemented with 1% FBS and 100 μg/ml Normocin (Invivogen) to a concentration of approximately 5 × 106 cells/ml. Fluorescence Activated Cell Sorting (FACS) was performed using an MA900 cell sorter (Sony Biotechnology), equipped with a 130nm nozzle. Forward angle light scatter (FSC) and back scatter (BSC) were generated using a 488nm laser and detected using 488 ± 17nm band pass filters. Cells were distinguished from debris based on FSC-Area(A) and SSC-A measurements. Single cells were distinguished from doublets and clumps based on FSC-A and FSC-Width (W) measurements. Co-linear 488nm laser was used to excite GFP and fluorescence was detected using a 525 ± 50nm band pass filter. 561nm and 405nm lasers were used to excite mCherry and BFP and fluorescence was detected using 617 ± 30 and 450 ± 50 band pass filters, respectively. Positive cells were identified by assessing the background autofluorescence of control (untransfected) cells which did not express fluorescent proteins. Single positive cells were sorted into individual wells of a 96-well plate containing 200 μl of 50% pre-conditioned media obtained from healthy cells and 50% fresh media (20% FBS) according to the cell type. Due to low efficiency of transfection with the Bd-WRN SW48 cells, transfected cell pools were bulk sorted for GFP expression first using the standard semi-purity mode, expanded, and re-sorted for GFP to isolate single cell clones as above. After FACS, plates were spun at 1000 rpm for 3 min and clones were left to grow at 37 °C, 5% CO2, and 95% humidity for 3 weeks. All surviving colonies were expanded and analysed via western blotting and PCR strategies to detect Bd-WRN or through flow cytometry to detect mCherry and BFP clones.

Cell lysis and protein quantification

Cells were lysed in ice cold RIPA buffer comprised of 50 mM Tris–HCl (pH 8.0), 1 mM EDTA, 0.5 mM EGTA, 0.1% SDS, 0.1% Sodium deoxycholate, 150 mM NaCl, 0.5 U/ml Pierce Universal Nuclease (Thermo Fisher), 1:10,000 Microcystin-Lr (Enzo), 1:100 Phosphatase Inhibitor Cocktail (Sigma-Aldrich) and 1 × Complete EDTA-free Protease Inhibitor (Roche). Lysates were incubated on ice for 30 min and then cleared by centrifugation at 17,000 xg for 10 min. Protein concentration was estimated using the Pierce™ BCA Protein Assay kit (Thermo Fisher) according to the manufacturer’s instructions.

SDS-PAGE and western blotting

Lysates were incubated with 1/4 volume 4X NuPAGE® LDS Sample Buffer (Invitrogen) supplemented with 2.5% (v/v) β-mercaptoethanol and boiled at 95 °C for 5 min. Protein samples were separated by SDS-PAGE (50 μg/well) using NuPAGE® 3–8% Tris–Acetate gels (Thermo Fisher) at 110V for 1 h and 10 min. PageRuler™ Prestained Protein Ladder (Thermo Fisher) was used as a marker for molecular weight. Proteins were then transferred onto an Amersham Protran 0.45 μM nitrocellulose membrane (Cytiva) at a constant voltage of 90V for 1.5 h using 25 mM Tris, 192 mM Glycine and 20% Methanol. Membranes were then blocked for 30 min in 5% milk TBS-T (20 mM Tris, 150 mM NaCl, 0.2% Tween® 20 (v/v)). Protein detection was carried out by incubating primary antibodies (Table 3), diluted in 5% milk TBS-T for non-phospho antibodies or 5% BSA TBS-T for phospho antibodies, overnight at 4 °C. The next day, membranes were washed thrice for 5 min in TBS-T before incubating with secondary antibodies (Table 5), diluted in 5% milk TBS-T for non-phospho antibodies or 5% BSA TBS-T for phospho antibodies, for 1 h at RT. Membranes were then washed thrice for 5 min in TBS-T, imaged using Odyssey CLx Scanner (LI-COR) and subsequently analysed in Empiria Studio v. 2.3 (LI-COR). When indicated, quantification of western blot bands was performed using ImageJ (v1.53), normalizing the intensity of the relevant target protein band to the corresponding loading control.

Genomic DNA extraction

Cells were pelleted at 1500 rpm for 5 min and genomic DNA was extracted using the DNeasy Blood & Tissue Kit (Qiagen) according to the manufacturer’s instructions. DNA concentration was estimated on NanoDrop™ Spectrophotometer (Thermo Fisher).

Junction PCR amplification of targeted WRN locus

The knock-in (KI) target region for parental or Bd-WRN HCT-116, SW620, SW48 and Caov-3 clones was amplified using 300 ng of DNA template and the PrimeSTAR® GXL DNA Polymerase (Takara Bio) according to the manufacturer’s instructions using a C1000 Touch Thermal Cycler (BioRad). Primers used included the Nter2 flanking primers (binding outside of the homology regions) or Nter2 Fwd and GFP Rev or bdTAG Fwd and Nter2 Rev (Table 2).

Agarose gel electrophoresis

10 μl of PCR products were mixed with 1/6 volume Gel Loading Dye, Purple (6x) (NEB) and loaded on a 1% (w/v) agarose gel in Tris–acetate-EDTA (TAE) buffer (40 mM Tris, 20 mM acetic acid, 1 mM EDTA, pH 8.0) with 1X SYBR™ Safe DNA Gel Stain (Thermo Fisher). 7 μl of 1 kb Plus DNA Ladder (Thermo Fisher) was used as a marker for size of DNA samples. DNA samples were separated through electrophoresis in TAE buffer at 100V for 45 min and gels were imaged using U:Genius2 Gel documentation system (Syngene).

Genotyping Bd-WRN knock-in clones

Following junction PCR amplification of the KI target region, PCR products generated with the Nter2 flanking primers (Table 2) were ligated into the pSC-B-amp/kan blunt end cloning vector using the StrataClone Blunt PCR Cloning Kit (Agilent), according to manufacturer’s instructions. Ligated vectors were transformed into the provided Cre recombinase proficient StrataClone SoloPack competent cells, plated on 100 μg/ml ampicillin agar plates and incubated at 37 °C overnight. The next day, 12–15 single colonies were picked per KI cell clone and grown overnight in 5 ml LB media supplemented with 100 μg/ml ampicillin at 37 °C, shaking. After 24 h, bacterial cultures were pelleted at 5000 rpm for 15 min and sent to DNA Sequencing and Services (University of Dundee) for genomic DNA minipreps. Subsequently, DNA sequencing was performed by DNA Sequencing & Services (MRC PPU, School of Life Sciences, University of Dundee, Scotland, www.dnaseq.co.uk) using Applied Biosystems Big-Dye Ver 3.1 chemistry on an Applied Biosystems model 3730 automated capillary DNA sequencer using M13 F and R, Bd-Tag R and IRES R primers (Table 2).

Dose–response WRN degradation assays

After genotypic and western blot analysis, 5 × 105 parental or Bd-WRN clones were plated in 6-well plates in 2 ml of cell culture media and grown at 37 °C, 5% CO2, and 95% humidity. 24 h later, AGB-1 (Tocris Bioscience) reconstituted in DMSO was added to the cells at the following final concentrations: 1000 nM, 300 nM, 100 nM, 30 nM, 10 nM, 3 nM, and 1 nM. Each clone and parental cells were also incubated with 0.1% DMSO and 1000 nM Cis-AGB-1 (Tocris Bioscience) as controls. Cells were treated for 3 h and then harvested with 0.05% Trypsin–EDTA (Gibco), lysed and analysed via western blotting.

Time course WRN degradation assays

Approximately 5 × 105 parental or Bd-WRN clones were plated in 6-well plates in 2 ml of cell culture media and grown at 37 °C, 5% CO2, and 95% humidity. 24 h later, AGB-1 was added to cells at a final concentration of 300 nM. Each Bd-WRN clone and parental cells were also incubated with 0.1% DMSO and 300 nM Cis-AGB-1. Cells were harvested at 0 h, 0.5 h, 1 h, 2 h, 4 h and 8 h after treatment, lysed and analysed via western blotting. DMSO and Cis-AGB-1 treated cells were harvested after 8 h of treatment only.

Proteasome dependence of Bd-WRN degradation

Approximately 5 × 105 parental or Bd-WRN clones were plated in 6-well plates in 2 ml of cell culture media and grown at 37 °C, 5% CO2, and 95% humidity. Clones analysed either had untagged and Bd-tagged WRN or only Bd-tagged WRN. 24 h later, cells were pre-treated with either 3 μM of MLN4924 (Active Biochem), 50 μM of MG132 (Sigma) or 0.1% DMSO for 1 h. Pre-treated cells were then incubated with either 300 nM AGB-1, 300 nM Cis-AGB-1 or 0.1% DMSO in the presence of MLN4924 or MG132 for a further 3 h. Cells were then harvested with 0.05% Trypsin–EDTA (Gibco), lysed and analysed via western blotting.

Cell viability assays

Viability assays were conducted in pairs comprised of one MSI and one MSS cell line—HCT-116 and SW620 cells were the first pair and SW48 and Caov-3 were the second pair. For each MSI-MSS pair, between 2 × 103 and 5 × 103 parental and two Bd-WRN clones per cell type were plated in duplicate, in a 96-well plate in 50 μl of their respective cell culture media and grown at 37 °C, 5% CO2, and 95% humidity. For dose response assays, 24 h after plating, 50 μl of media supplemented with 2X DMSO (0.1% final) or 2X concentrations of AGB-1 and Cis-AGB-1 at final concentrations ranging from 1000 nM, 300 nM, 100 nM, 30 nM, 10 nM, and 0 nM were added to the relevant wells. Cells were then incubated at 37 °C, 5% CO2, and 95% humidity for 72 h, after which, cell viability was assessed. For time course assays, 24 h after plating, 50 μl of media supplemented with 2X DMSO (0.1% final) or 2X AGB-1 (300 nM final) and Cis-AGB-1 (300 nM final) were added to relevant wells. Cells were then incubated at 37 °C, 5% CO2, and 95% humidity for 24 h, 48 h, 72 h and 96 h. The SW48 and Caov-3 pair was grown till an extra timepoint of 120 h. DMSO, AGB-1 Cis-AGB-1 was replaced in plates every 48 h. Time course cell viability assays were performed in a blind manner, with the identities of DMSO, Cis-AGB-1 and AGB-1 anonymised as compounds 1, 2 and 3 by other lab members. To measure cell viability at each time point, 20 μl/well of CellTiter®-Glo 2.0 Cell Viability Assay Reagent (Promega) was added per well. Plates were gently shaken and incubated at 37 °C, 5% CO2, and 95% humidity for 2.5 h. Absorbance at 490 nm (A490) was then measured on the Epoch microplate spectrophotometer (BioTek). Raw absorbance values were converted to percentage cell viability by normalising AGB-1 and Cis-AGB-1 readouts to the DMSO control condition for each respective cell type at each concentration or timepoint.

Investigating checkpoint activation (pCHK2 and pSMC1 analysis)

5 × 105 Bd-WRN HCT-116 and SW620 clones were plated in 6-well plates in 2 ml of cell culture media and grown at 37 °C, 5% CO2, and 95% humidity. 24 h later, AGB-1 was added to cells at a final concentration of 300 nM. Each clone was also incubated with 0.1% DMSO and 300 nM Cis-AGB-1 as controls. Cells were harvested at 0 h, 2 h, 4 h, 8 h and 24 h after treatment, lysed and analysed via western blotting. DMSO and Cis-AGB-1 treated cells were harvested after 24 h only. Immediately after adding compounds, a separate plate of cells were irradiated with a 36.52 TBq Cesium-137 ionising radiation (IR) source with a dose of 5 grays (Gy) as a positive control for checkpoint activation. After irradiation, cells were returned to the incubator for 30 min before harvesting. All cells were then lysed and analysed via western blotting.

Immunofluorescence

2 × 104 HCT-116 parental and Bd-WRN clones and 3 × 104 SW620 parental and Bd-WRN clones were seeded in triplicate in CELLSTAR μClear 96-well plates (Greiner) with 50 μl of media. The next day, 50 μl of media supplemented with 2X of compounds AGB-1 (300 nM final), Cis-AGB-1 (300 nM final), Etoposide (25 μM final) (Sigma) or Aphidicolin (0.5 μM final) (Thermo Fisher) were added to the relevant wells. Cells were treated for 0 h, 2 h, 12 h or 24 h; Etoposide and Aphidicolin treatments were done for 2 h and 24 h, respectively. During the last 30 min of each timepoint, cells were incubated with 10 μM EdU. Cells were then fixed with 100 μl/well of 4% paraformaldehyde (Thermo Fisher) for 15 min at RT and then permeabilised with 100 μl/well of 1% Triton X-100-PBS for 5 min. Click-IT reaction was performed for 90 min with 100 μl/well of 10 mM CuSO4, 1.875 μM AlexaFluor™ 647-Azide (Thermo Fisher) and 10 mM Ascorbic acid made up in PBS. Cells were washed and blocked for 1 h with 100 μl/well blocking buffer (PBS, 1% BSA, 0.2% Triton X-100). Primary antibodies for γH2AX and 53BP1 (Table 4) were made up in blocking buffer, and 70 μl/well was added to wells and left overnight at 4 °C. The next day, wells were washed, and relevant secondaries (Table 6) were made up with 10 μg/ml of DAPI in blocking buffer and 70 μl/well added to wells for 1 h. Wells were washed, and then imaged using an Olympus ScanR high-content automated microscope with a × 20 objective. For each well, 25 fields were imaged and between 2000–12,000 cells per condition. Analysis was performed using the Scan-R analysis software and graphs were generated using GraphPad Prism 10 or with R Statistical Software (V 4.1.0, R Core team, 2021) using the ggplot library for visualisation.

Lentiviral production and transduction

2 × 106 HEK293 FT packaging cells were plated in a 10 cm dish and the next day, cells were transfected with 30 μg PEI, 3.25 μg VSV-GP (MRC PPU, University of Dundee), 1.75 μg VSV-G (MRC PPU, University of Dundee) and 5 μg of either pLenti-mCherry-NLS or pLenti-BFP-NLS (Table 1). pLenti-mCherry-NLS was obtained from66. AgeI and BamHI were used to replace mCherry-NLS with a TagBFP-NLS construct to generate the pLenti-BFP-NLS plasmid. After 24 h, 5 × 105 Bd-WRN HCT-116 and SW620 clones were seeded in 6-well plates and media of the packaging cells were replaced with media of target cell line to be transduced. The next day, target cells were treated with 8 μg/ml of polybrene (Merck) for 2 h and 0, 0.1, 0.5, 1, 1.5 or 2 ml of filtered viral supernatant was added to target cells to a final volume of 2 ml, diluted with media. Transduced pools were expanded, and single cell clones were isolated through FACS based on BFP or mCherry expression.

Multicolour assay (MCA)

Either mCherry HCT-116 Bd-WRN clone 24 and BFP SW620 Bd-WRN Clone 1 or mCherry HCT-116 Bd-WRN clone 44 and BFP SW620 Bd-WRN clone 17 were mixed in a 1:1 ratio (50,000 cells each) in 6-well plates and grown in DMEM media. Parental Bd-WRN clones were also plated in separate wells as controls to identify non-fluorescent cells. After 24 h, untreated cells were harvested for flow cytometry analysis and the rest of the plates were treated with either 300 nM AGB-1 and 300 nM Cis-AGB-1 or HRO761 (40 nM and 400 nM) (MedChem Express) and DMSO (0.1%). Live cells were analysed on the BD LSR Fortessa at 48 h and 96 h after adding compounds using the 405 nm and the 561 nm laser for BFP and mCherry cell detection, respectively. AGB-1, Cis-AGB-1 and DMSO were replaced every 48 h and HRO761 was replaced every 24 h.

Statistical analysis

Statistical significance for experiments were evaluated with an ordinary one-way analysis of variance (ANOVA) in GraphPad Prism 10. When multiple comparisons were performed in pairs, the Šidák post-test was used and when comparisons were made to a single control condition, the Dunnett’s post-test was used. The P values from post-test comparisons and resulting statistical significance is indicated within figures and figure legends as; *P < 0.05, **P < 0.01, ***P < 0.001, ****P < 0.0001.

Supplementary Information

Supplementary Information 1.

Supplementary Information 2.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-71160-5.

Acknowledgements

We thank the excellent technical support of the MRC PPU including the DNA Sequencing Service, Tissue Culture Team, and the Reagents and Services Team. We thank Arlene Rennie and Rosemary Clarke (Centre for Advanced Scientific Technologies, School of Life Sciences Dundee) for extensive help with FACS-based cell sorting and flow cytometry experiments. We thank Gillian Smith (Jacqui Wood Cancer Centre, Ninewells Hospital Dundee) for kindly providing Caov-3 ovarian cancer cells, and Daniel Durocher (Lunenfeld-Tannenbaum Research Institute, Toronto) for kindly providing the lentiviral vector pLenti-mCherry-NLS. We thank Ralitsa Madsen (MRC PPU Dundee) for advice on validation of genome edited clones. We thank all JR lab members especially Ivan Muñoz and Rathan Singh Jadav for useful discussions and Nelma Palminha (currently at Artios Pharma) and Wissem Bououdina for help with blinding of the cell viability assays in Fig. 3. This work was supported by the Medical Research Council (UK; Grant Number MC_UU_00038/5), the European Research Council (ERC Stg No. IDRE-715127) and Cancer Research UK (CDF C57404/A21782).

Author contributions

V.T. executed all the experiments and J.R. conceived the study. T.C. helped with analysis of microscopy data. T.M. generated DNA constructs for genome editing, and R.T. generated other DNA constructs. S.B., C.A. and G.S. helped with high content ScanR imaging and data analysis.

Data availability

All data supporting the findings of this study are available from the corresponding author upon reasonable request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Hakem R DNA-damage repair; the good, the bad, and the ugly EMBO J. 2008 27 589 605 10.1038/emboj.2008.15 18285820
Hakem, R. DNA-damage repair; the good, the bad, and the ugly. EMBO J. 27, 589–605 (2008).18285820 10.1038/emboj.2008.15
2. Jiricny J The multifaceted mismatch-repair system Nat. Rev. Mol. Cell Biol. 2006 7 335 346 10.1038/nrm1907 16612326
Jiricny, J. The multifaceted mismatch-repair system. Nat. Rev. Mol. Cell Biol. 7, 335–346 (2006).16612326 10.1038/nrm1907
3. Jiricny J Postreplicative mismatch repair Cold Spring Harb. Perspect. Biol. 2013 5 a012633 10.1101/cshperspect.a012633 23545421
Jiricny, J. Postreplicative mismatch repair. Cold Spring Harb. Perspect. Biol. 5, a012633. 10.1101/cshperspect.a012633 (2013).23545421 10.1101/cshperspect.a012633
4. Tieng FYF Abu N Lee L-H Ab Mutalib N-S Microsatellite instability in colorectal cancer liquid biopsy—current updates on its potential in non-invasive detection, prognosis and as a predictive marker Diagnostics 2021 11 544 10.3390/diagnostics11030544 33803882
Tieng, F. Y. F., Abu, N., Lee, L.-H. & Ab Mutalib, N.-S. Microsatellite instability in colorectal cancer liquid biopsy—current updates on its potential in non-invasive detection, prognosis and as a predictive marker. Diagnostics 11, 544 (2021).33803882 10.3390/diagnostics11030544
5. Li G-M Mechanisms and functions of DNA mismatch repair Cell Res. 2008 18 85 98 10.1038/cr.2007.115 18157157
Li, G.-M. Mechanisms and functions of DNA mismatch repair. Cell Res. 18, 85–98 (2008).18157157 10.1038/cr.2007.115
6. Nilbert M Planck M Fernebro E Borg A Johnson A Microsatellite instability is rare in rectal carcinomas and signifies hereditary cancer Eur. J. Cancer 1999 35 942 945 10.1016/s0959-8049(99)00045-3 10533476
Nilbert, M., Planck, M., Fernebro, E., Borg, A. & Johnson, A. Microsatellite instability is rare in rectal carcinomas and signifies hereditary cancer. Eur. J. Cancer 35, 942–945. 10.1016/s0959-8049(99)00045-3 (1999).10533476 10.1016/s0959-8049(99)00045-3
7. Tiwari AK Roy HK Lynch HT Lynch syndrome in the 21st century: clinical perspectives QJM 2016 109 151 158 10.1093/qjmed/hcv137 26224055
Tiwari, A. K., Roy, H. K. & Lynch, H. T. Lynch syndrome in the 21st century: clinical perspectives. QJM 109, 151–158 (2016).26224055 10.1093/qjmed/hcv137
8. Olave MC Graham RP Mismatch repair deficiency: The what, how and why it is important Genes Chromosom. Cancer 2022 61 314 321 10.1002/gcc.23015 34837268
Olave, M. C. & Graham, R. P. Mismatch repair deficiency: The what, how and why it is important. Genes Chromosom. Cancer 61, 314–321 (2022).34837268 10.1002/gcc.23015
9. Hause RJ Pritchard CC Shendure J Salipante SJ Classification and characterization of microsatellite instability across 18 cancer types Nat. Med. 2016 22 1342 1350 10.1038/nm.4191 27694933
Hause, R. J., Pritchard, C. C., Shendure, J. & Salipante, S. J. Classification and characterization of microsatellite instability across 18 cancer types. Nat. Med. 22, 1342–1350 (2016).27694933 10.1038/nm.4191
10. Laghi L Bianchi P Malesci A Differences and evolution of the methods for the assessment of microsatellite instability Oncogene 2008 27 6313 6321 10.1038/onc.2008.217 18679418
Laghi, L., Bianchi, P. & Malesci, A. Differences and evolution of the methods for the assessment of microsatellite instability. Oncogene 27, 6313–6321 (2008).18679418 10.1038/onc.2008.217
11. Boland CR Goel A Microsatellite instability in colorectal cancer Gastroenterology 2010 138 2073 2087.e3 10.1053/j.gastro.2009.12.064 20420947
Boland, C. R. & Goel, A. Microsatellite instability in colorectal cancer. Gastroenterology 138, 2073-2087.e3 (2010).20420947 10.1053/j.gastro.2009.12.064
12. Chiaravalli AM Immunohistochemical pattern of hMSH2/hMLH1 in familial and sporadic colorectal, gastric, endometrial and ovarian carcinomas with instability in microsatellite sequences Virchows Archiv 2001 438 39 48 10.1007/s004280000325 11213834
Chiaravalli, A. M. et al. Immunohistochemical pattern of hMSH2/hMLH1 in familial and sporadic colorectal, gastric, endometrial and ovarian carcinomas with instability in microsatellite sequences. Virchows Archiv 438, 39–48 (2001).11213834 10.1007/s004280000325
13. World Cancer Research Fund International. Stomach Cancer Statistics, https://www.wcrf.org/cancer-trends/stomach-cancer-statistics/ (2022). Accessed 22 May 2024.
14. International Agency for Research on Cancer (WHO). Global Cancer Observatory, https://gco.iarc.fr/en (2024). Accessed 22 May 2024.
15. Chan EM WRN helicase is a synthetic lethal target in microsatellite unstable cancers Nature 2019 568 551 556 10.1038/s41586-019-1102-x 30971823
Chan, E. M. et al. WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Nature 568, 551–556 (2019).30971823 10.1038/s41586-019-1102-x
16. Lieb S Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells Elife 2019 8 e43333 10.7554/eLife.43333 30910006
Lieb, S. et al. Werner syndrome helicase is a selective vulnerability of microsatellite instability-high tumor cells. Elife 8, e43333 (2019).30910006 10.7554/eLife.43333
17. Le DT Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade Science 2017 357 409 413 10.1126/science.aan6733 28596308
Le, D. T. et al. Mismatch repair deficiency predicts response of solid tumors to PD-1 blockade. Science 357, 409–413 (2017).28596308 10.1126/science.aan6733
18. Le DT PD-1 blockade in tumors with mismatch-repair deficiency N. Engl. J. Med. 2015 372 2509 2520 10.1056/NEJMoa1500596 26028255
Le, D. T. et al. PD-1 blockade in tumors with mismatch-repair deficiency. N. Engl. J. Med. 372, 2509–2520 (2015).26028255 10.1056/NEJMoa1500596
19. Overman MJ Durable clinical benefit with nivolumab plus ipilimumab in DNA mismatch repair-deficient/microsatellite instability-high metastatic colorectal cancer J. Clin. Oncol. 2018 36 773 779 10.1200/JCO.2017.76.9901 29355075
Overman, M. J. et al. Durable clinical benefit with nivolumab plus ipilimumab in DNA mismatch repair-deficient/microsatellite instability-high metastatic colorectal cancer. J. Clin. Oncol. 36, 773–779 (2018).29355075 10.1200/JCO.2017.76.9901
20. Overman MJ Nivolumab in patients with metastatic DNA mismatch repair-deficient or microsatellite instability-high colorectal cancer (CheckMate 142): An open-label, multicentre, phase 2 study Lancet Oncol. 2017 18 1182 1191 10.1016/S1470-2045(17)30422-9 28734759
Overman, M. J. et al. Nivolumab in patients with metastatic DNA mismatch repair-deficient or microsatellite instability-high colorectal cancer (CheckMate 142): An open-label, multicentre, phase 2 study. Lancet Oncol. 18, 1182–1191 (2017).28734759 10.1016/S1470-2045(17)30422-9
21. Gurjao C Intrinsic resistance to immune checkpoint blockade in a mismatch repair–deficient colorectal cancer Cancer Immunol. Res. 2019 7 1230 1236 10.1158/2326-6066.CIR-18-0683 31217164
Gurjao, C. et al. Intrinsic resistance to immune checkpoint blockade in a mismatch repair–deficient colorectal cancer. Cancer Immunol. Res. 7, 1230–1236 (2019).31217164 10.1158/2326-6066.CIR-18-0683
22. Monjazeb AM A randomized trial of combined PD-L1 and CTLA-4 inhibition with targeted low-dose or hypofractionated radiation for patients with metastatic colorectal cancer Clin. Cancer Res. 2021 27 2470 2480 10.1158/1078-0432.CCR-20-4632 33568343
Monjazeb, A. M. et al. A randomized trial of combined PD-L1 and CTLA-4 inhibition with targeted low-dose or hypofractionated radiation for patients with metastatic colorectal cancer. Clin. Cancer Res. 27, 2470–2480 (2021).33568343 10.1158/1078-0432.CCR-20-4632
23. Behan FM Prioritization of cancer therapeutic targets using CRISPR–Cas9 screens Nature 2019 568 511 516 10.1038/s41586-019-1103-9 30971826
Behan, F. M. et al. Prioritization of cancer therapeutic targets using CRISPR–Cas9 screens. Nature 568, 511–516 (2019).30971826 10.1038/s41586-019-1103-9
24. Kategaya L Perumal SK Hager JH Belmont LD Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability Iscience 2019 13 488 497 10.1016/j.isci.2019.02.006 30898619
Kategaya, L., Perumal, S. K., Hager, J. H. & Belmont, L. D. Werner syndrome helicase is required for the survival of cancer cells with microsatellite instability. Iscience 13, 488–497 (2019).30898619 10.1016/j.isci.2019.02.006
25. Mengoli V WRN helicase and mismatch repair complexes independently and synergistically disrupt cruciform DNA structures EMBO J. 2023 42 e111998 10.15252/embj.2022111998 36541070
Mengoli, V. et al. WRN helicase and mismatch repair complexes independently and synergistically disrupt cruciform DNA structures. EMBO J. 42, e111998 (2023).36541070 10.15252/embj.2022111998
26. van Wietmarschen N Repeat expansions confer WRN dependence in microsatellite-unstable cancers Nature 2020 586 292 298 10.1038/s41586-020-2769-8 32999459
van Wietmarschen, N. et al. Repeat expansions confer WRN dependence in microsatellite-unstable cancers. Nature 586, 292–298 (2020).32999459 10.1038/s41586-020-2769-8
27. van Wietmarschen N Nathan WJ Nussenzweig A The WRN helicase: Resolving a new target in microsatellite unstable cancers Curr. Opin. Genet. Dev. 2021 71 34 38 10.1016/j.gde.2021.06.014 34284257
van Wietmarschen, N., Nathan, W. J. & Nussenzweig, A. The WRN helicase: Resolving a new target in microsatellite unstable cancers. Curr. Opin. Genet. Dev. 71, 34–38 (2021).34284257 10.1016/j.gde.2021.06.014
28. Rodríguez Pérez F WRN inhibition leads to its chromatin-associated degradation via the PIAS4-RNF4-p97/VCP axis Nat. Commun. 2024 15 6059 10.1038/s41467-024-50178-3 39025847
Rodríguez Pérez, F. et al. WRN inhibition leads to its chromatin-associated degradation via the PIAS4-RNF4-p97/VCP axis. Nat. Commun. 15, 6059 (2024).39025847 10.1038/s41467-024-50178-3
29. Croteau DL Popuri V Opresko PL Bohr VA Human RecQ helicases in DNA repair, recombination, and replication Annu. Rev. Biochem. 2014 83 519 10.1146/annurev-biochem-060713-035428 24606147
Croteau, D. L., Popuri, V., Opresko, P. L. & Bohr, V. A. Human RecQ helicases in DNA repair, recombination, and replication. Annu. Rev. Biochem. 83, 519 (2014).24606147 10.1146/annurev-biochem-060713-035428
30. Parker MJ Identification of 2-sulfonyl/sulfonamide pyrimidines as covalent inhibitors of WRN using a multiplexed high-throughput screening assay Biochemistry 2023 62 2147 2160 10.1021/acs.biochem.2c00599 37403936
Parker, M. J. et al. Identification of 2-sulfonyl/sulfonamide pyrimidines as covalent inhibitors of WRN using a multiplexed high-throughput screening assay. Biochemistry 62, 2147–2160 (2023).37403936 10.1021/acs.biochem.2c00599
31. Heuser A Challenges for the discovery of non-covalent WRN helicase inhibitors ChemMedChem 2024 19 e202300613 10.1002/cmdc.202300613 38334957
Heuser, A. et al. Challenges for the discovery of non-covalent WRN helicase inhibitors. ChemMedChem 19, e202300613 (2024).38334957 10.1002/cmdc.202300613
32. Aggarwal M Sommers JA Shoemaker RH Brosh RM Jr Inhibition of helicase activity by a small molecule impairs Werner syndrome helicase (WRN) function in the cellular response to DNA damage or replication stress Proc. Natl. Acad. Sci. 2011 108 1525 1530 10.1073/pnas.1006423108 21220316
Aggarwal, M., Sommers, J. A., Shoemaker, R. H. & Brosh, R. M. Jr. Inhibition of helicase activity by a small molecule impairs Werner syndrome helicase (WRN) function in the cellular response to DNA damage or replication stress. Proc. Natl. Acad. Sci. 108, 1525–1530 (2011).21220316 10.1073/pnas.1006423108
33. Nguyen GH A small molecule inhibitor of the BLM helicase modulates chromosome stability in human cells Chem. Biol. 2013 20 55 62 10.1016/j.chembiol.2012.10.016 23352139
Nguyen, G. H. et al. A small molecule inhibitor of the BLM helicase modulates chromosome stability in human cells. Chem. Biol. 20, 55–62 (2013).23352139 10.1016/j.chembiol.2012.10.016
34. Aggarwal M Werner syndrome helicase has a critical role in DNA damage responses in the absence of a functional fanconi anemia pathway Cancer Res. 2013 73 5497 5507 10.1158/0008-5472.CAN-12-2975 23867477
Aggarwal, M. et al. Werner syndrome helicase has a critical role in DNA damage responses in the absence of a functional fanconi anemia pathway. Cancer Res. 73, 5497–5507 (2013).23867477 10.1158/0008-5472.CAN-12-2975
35. Sommers JA A high-throughput screen to identify novel small molecule inhibitors of the Werner Syndrome Helicase-Nuclease (WRN) PLoS ONE 2019 14 e0210525 10.1371/journal.pone.0210525 30625228
Sommers, J. A. et al. A high-throughput screen to identify novel small molecule inhibitors of the Werner Syndrome Helicase-Nuclease (WRN). PLoS ONE 14, e0210525 (2019).30625228 10.1371/journal.pone.0210525
36. Picco G Novel WRN helicase inhibitors selectively target microsatellite unstable cancer cells Cancer Discov. 2024 23 B20
Picco, G. et al. Novel WRN helicase inhibitors selectively target microsatellite unstable cancer cells. Cancer Discov. 23, B20 (2024).
37. Kikuchi S Abstract ND11: Chemoproteomic-enabled discovery of VVD-214, a synthetic lethal allosteric inhibitor of WRN helicase Cancer Res. 2024 84 ND11 10.1158/1538-7445.AM2024-ND11
Kikuchi, S. et al. Abstract ND11: Chemoproteomic-enabled discovery of VVD-214, a synthetic lethal allosteric inhibitor of WRN helicase. Cancer Res. 84, ND11 (2024).10.1158/1538-7445.AM2024-ND11
38. Cortes-Cros M Abstract PR007: Discovery of HRO761, a novel, first-in-class clinical stage WRN inhibitor with potent and selective anti-tumor activity in cancers with microsatellite instability Mol. Cancer Therap. 2023 22 PR007 10.1158/1535-7163.TARG-23-PR007
Cortes-Cros, M. et al. Abstract PR007: Discovery of HRO761, a novel, first-in-class clinical stage WRN inhibitor with potent and selective anti-tumor activity in cancers with microsatellite instability. Mol. Cancer Therap. 22, PR007 (2023).10.1158/1535-7163.TARG-23-PR007
39. Sakamoto KM Protacs: chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation Proc. Natl. Acad. Sci. USA 2001 98 8554 8559 10.1073/pnas.141230798 11438690
Sakamoto, K. M. et al. Protacs: chimeric molecules that target proteins to the Skp1-Cullin-F box complex for ubiquitination and degradation. Proc. Natl. Acad. Sci. USA 98, 8554–8559. 10.1073/pnas.141230798 (2001).11438690 10.1073/pnas.141230798
40. Biopharma PEG. PROTACs VS. Traditional Small Molecule Inhibitors, https://www.biochempeg.com/article/233.html (2021). Accessed 22 May 2024.
41. Sun X PROTACs: Great opportunities for academia and industry Signal Transduct. Target Ther. 2019 4 64 10.1038/s41392-019-0101-6 31885879
Sun, X. et al. PROTACs: Great opportunities for academia and industry. Signal Transduct. Target Ther. 4, 64. 10.1038/s41392-019-0101-6 (2019).31885879 10.1038/s41392-019-0101-6
42. Bekes M Langley DR Crews CM PROTAC targeted protein degraders: The past is prologue Nat. Rev. Drug Discov. 2022 21 181 200 10.1038/s41573-021-00371-6 35042991
Bekes, M., Langley, D. R. & Crews, C. M. PROTAC targeted protein degraders: The past is prologue. Nat. Rev. Drug Discov. 21, 181–200. 10.1038/s41573-021-00371-6 (2022).35042991 10.1038/s41573-021-00371-6
43. Gao H Sun X Rao Y PROTAC technology: Opportunities and challenges ACS Med. Chem. Lett. 2020 11 237 240 10.1021/acsmedchemlett.9b00597 32184950
Gao, H., Sun, X. & Rao, Y. PROTAC technology: Opportunities and challenges. ACS Med. Chem. Lett. 11, 237–240 (2020).32184950 10.1021/acsmedchemlett.9b00597
44. Bond AG Development of BromoTag: A “Bump-and-Hole”–PROTAC system to induce potent, rapid, and selective degradation of tagged target proteins J. Med. Chem. 2021 64 15477 15502 10.1021/acs.jmedchem.1c01532 34652918
Bond, A. G. et al. Development of BromoTag: A “Bump-and-Hole”–PROTAC system to induce potent, rapid, and selective degradation of tagged target proteins. J. Med. Chem. 64, 15477–15502 (2021).34652918 10.1021/acs.jmedchem.1c01532
45. Ran FA Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity Cell 2013 154 1380 1389 10.1016/j.cell.2013.08.021 23992846
Ran, F. A. et al. Double nicking by RNA-guided CRISPR Cas9 for enhanced genome editing specificity. Cell 154, 1380–1389. 10.1016/j.cell.2013.08.021 (2013).23992846 10.1016/j.cell.2013.08.021
46. Shen B Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects Nat. Methods 2014 11 399 402 10.1038/nmeth.2857 24584192
Shen, B. et al. Efficient genome modification by CRISPR-Cas9 nickase with minimal off-target effects. Nat. Methods 11, 399–402. 10.1038/nmeth.2857 (2014).24584192 10.1038/nmeth.2857
47. Morimoto M Nishida T Honda R Yasuda H Modification of cullin-1 by ubiquitin-like protein Nedd8 enhances the activity of SCF(skp2) toward p27(kip1) Biochem. Biophys. Res. Commun. 2000 270 1093 1096 10.1006/bbrc.2000.2576 10772955
Morimoto, M., Nishida, T., Honda, R. & Yasuda, H. Modification of cullin-1 by ubiquitin-like protein Nedd8 enhances the activity of SCF(skp2) toward p27(kip1). Biochem. Biophys. Res. Commun. 270, 1093–1096. 10.1006/bbrc.2000.2576 (2000).10772955 10.1006/bbrc.2000.2576
48. Baek K NEDD8 nucleates a multivalent cullin-RING-UBE2D ubiquitin ligation assembly Nature 2020 578 461 466 10.1038/s41586-020-2000-y 32051583
Baek, K. et al. NEDD8 nucleates a multivalent cullin-RING-UBE2D ubiquitin ligation assembly. Nature 578, 461–466. 10.1038/s41586-020-2000-y (2020).32051583 10.1038/s41586-020-2000-y
49. Schultz LB Chehab NH Malikzay A Halazonetis TD p53 binding protein 1 (53BP1) is an early participant in the cellular response to DNA double-strand breaks J. Cell Biol. 2000 151 1381 1390 10.1083/jcb.151.7.1381 11134068
Schultz, L. B., Chehab, N. H., Malikzay, A. & Halazonetis, T. D. p53 binding protein 1 (53BP1) is an early participant in the cellular response to DNA double-strand breaks. J. Cell Biol. 151, 1381–1390 (2000).11134068 10.1083/jcb.151.7.1381
50. Burma S Chen BP Murphy M Kurimasa A Chen DJ ATM phosphorylates histone H2AX in response to DNA double-strand breaks J. Biol. Chem. 2001 276 42462 42467 10.1074/jbc.C100466200 11571274
Burma, S., Chen, B. P., Murphy, M., Kurimasa, A. & Chen, D. J. ATM phosphorylates histone H2AX in response to DNA double-strand breaks. J. Biol. Chem. 276, 42462–42467 (2001).11571274 10.1074/jbc.C100466200
51. Smith J Tho LM Xu N Gillespie DA The ATM–Chk2 and ATR–Chk1 pathways in DNA damage signaling and cancer Adv. Cancer Res. 2010 108 73 112 10.1016/B978-0-12-380888-2.00003-0 21034966
Smith, J., Tho, L. M., Xu, N. & Gillespie, D. A. The ATM–Chk2 and ATR–Chk1 pathways in DNA damage signaling and cancer. Adv. Cancer Res. 108, 73–112 (2010).21034966 10.1016/B978-0-12-380888-2.00003-0
52. Lukas C 53BP1 nuclear bodies form around DNA lesions generated by mitotic transmission of chromosomes under replication stress Nat. Cell Biol. 2011 13 243 253 10.1038/ncb2201 21317883
Lukas, C. et al. 53BP1 nuclear bodies form around DNA lesions generated by mitotic transmission of chromosomes under replication stress. Nat. Cell Biol. 13, 243–253 (2011).21317883 10.1038/ncb2201
53. Mocali A Giovannelli L Dolara P Paoletti F The comet assay approach to senescent human diploid fibroblasts identifies different phenotypes and clarifies relationships among nuclear size, DNA content, and DNA damage J. Gerontol. Ser. A: Biol. Sci. Med. Sci. 2005 60 695 701 10.1093/gerona/60.6.695 15983170
Mocali, A., Giovannelli, L., Dolara, P. & Paoletti, F. The comet assay approach to senescent human diploid fibroblasts identifies different phenotypes and clarifies relationships among nuclear size, DNA content, and DNA damage. J. Gerontol. Ser. A: Biol. Sci. Med. Sci. 60, 695–701 (2005).15983170 10.1093/gerona/60.6.695
54. Dos Santos Á DNA damage alters nuclear mechanics through chromatin reorganization Nucleic Acids Res. 2021 49 340 353 10.1093/nar/gkaa1202 33330932
Dos Santos, Á. et al. DNA damage alters nuclear mechanics through chromatin reorganization. Nucleic Acids Res. 49, 340–353 (2021).33330932 10.1093/nar/gkaa1202
55. Zimmermann A A new class of selective ATM inhibitors as combination partners of DNA double-strand break inducing cancer therapies Mol. Cancer Therap. 2022 21 859 870 10.1158/1535-7163.MCT-21-0934 35405736
Zimmermann, A. et al. A new class of selective ATM inhibitors as combination partners of DNA double-strand break inducing cancer therapies. Mol. Cancer Therap. 21, 859–870 (2022).35405736 10.1158/1535-7163.MCT-21-0934
56. Kitagawa R Bakkenist CJ McKinnon PJ Kastan MB Phosphorylation of SMC1 is a critical downstream event in the ATM–NBS1–BRCA1 pathway Genes Dev. 2004 18 1423 1438 10.1101/gad.1200304 15175241
Kitagawa, R., Bakkenist, C. J., McKinnon, P. J. & Kastan, M. B. Phosphorylation of SMC1 is a critical downstream event in the ATM–NBS1–BRCA1 pathway. Genes Dev. 18, 1423–1438 (2004).15175241 10.1101/gad.1200304
57. Smogorzewska A Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair Cell 2007 129 289 301 10.1016/j.cell.2007.03.009 17412408
Smogorzewska, A. et al. Identification of the FANCI protein, a monoubiquitinated FANCD2 paralog required for DNA repair. Cell 129, 289–301. 10.1016/j.cell.2007.03.009 (2007).17412408 10.1016/j.cell.2007.03.009
58. Ferretti S Discovery of WRN inhibitor HRO761 with synthetic lethality in MSI cancers Nature 2024 629 1 7 10.1038/s41586-024-07350-y
Ferretti, S. et al. Discovery of WRN inhibitor HRO761 with synthetic lethality in MSI cancers. Nature 629, 1–7 (2024).10.1038/s41586-024-07350-y
59. Zong D Comprehensive mapping of cell fates in microsatellite unstable cancer cells supports dual targeting of WRN and ATR Genes Dev. 2023 37 913 928 10.1101/gad.351085.123 37932011
Zong, D. et al. Comprehensive mapping of cell fates in microsatellite unstable cancer cells supports dual targeting of WRN and ATR. Genes Dev. 37, 913–928 (2023).37932011 10.1101/gad.351085.123
60. Ohoka N In vivo knockdown of pathogenic proteins via specific and nongenetic inhibitor of apoptosis protein (IAP)-dependent protein erasers (SNIPERs) J. Biol. Chem. 2017 292 4556 4570 10.1074/jbc.M116.768853 28154167
Ohoka, N. et al. In vivo knockdown of pathogenic proteins via specific and nongenetic inhibitor of apoptosis protein (IAP)-dependent protein erasers (SNIPERs). J. Biol. Chem. 292, 4556–4570. 10.1074/jbc.M116.768853 (2017).28154167 10.1074/jbc.M116.768853
61. Raina K PROTAC-induced BET protein degradation as a therapy for castration-resistant prostate cancer Proc. Natl. Acad. Sci. USA 2016 113 7124 7129 10.1073/pnas.1521738113 27274052
Raina, K. et al. PROTAC-induced BET protein degradation as a therapy for castration-resistant prostate cancer. Proc. Natl. Acad. Sci. USA 113, 7124–7129. 10.1073/pnas.1521738113 (2016).27274052 10.1073/pnas.1521738113
62. Zhou B Discovery of a small-molecule degrader of bromodomain and extra-terminal (BET) proteins with picomolar cellular potencies and capable of achieving tumor regression J. Med. Chem. 2018 61 462 481 10.1021/acs.jmedchem.6b01816 28339196
Zhou, B. et al. Discovery of a small-molecule degrader of bromodomain and extra-terminal (BET) proteins with picomolar cellular potencies and capable of achieving tumor regression. J. Med. Chem. 61, 462–481. 10.1021/acs.jmedchem.6b01816 (2018).28339196 10.1021/acs.jmedchem.6b01816
63. Saenz DT Novel BET protein proteolysis-targeting chimera exerts superior lethal activity than bromodomain inhibitor (BETi) against post-myeloproliferative neoplasm secondary (s) AML cells Leukemia 2017 31 1951 1961 10.1038/leu.2016.393 28042144
Saenz, D. T. et al. Novel BET protein proteolysis-targeting chimera exerts superior lethal activity than bromodomain inhibitor (BETi) against post-myeloproliferative neoplasm secondary (s) AML cells. Leukemia 31, 1951–1961. 10.1038/leu.2016.393 (2017).28042144 10.1038/leu.2016.393
64. Burslem GM The advantages of targeted protein degradation over inhibition: An RTK case study Cell Chem. Biol. 2018 25 67 77.e63 10.1016/j.chembiol.2017.09.009 29129716
Burslem, G. M. et al. The advantages of targeted protein degradation over inhibition: An RTK case study. Cell Chem. Biol. 25, 67-77.e63. 10.1016/j.chembiol.2017.09.009 (2018).29129716 10.1016/j.chembiol.2017.09.009
65. Dias MP Moser SC Ganesan S Jonkers J Understanding and overcoming resistance to PARP inhibitors in cancer therapy Nat. Rev. Clin. Oncol. 2021 18 773 791 10.1038/s41571-021-00532-x 34285417
Dias, M. P., Moser, S. C., Ganesan, S. & Jonkers, J. Understanding and overcoming resistance to PARP inhibitors in cancer therapy. Nat. Rev. Clin. Oncol. 18, 773–791. 10.1038/s41571-021-00532-x (2021).34285417 10.1038/s41571-021-00532-x
66. Noordermeer SM The shieldin complex mediates 53BP1-dependent DNA repair Nature 2018 560 117 121 10.1038/s41586-018-0340-7 30022168
Noordermeer, S. M. et al. The shieldin complex mediates 53BP1-dependent DNA repair. Nature 560, 117–121 (2018).30022168 10.1038/s41586-018-0340-7
