
==== Front
eLife
Elife
eLife
eLife
2050-084X
eLife Sciences Publications, Ltd

39240259
92545
10.7554/eLife.92545
version of record
Research Article
Neuroscience
The function of juvenile–adult transition axis in female sexual receptivity of Drosophila melanogaster
Li Jing https://orcid.org/0000-0003-3248-3513
lijing@szbl.ac.cn
12†
Ning Chao 34†
Liu Yaohua 25†
Deng Bowen 6
Wang Bingcai 27
Shi Kai 27
Wang Rencong 27
Fang Ruixin 1
Zhou Chuan 127
1 https://ror.org/00sdcjz77 Institute of Molecular Physiology, Shenzhen Bay Laboratory Shenzhen China
2 https://ror.org/034t30j35 State Key Laboratory of Integrated Management of Pest Insects and Rodents, Institute of Zoology, Chinese Academy of Sciences Beijing China
3 https://ror.org/034t30j35 National Laboratory of Biomacromolecules, New Cornerstone Science Laboratory, CAS Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences Beijing China
4 https://ror.org/034t30j35 CAS Key Laboratory of Genome Sciences and Information, Beijing Institute of Genomics, Chinese Academy of Sciences Beijing China
5 https://ror.org/05e9f5362 Department of Plant Protection, Shanxi Agricultural University Jinzhong China
6 https://ror.org/029819q61 Chinese Institute for Brain Research, Peking-Tsinghua Center for Life Sciences, Zhongguancun Life Sciences Park Beijing China
7 https://ror.org/034t30j35 University of Chinese Academy of Sciences Beijing China
Muraro Nara Ines Reviewing Editor Instituto de Investigación en Biomedicina de Buenos Aires Argentina

Cardona Albert Senior Editor https://ror.org/013meh722 University of Cambridge United Kingdom

† These authors contributed equally to this work.

06 9 2024
2024
12 RP9254527 9 2023
This manuscript was published as a preprint.29 9 2023

This manuscript was published as a reviewed preprint.28 11 2023

The reviewed preprint was revised.22 8 2024

© 2023, Li, Ning, Liu et al
2023
Li, Ning, Liu et al
https://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Female sexual receptivity is essential for reproduction of a species. Neuropeptides play the main role in regulating female receptivity. However, whether neuropeptides regulate female sexual receptivity during the neurodevelopment is unknown. Here, we found the peptide hormone prothoracicotropic hormone (PTTH), which belongs to the insect PG (prothoracic gland) axis, negatively regulated virgin female receptivity through ecdysone during neurodevelopment in Drosophila melanogaster. We identified PTTH neurons as doublesex-positive neurons, they regulated virgin female receptivity before the metamorphosis during the third-instar larval stage. PTTH deletion resulted in the increased EcR-A expression in the whole newly formed prepupae. Furthermore, the ecdysone receptor EcR-A in pC1 neurons positively regulated virgin female receptivity during metamorphosis. The decreased EcR-A in pC1 neurons induced abnormal morphological development of pC1 neurons without changing neural activity. Among all subtypes of pC1 neurons, the function of EcR-A in pC1b neurons was necessary for virgin female copulation rate. These suggested that the changes of synaptic connections between pC1b and other neurons decreased female copulation rate. Moreover, female receptivity significantly decreased when the expression of PTTH receptor Torso was reduced in pC1 neurons. This suggested that PTTH not only regulates female receptivity through ecdysone but also through affecting female receptivity associated neurons directly. The PG axis has similar functional strategy as the hypothalamic–pituitary–gonadal axis in mammals to trigger the juvenile–adult transition. Our work suggests a general mechanism underlying which the neurodevelopment during maturation regulates female sexual receptivity.

prothoracicotropic hormone
Drosophila melanogaster
female sexual receptivity
ecdysone
pC1 neurons
Research organism

D. melanogaster
http://dx.doi.org/10.13039/501100021177 Shenzhen Bay Laboratory 21260061 Zhou Chuan http://dx.doi.org/10.13039/501100021177 Shenzhen Bay Laboratory S239201006 Li Jing http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China Y711241133 Zhou Chuan http://dx.doi.org/10.13039/501100002367 Chinese Academy of Sciences Y929731103 Zhou Chuan The funders had no role in study design, data collection, and interpretation, or the decision to submit the work for publication.Author impact statementProthoracicotropic hormone and ecdysone belonging to the insect PG axis modulate virgin female sexual receptivity.
publishing-routeprc
==== Body
pmcIntroduction

The success of copulation is important for the reproduction of a species. Drosophila melanogaster provides a powerful system to investigate the neuronal and molecular mechanism of sexual behaviors. Females decide to mate or not according to their physiological status and the environmental condition (Dickson, 2008). Sexually mature adult virgin females validate males after sensing the courtship song and male-specific sex pheromone, receive courtship with pausing and opening the vaginal plate (VPO) (Ferveur, 2010; Greenspan and Ferveur, 2000; Hall, 1994; Wang et al., 2021). If the female is not willing to mate, she may kick her legs, flick her wings, or extrude the ovipositor to deter males (Connolly and Cook, 1973). Mated females reject males for several days after mating mainly through more ovipositor extrusion (OE) and less VPO (Fuyama and Ueyama, 1997; Wang et al., 2021). These options need the establishment of neural circuits for female sexual receptivity. However, the associated mechanism of neural maturation and the effect of neural maturation on female sexual receptivity are little known.

doublesex (dsx) and fruitless (fru) are the terminal genes in sex determination regulatory hierarchy. They specify nearly all aspects of somatic sexual differentiation, including the preparation for sexual behaviors (Dickson, 2008; Manoli et al., 2013; Manoli et al., 2006; Mellert et al., 2012; Pavlou and Goodwin, 2013; Siwicki and Kravitz, 2009; Yamamoto, 2007; Yamamoto and Koganezawa, 2013). In males, expression of male-specific FruM (Billeter et al., 2006; Demir and Dickson, 2005; Hall, 1978; Manoli et al., 2005; Stockinger et al., 2005) and male-specific DsxM (Kohatsu et al., 2011; Pan and Baker, 2014; Pan et al., 2011; Rideout et al., 2010) is important for male courtship behaviors. In females, although functional Fru protein is not translated, neurons with DsxF or fru P1 promoter regulate some aspects of the female sexual behaviors (Kvitsiani and Dickson, 2006; Rideout et al., 2010). Fru and dsx are involved in regulating the sexual dimorphism during neurodevelopment (Yamamoto and Koganezawa, 2013). For instance, the sexual dimorphism of P1 and mAL neurons which are all associated with male courtship and aggression behaviors (Clowney et al., 2015; Hoopfer et al., 2015; Kimura et al., 2008; Kohatsu et al., 2011; Pan et al., 2012; Sengupta et al., 2022; von Philipsborn et al., 2011) is the result of regulation by Dsx and/or Fru (Ito et al., 2012; Kimura et al., 2008). In the cis-vaccenyl acetate (cVA) pathway, which induces the courtship inhibiting in males (Kurtovic et al., 2007; Wang and Anderson, 2010), the first-order to the fourth-order components are all fru-Gal4-positive neurons and are either male-specific or sexually dimorphic (Ruta et al., 2010). However, the role of DsxF in neurodevelopment associated with female sexual behaviors is little understood.

During postembryonic development, the PG axis triggers the juvenile–adult transition, similar to the function of hypothalamic–pituitary–gonadal (HPG) axis in mammals (Herbison, 2016; Pan and O’Connor, 2019). Hormones of the PG axis act to transform the larval nervous system into an adult version (Truman and Riddiford, 2023). Ecdysone belonging to the PG axis is the prime mover of insect molting and metamorphosis and is involved in all phases of neurodevelopment, including neurogenesis, pruning, arbor outgrowth, and cell death (Truman and Riddiford, 2023). The neurons read the ecdysteroid titer through two isoforms of the ecdysone receptor, EcR-A and EcR-B1, according to spatial and temporal conditions in the central nervous system (CNS) (Riddiford et al., 2000; Truman et al., 1994). EcR-A is required in fru P1-expressing neurons for the establishment of male-specific neuronal architecture, and ecdysone receptor deficient males display increased male–male courtship behavior (Dalton et al., 2009; Ganter et al., 2007). However, how ecdysone regulates the neurodevelopment associated with female sexual receptivity, especially the fru+ and dsx+ neurons, is unknown.

Much of studies to understand female sexual receptivity has focused on its regulation. How a female respond to males is highly dependent on whether or not she has previously mated. In virgin females, dsx+ pCd neurons respond to the cVA, while dsx+ pC1 neurons also respond to male courtship song (Zhou et al., 2014). The receptive females open the vaginal plate (VPO) through activation of the dsx+ vpoDN neurons (Wang et al., 2021). After mated, sex peptide in the seminal fluid binds to the fru+ dsx+ sex peptide sensory neurons in the female uterus. Then neuronal activity in the dsx+ sex peptide abdominal ganglion neurons of the ventral nerve cord and in the pC1 neurons is reduced (Avila et al., 2011; Feng et al., 2014; Häsemeyer et al., 2009; Kubli, 2003; Wang et al., 2020b; Yang et al., 2009; Zhou et al., 2014). Therefore, the sexual receptivity is reduced with less VPO and more OE which is controlled by dsx+ DpN13 neurons (Wang et al., 2020a). In addition, neuropeptides and monoamines play a critical role in regulation of the female receptivity. The neuropeptides Drosulfakinin, myoinhibitory peptides and SIFamide are involved in female sexual receptivity (Jang et al., 2017; Terhzaz et al., 2007; Wang et al., 2022). As monoamines, dopamine, serotonin, and octopamine are pivotal to female sexual behaviors (Ishimoto and Kamikouchi, 2020; Ma et al., 2022; Neckameyer, 1998; Rezával et al., 2014). So far, the identified neuropeptides and monoamines modulating female sexual receptivity all function during the adult stage. However, whether neuropeptides or monoamines regulate the establishment of neural circuits for female sexual receptivity is unknown.

To explore the factors that regulate Drosophila virgin female receptivity especially during neurodevelopment, we did a knock-out screen including most of chemoconnectome (CCT) members. We discovered a requirement for the prothoracicotropic hormone (PTTH) during postembryonic development for virgin female receptivity. We also found that PTTH neurons expressing PTTH are dsx+ neurons. PTTH, a brain-derived neuropeptide hormone, is the primary promoter of the synthesis of steroid hormone 20-hydroxyecdysone (20E) (McBrayer et al., 2007; Rewitz et al., 2009). Indeed, the enhanced virgin female receptivity due to the loss of PTTH could be rescued through feeding 20E to the third-instar larvae. Because 20E acts through its receptor EcR (Riddiford et al., 2000), we then tested the function of EcR in pC1 neurons which encode the mating status of females (Zhou et al., 2014). The reduced EcR-A expression in pC1 neurons resulted in the abnormal anatomical pattern of pC1 neurons and the reduced female copulation rate. This may be explained by the increased EcR-A in newly formed prepupae resulted from the PTTH deletion. Furthermore, the decreased female copulation rate was due to the reduced EcR-A in pC1b neurons. Besides, we detected the inhibited female receptivity when PTTH receptor torso was decreased in pC1 neurons, suggested the direct function of PTTH on other dsx+ neurons to regulate female receptivity. Thus, in addition to demonstrating the function of PTTH in virgin female receptivity during neurodevelopment, our study identified the necessary role of the normal pC1b neural morphology in virgin female receptivity.

Results

PTTH modulates virgin female receptivity

In Drosophila, neuropeptides and monoamines, belonging to the CCT (the entire set of neurotransmitters, neuromodulators, neuropeptides, and their receptors underlying chemotransmission) (Deng et al., 2019), play a critical role in regulation of the female receptivity. To explore the factors that regulate virgin female receptivity especially during neurodevelopment, we screened 108 CCT knock-out lines generated by the CRISPR–Cas9 system (Deng et al., 2019) (unpublished data). The result showed that PTTH might regulate virgin female receptivity. The deletion mutant PtthDelete removed part of the 5′ UTR and almost all coding sequence and is a protein null (Figure 1A). We confirmed the PTTH knock-out flies by using PCR (Polymerase Chain Reaction) analysis at the PTTH locus in genomic DNA samples (Figure 1B), by using RT-PCR (Real-time PCR) to identify the loss of PTTH transcripts in cDNA samples (Figure 1C) and by detecting the immunoreactivity of PTTH in the central brain (Figure 1—figure supplement 1A). Primers used are listed in Supplementary file 1. PTTH immunoreactivity was found in the brain of wild-type and heterozygous flies (Figure 1—figure supplement 1A1, 1A3), but was absent in homozygous PtthDelete flies (Figure 1—figure supplement 1A2). As the previous study, the PtthDelete larvae lacking PTTH undergo metamorphosis with about 1 day delay compared with the wild-type control (Shimell et al., 2018) (data not shown). Besides, the PtthDelete adult male and female flies had the significant increased weight than wild-type flies (Figure 1—figure supplement 1B). This is also consistent with that PTTH regulates developmental timing and body size in Drosophila (McBrayer et al., 2007; Shimell et al., 2018).

Figure 1. Ptth null mutants have increased virgin female receptivity.

(A–C) Generation and validation of a 974-bp deletion mutant of the Ptth gene. The 5′ UTR and almost all coding sequence were deleted. The deletion was confirmed through PCR analysis at the prothoracicotropic hormone (PTTH) locus in genomic DNA samples (B), and through RT-PCR to identify the loss of PTTH transcripts in cDNA samples of wandering larvae (C). Virgin female receptivity of Ptth null mutants on the first (D), second (E), third (F), and sixth day (G), respectively. The comparison referred to PtthDelete/PtthDelete. (H) Enhanced virgin female receptivity of ΔPtth null mutants was rescued by elav-Gal4 driving UAS-PTTH. The increased copulation rate and decreased latency to copulation on the first day after eclosion were rescued to the comparable level of control. The comparison referred to elav-Gal4/+; PtthDelete/PtthDelete;UAS-PTTH/+. The copulation latency and copulation rate of elav-Gal4/+; PtthDelete/PtthDelete are higher and lower than PtthDelete/PtthDelete;UAS-PTTH/+, respectively. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal–Wallis ANOVA (Analysis of Variance) and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM (Mean standard error). *p < 0.05, ***p < 0.001, ns indicates no significant difference.

Figure 1—source data 1. Photo of nucleic acid electrophoresis and copulation time.

Figure 1—figure supplement 1. Prothoracicotropic hormone (PTTH) expression, weight, attractiveness, and locomotion behavior of Ptth null mutant virgin females.

(A) Brain of indicated genotype, immunostained with anti-PTTH antibody (green) and counterstained with nc82 (magenta). Arrows show signals (green) stained with anti-PTTH antibody. Female flies were within 10 hr after eclosion. Scale bars, 50 μm. (B) The weights of 24-hr-old adult PtthDelete/PtthDelete null mutant females were significantly higher than that of wild-type females (Mann–Whitney U test, n = 8 groups, 10 flies in each group). (C) Courtship index of wild-type males during the first 5 min of courtship toward a female with the indicated genotype (Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests, n = 7–9). Mean velocity had no significant change in PtthDelete/PtthDelete null mutant females on the first day (D) and the sixth day (E) compared with control females (Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests, n = 7–12). The comparison referred to PtthDelete/PtthDelete. Female flies for behavioral assay were 4- to 6-day-old adults. Error bars indicate SEM. **p < 0.01, ns = not significant.

Figure 1—figure supplement 1—source data 1. Body weight, courtship index, and walking speed.

Figure 1—figure supplement 2. Effect of the expression of prothoracicotropic hormone (PTTH) on female receptivity.

(A) Overexpressing PTTH in PTTH neurons. The comparison referred to flies Ptth-Gal4/+;UAS-PTTH/+. Female flies for behavioral assay were 4- to 6-day-old. (B, C) Decreasing PTTH in PTTH neurons. The comparison referred to flies Ptth-Gal4/+;UAS-PTTH-RNAi/+ and Dsx-Gal4/+;UAS-PTTH-RNAi/+. Female flies for behavioral assay were 2-day-old adults. (D) The fly brain of elav-Gal4>UAS-GFP were stained with PTTH antibody. The larvae flies were the wandering ones. The adult flies were within 10 hr after eclosion. Representative of five female brains. Scale bars, 50 μm. *p < 0.05, **p < 0.01, ***p < 0.001.

Figure 1—figure supplement 2—source data 1. Copulation time.

To confirm the function of PTTH, we tested virgin female receptivity of PtthDelete female flies. We found that the virgin female losing PTTH had significantly higher copulation rate and shorter latency to copulation than wild-type flies (Figure 1D–G). In addition, the PtthDelete flies had higher copulation rate and lower latency to copulation compared to heterozygous null mutant females within 2 days (Figure 1D, E) and within 3 days, respectively (Figure 1D–F). The enhanced virgin female receptivity had no relationship either with the attractivity or with the locomotion activity of virgin females (Figure 1—figure supplement 1C–E). These results suggested that PTTH deletion regulates virgin female receptivity in a dose-dependent manner. Female receptivity increases with the increase of age after eclosion, not only for wild-type flies but also PTTH mutants. At the first day after eclosion (Figure 1D), maybe the loss of PTTH in PTTHDelete/+ flies is not enough for sexual precocity as PTTHDelete/PTTHDelete. At the second day after eclosion and after (Figure 1E–G), the loss of PTTH in PTTHDelete/+ flies is enough for sexual precocity compared with wild-type flies. However, After the second day of adult, female receptivity of all genotype flies increases sharply. At the third day of adult and after, female receptivity of PTTHDelete/PTTHDelete reaches the peak and the receptivity of PTTHDelete/+ reaches more nearly to PTTHDelete/PTTHDelete when flies get older (Figure 1F, G). However, the overexpression through PTTH-Gal4>UAS-PTTH is also not sufficient to change female receptivity (Figure 1—figure supplement 2A). Similarly, decreased expression of PTTH through PTTH-Gal4>UAS-PTTH-RNAi or dsx-Gal4>UAS-PTTH-RNAi did not result in the similar phenotype to that of PTTHDelete/PTTHDelete (Figure 1—figure supplement 2B, C). It is possible that both decreasing and increasing PTTH expression are not sufficient to change female receptivity.

Furthermore, we carried out genetic rescue experiments to further confirm the function of PTTH in modulating virgin female receptivity. We used the pan-neuronal driver elav-Gal4 to drive UAS-PTTH expression in PTTH mutant background, although elav-Gal4 did not express in PTTH neurons (Figure 1—figure supplement 2D). We detected the PTTH signals using PTTH antibody in the rescued female brains (Figure 1—figure supplement 1A4). We found that neuron-specific expression of PTTH could restore the enhanced copulation rate and shorter latency to copulation in PTTHDelete/PTTHDelete virgin females (Figure 1H). Except for the projection of axons to PG gland, PTTH also carries endocrine function to regulate light avoidance of larvae (Yamanaka et al., 2013). The overexpressed PTTH in other neurons through elav-Gal4>UAS-PTTH may act on the PG gland through endocrine function and then induce the ecdysone synthesis and release. In summary, these results suggested that PTTH regulates virgin female receptivity.

Dsx+ PTTH neurons regulate virgin female receptivity

We used new Ptth-Gal4 and Ptth-LexA which inserts Gal4 or LexA sequence before the stop codon of the Ptth gene (Deng et al., 2019) to label and manipulate PTTH neurons expressing PTTH. The labeled neurons were the same as reported before (McBrayer et al., 2007; Yamanaka et al., 2013), a pair of bilateral neurosecretory cells in the brain directly innervating the prothoracic gland during the larval stage (Figure 2A and Figure 2—figure supplement 1A). The newly emerged flies had the similar anatomical pattern with that of the larval stage (Figure 2B and Figure 2—figure supplement 1B). However, while the prothoracic gland cells are gradually degenerating during pharate adult development (Dai and Gilbert, 1991; Roy et al., 2018), the pattern of PTTH neurons labeled by Ptth-Gal4>UAS-mCD8GFP gradually could not be found after the 10th hour after eclosion (Figure 2—figure supplement 2).

Figure 2. Prothoracicotropic hormone (PTTH) neurons are doublesex-positive neurons.

Expression pattern of Ptth-Gal4 revealed by anti-GFP in larvae central nervous system (CNS) (A) and adult brain (B). Representative of five female flies. Scale bars, 50 μm. (C) All PTTH neurons were colabeled by dsx-Gal4 driving UAS-GFP-Stinger (red) and Ptth-LexA driving LexAop-tomato (green). Representative of five female brains. Scale bars, 50 and 5 μm (zoom-in). (D) All PTTH neurons were Ptth and Dsx co-expressing, labeled by intersectional strategy. The larvae flies were the wandering ones. The adult flies were within 10-hr-old adults. Representative of five female brains. Scale bars, 50 μm.

Figure 2—figure supplement 1. The function of prothoracicotropic hormone (PTTH) neurons in female receptivity.

Expression pattern of Ptth-LexA in the brain revealed by anti-GFP (green) in wandering larvae central nervous system (CNS) (A) and within 10-hr adult brain (B). Representative of five female flies. Scale bars, 50 μm. (C) The female receptivity when deceasing the expression of DsxF in PTTH neurons. The comparison referred to Ptth-Gal4/+;UAS-DsxF-RNAi/+. Female flies were 2-day-old adults. (D) PTTH neurons were inactivated during the whole larval, pupal, and adult stages, respectively, by kir2.1, restricted by shifts from 18°C to 30°C. When the experiment was done at the larval stage is the only situation when the controls were both different from the experimental. The comparison referred to Ptth-Gal4/tub-Gal80ts;kir2.1/+. Female flies were 2-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ns indicates no significant difference.

Figure 2—figure supplement 1—source data 1. Copulation time.

Figure 2—figure supplement 2. The anatomical pattern of prothoracicotropic hormone (PTTH) neurons expressing PTTH at different developmental stages.

Expression pattern of Ptth-Gal4 in the brain revealed by anti-GFP from the third larval stage to the fourth day after eclosion. Arrows show PTTH signals (green) stained with anti-GFP antibody. L3, the third-instar larvae; wander, the wandering larvae; P4, the fourth day of the pupal stage; A0h, the first hour of the adult stage; A3h, the third hour of the adult stage; A6h, the sixth hour of the adult stage; A9h, the ninth hour of the adult stage; A12h, the 12th hour of the adult stage; A4d, the fourth day of the adult stage. Representative of five female flies. Scale bars, 50 μm.

Figure 2—figure supplement 3. Prothoracicotropic hormone (PTTH) neurons expressing PTTH do not regulate virgin female copulation rate during adult stage.

(A-C) PTTH neurons were activated during adult stage by dTrpA1 at 29°C. The female copulation rate and the latency to copulation did not change significantly. The number of female flies paired with wild-type males is displayed in parentheses. Female flies were 4-day-old adults. For the copulation rate, chi-square test is applied. For the latency to copulation, Mann–Whitney U test is applied. Error bars indicate SEM. *p < 0.05, ns indicates no significant difference.

Figure 2—figure supplement 3—source data 1. Copulation time.

Most identified neurons associated with female sexual behaviors express doublesex gene. We asked whether PTTH neurons are a part of the doublesex circuitry or not. Double labeling of dsx-LexA and Ptth-Gal4 neurons (LexAop-tomato,UAS-stinger-GFP/Ptth-LexA;dsx-Gal4/+) revealed that PTTH neurons are all doublesex-positive (Figure 2C). We then used an intersectional strategy to visualize overlapped expression between dsx-LexA and Ptth-Gal4 (UAS > stop > myrGFP/+;LexAop2-FlpL,dsx-LexA/Ptth-Gal4). We observed all PTTH neurons with GFP signals (Figure 2D). These results suggested that PTTH neurons are dsx+ neurons. Furthermore, we wanted to know whether DsxF regulates female receptivity in PTTH neurons. We decreased the DsxF expression in PTTH neurons and did not detect significantly changed female receptivity (Figure 2—figure supplement 1C). We supposed that PTTH neurons have some relationship with other DsxF-positive neurons which regulate female receptivity.

We then analyzed whether PTTH neurons are involved in the modulation of virgin female receptivity. First, we activated PTTH neurons transiently in adult virgin females by driving the temperature-sensitive activator dTrpA1 (Hamada et al., 2008) using Ptth-Gal4. PTTH neurons were activated at 29°C compared with the control treatment at 23°C. No significantly different copulation rate or latency to copulation was detected (Figure 2—figure supplement 3A–C). This suggested that PTTH neurons do not regulate virgin female receptivity during the adult stage.

To identify the detail time for the function of PTTH neurons in virgin female receptivity, we inactivated PTTH neurons through kir2.1 under the control of the temporal and regional gene expression targeting system (McGuire et al., 2004). When the experiment was done at the larval stage is the only situation when the controls were both different from the experimental (Figure 2—figure supplement 1D). However, when PTTH neurons were inactivated during whole pupal or whole adult stages, virgin female copulation rate did not change significantly (Figure 2—figure supplement 1D). Furthermore, we activated PTTH neurons at different stages overlapping the postembryonic larval developmental time using dTrpA1 (Figure 3A). Stage 1 was from the first-instar larvae to 6 hr before the third-instar larvae. Stage 2 was from 6 hr before the third-instar larvae to the end of the wandering larvae (the start of prepupa stage). Stage 3 was from the start of prepupa stage to the end of the second day of the pupal stage. Stage 4 was from the end of the second day of the pupal stage to the eclosion of adults. The copulation rate did not change significantly when activating PTTH neurons during the stage 1, 3, or 4 (Figure 3B, D, E). However, we found the significant lower copulation rate and the longer latency to copulation only when PTTH neurons were activated during the stage 2 (Figure 3C, F). The defected copulation was not due to a lower locomotion activity of virgin females (Figure 3G). Taken together, our findings indicated that the activity of dsx+ PTTH neurons negatively regulate virgin female receptivity during the stage from the start of the third instar to the end of wandering stage.

Figure 3. Activation of prothoracicotropic hormone (PTTH) neurons expressing PTTH during the third-instar larvae inhibits virgin female receptivity.

(A) Four developmental stages of Drosophila before eclosion when PTTH neurons were thermogenetic activated by dTrpA1. L1, L2, and L3: start of three larval stages, W: start of wandering stage, Pp: puparium formation, P1 and P2: start of the first and second day of pupal stage. (B–E) Ptth-Gal4 driving UAS-dTrpA1 activated PTTH neurons at 29°C. Activation of PTTH neurons at the stage 2 significantly decreased copulation rate (C), but not at the stage 1 (B), stage 3 (D), and stage 4 (E). (F) Activation of PTTH neurons at the stage 2 significantly increased the latency to copulation. (G) Mean velocity had no significant change when PTTH neurons were activated during the stage 2 compared with control females (ns = not significant, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests, mean ± SEM, n = 8–12). The comparison referred to Ptth-Gal4/UAS-dTrpA1. Female flies were 4-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Mann–Whitney U test is applied. Error bars indicate SEM . ***p < 0.001, ****p < 0.0001, ns indicates no significant difference.

Figure 3—source data 1. Copulation time and walking speed.

PTTH modulates virgin female receptivity through ecdysone

The third-intar larval stage is the critical stage for the initiation of metamorphosis involving the synthesis of ecdysone (Imura et al., 2020; Lavrynenko et al., 2015; Shimell et al., 2018). To test whether PTTH regulates virgin female receptivity through regulating the synthesis of ecdysone, we rescued the enhanced female receptivity by feeding 20E to the third-intar larval PtthDelete flies. The enhanced copulation rate and shorter latency to copulation of the PtthDelete flies were rescued to the comparable level of wild-type females (Figure 4). Furthermore, the wild-type females fed by 20E had no significantly different copulation rate and latency to copulation compared with the wild-type females fed by the same volume of 95% ethanol which is the solvent of 20E (Figure 4). This suggested that PTTH regulates virgin female receptivity through the titer of ecdysone.

Figure 4. Feeding 20E restores virgin female receptivity of Ptth null mutant flies.

The increased copulation rate and decreased latency to copulation of the 24-hr-old ΔPtth flies were rescued to the comparable level of wild-type females by feeding 20E to the third-instar larval ΔPtth flies. The wild-type larval females fed by 20E had no significantly different copulation rate and latency to copulation compared with the wild-type females fed by the same volume of 95% ethanol which is the solvent of 20E. The comparison referred to PtthDelete/PtthDelete + 20E. Female flies were 1-day-old. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ns indicates no significant difference.

Figure 4—source data 1. Copulation time.

Ecdysone receptor EcR-A in pC1 neurons regulates virgin female copulation rate

Given that PTTH regulates virgin female receptivity through ecdysone which acts on its receptor EcR, we then asked whether ecdysone regulates the function of neurons associated with virgin female receptivity through EcR. pC1 and vpoDN neurons are two main dsx+ neurons involved in virgin female receptivity (Wang et al., 2021; Zhou et al., 2014). pC1 neurons encode the mating status of female flies, vpoDN neurons regulate the VPO when females attend to accept males. EcR-A and EcR-B1 are the two prominently expressed ecdysone receptors in the CNS (Riddiford et al., 2000). First, we tested the expression of EcR-A and EcR-B1 in these two neurons on the second day of the pupal stage when ecdysone functions as the main mover in the metamorphosis (Dalton et al., 2009; Truman et al., 1994). The GFP signals labeled by pC1-ss2-Gal4 and vpoDN-ss1-Gal4 were merged well with the signals of both EcR-A and EcR-B1 antibodies, respectively (Figure 5—figure supplement 1). This revealed that EcR-A and EcR-B1 express in both pC1 and vpoDN neurons. We then tested the function of EcR in pC1 and vpoDN neurons through reducing the expression of EcR-A and EcR-B1, respectively. We used the split-Gal4 for pC1 and vpoDN neurons to drive the UAS-EcR-RNAi. First, we reduced the expression of all EcR isoforms in pC1 neurons, this decreased the copulation rate and prolonged the latency to copulation significantly (Figure 5—figure supplement 2A). Furthermore, we reduced the expression of EcR-A in pC1 neurons. The virgin female had the significant lower copulation rate and longer latency to copulation (Figure 5A). The reduced copulation rate had no relationship with the attractivity (Figure 5E) and the locomotion activity of virgin females (Figure 5—figure supplement 2B). When reducing the expression of EcR-B1 in pC1 neurons, virgin females had the significant longer latency to copulation but the comparable copulation rate to controls (Figure 5B). However, reducing the expression of EcR-A (Figure 5—figure supplement 3A–C) and EcR-B1 (Figure 5—figure supplement 3D–F) using three split vpoDN-Gal4s in vpoDN neurons all did not affect virgin female receptivity. This suggested that the expression of EcR-A in pC1 neurons regulates virgin female copulation rate, but EcR isoforms in vpoDN neurons do not modulate virgin female receptivity.

Figure 5. Virgin females with reduced EcR-A in pC1 neurons have reduced sexual receptivity.

(A) Knock-down of EcR-A in pC1 neurons driven by pC1-ss2-Gal4 significantly decreased the copulation rate and increased the latency to copulation. (B) Knock-down of EcR-B1 in pC1 neurons driven by pC1-ss2-Gal4 significantly prolonged the latency to copulation. Knock-down of EcR-A (C) or EcR-B1 (D) in pC1 neurons driven by pC1-ss1-Gal4 did not affect the copulation rate or the latency to copulation. (E) Courtship index of wild-type males toward a female with the indicated genotype (n = 8). (F) The number of eggs laid by virgin females during the third to fourth day after eclosion when EcR-A was knocked down in pC1 neurons (n = 17–36). The UAS-EcR-A-RNAi control causes a massive decrease in female fertility. (G) Knock-down of EcR-A in pC1 neurons decreased the opening of vaginal plate of virgin females compared with controls (n = 8). (H) Knock-down of EcR-A in pC1 neurons increased the ovipositor extrusion of virgin females compared with controls (n = 8). (I–K) Virgin female copulation rate when EcR-A was knocked down in pC1 neurons temporally restricted by shifts from 18°C to 30°C. EcR-A was knocked down during the whole larval (I), pupal (J), and adult (K) stages, respectively. When the experiment was done at the pupal stage is the only situation when the controls were both different from the experimental (J). The comparison referred to flies with decreased EcR isoform in pC1 neurons. Female flies for behavioral assay were 4- to 6-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For other comparisons, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns indicates no significant difference.

Figure 5—source data 1. Copulation time, courtship index, number of eggs, number of vaginal plate opening (VPO), and number of ovipositor extrusion (OE).

Figure 5—figure supplement 1. Expression of EcR-A and EcR-B1 in pC1 and vpoDN neurons.

(A–C) pC1 neurons were colabeled by pC1-ss2 driving UAS-mCD8-GFP (green, A) and EcR-A antibodies (red, B). Magnification of green boxed region in (C) is shown in (D1–D3). (E–G) pC1 neurons were colabeled by pC1-ss2 driving UAS-mCD8-GFP (green, E) and EcR-B1 antibodies (red, F). Magnification of green boxed region in (G) is shown in (H1–H3). (I–K) vpoDN neurons were colabeled by vpo-ss1 driving UAS-mCD8-GFP (green, I) and EcR-A antibodies (red, J). Magnification of green boxed region in (K) is shown in (L1–L3). (M–O) vpoDN neurons were colabeled by vpo-ss1 driving UAS-mCD8-GFP (green, M) and EcR-B1 antibodies (red, N). Magnification of green boxed region in (O) is shown in (P1–P3). Female flies were during prepupae stage. Scale bars for magnified regions are 5 μm, for others are 50 μm.

Figure 5—figure supplement 2. Reduced EcR in pC1 neurons reduces virgin female receptivity.

(A) Knock-down of EcR in pC1 neurons driven by pC1-ss2-Gal4 significantly decreased the copulation rate and increased the latency to copulation. (B) Mean velocity had no significant change when EcR-A was knocked down in pC1 neurons compared with controls (Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests, n = 8–11). The comparison referred to pC1-ss2-Gal4/UAS-EcR-RNAi (A) and pC1-ss2-Gal4/UAS-EcR-A-RNAi (B). Female flies were 4- to 6-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns indicates no significant difference.

Figure 5—figure supplement 2—source data 1. Copulation time and walking speed.

Figure 5—figure supplement 3. Reduced EcR in vpoDN neurons has no effect on virgin female receptivity.

(A–C) Knock-down of EcR-A in vpoDN neurons driven by vpoDN-ss1-Gal4, vpoDN-ss2-Gal4, and vpoDN-ss3-Gal4 had no effect on virgin female receptivity. (D–F) Knock-down of EcR-B1 in vpoDN neurons driven by vpoDN-ss1-Gal4, vpoDN-ss2-Gal4, and vpoDN-ss3-Gal4 had no effect on virgin female receptivity. The comparison referred to flies with decreased EcR isoform in vpoDN neurons. Female flies were 4- to 6-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM. *p < 0.05, **p < 0.01, ***p < 0.001, ns indicates no significant difference.

Figure 5—figure supplement 3—source data 1. Copulation time.

Figure 5—figure supplement 4. Reduced EcR-A in pC1d neurons has no effect on virgin female receptivity.

(A) Knock-down of EcR-A in pC1d neurons had no effect on virgin female copulation rate and latency to copulation. The comparison referred to pC1d-Gal4/UAS-EcR-A-RNAi. Female flies were 4- to 6-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM, ns indicates no significant difference.

Figure 5—figure supplement 4—source data 1. Copulation time.

Two split-Gal4 drivers for pC1 neurons had been obtained previously. pC1-ss1-Gal4 labels pC1-a, -c, and -e neurons, and pC1-ss2-Gal4 labels all pC1-a, -b, -c, -d, and -e neurons (Wang et al., 2020b). We also tested virgin female receptivity when EcR-A or EcR-B1 were reduced in pC1-a, -c, and -e neurons simultaneously using pC1-ss1-Gal4, respectively. While the copulation rate or the latency to copulation did not change significantly (Figure 5C, D). This suggested that, pC1b only, or both pC1b and pC1d neurons is necessary for the functions of EcR-A and EcR-B1 in pC1 neurons on virgin female receptivity. Whether pC1d is involved in the regulation of female receptivity is uncertain (Deutsch et al., 2020; Schretter et al., 2020; Taisz et al., 2023). However, when reducing EcR-A in pC1d neurons alone using the specific split-Gal4 SS56987 (Schretter et al., 2020), virgin female receptivity including copulation rate and latency to copulation did not change significantly compared with controls (Figure 5—figure supplement 4). These results suggested that the function of EcR-A in pC1b neurons is necessary for virgin female copulation rate.

As recently mated females may reduce sexual receptivity and increase egg laying (Avila et al., 2011; Kubli, 2003). we asked whether the decreased copulation rate induced by EcR-A could be a post-mating response and correlate with elevated egg laying. To address this, we examined the number of eggs laid by virgin females when EcR-A was reduced in pC1 neurons. We found that manipulation of EcR-A did not enhance egg laying significantly in virgin females (Figure 5F), although the UAS-EcR-A-RNAi control causes a massive decrease in female fertility. Meanwhile, we further analyzed whether reduction of EcR-A in pC1 neurons regulates the VPO or the OE. We found that reducing the EcR-A expression in pC1 neurons lead to the significantly less VPO and more OE (Figure 5G, H). These results suggested that reduced EcR-A expression in pC1 neurons results in the similar phenotype to that of mated females.

EcR-A participates in the morphological development of pC1 neurons

EcR isoforms have distinct temporal and spatial expression patterns in the CNS (Riddiford et al., 2000; Truman et al., 1994). It is unknown when EcR-A functions in pC1 neurons for virgin female receptivity. Thus, we examined virgin female receptivity when EcR-A expression was conditionally reduced through RNAi via the pC1-ss2-Gal4 under the control of the temporal and regional gene expression targeting system (McGuire et al., 2004). EcR-A was reduced during the whole larval, pupal and adult stage, respectively (Figure 5I–K). When the experiment was done at the pupal stage is the only situation when the controls were both different from the experimental (Figure 5J). The result suggested that EcR-A in pC1 neurons plays a role in virgin female receptivity during metamorphosis. This is consistent with that PTTH regulates virgin female receptivity before the start of metamorphosis.

We then tested how EcR-A functions in pC1 neurons to modulate virgin female receptivity. First, we tested the morphology of pC1 neurons when reducing the expression of EcR-A in pC1 neurons. We found that the morphology of pC1-ss2-Gal4 expressing neurons appeared after the formation of the white pupa (Figure 6A1). The reduced EcR-A expression induced the more elaborated morphologies of the pC1-d/e cells, especially the extra vertical projection (EVP) near the midline of brains (Figure 6B–D; Deutsch et al., 2020). These changes exhibited from the second day of the pupal stage (Figure 6B1, B2, E) and maintained at the adult stage (Figure 6D1, D2, F). Meanwhile, the number of pC1 cell bodies in adult flies when EcR-A was reduced were the same as that of wild-type flies (Figure 6G). Previous studies suggested that pC1d cells serve as a hub within the central brain for dsx+ and fru+ neurons (Deutsch et al., 2020). Thus, the abnormal development of pC1d neurons may induce the changes between pC1d neurons and other dsx+ and fru+ neurons to affect associated behaviors.

Figure 6. Reduced EcR-A in pC1 neurons induces the morphological changes.

(A1, A2) pC1-ss2-Gal4 expressing neurons appeared at the start of the pupal stage. (B–D) Reduced EcR-A in pC1 neurons induced more elaborated morphologies of pC1d axons, especially the extra vertical projection (EVP). The EVP regions of pC1d neurons was indicated by arrows. The morphological changes appeared on the second day of the pupal stage (B1, B2) and retained to the adult stage including the first day (C1, C2) and the fourth day (D1, D2) of the adult stage. p0, the first day of the pupal stage; p2, the second day of the pupal stage; A1, the first day of the adult stage; A4, the fourth day of the adult stage. Fluorescence intensity of EVP in pC1d neurons on the second day of the pupal stage (E) and the fourth day of the adult stage (F) was quantified when EcR-A was reduced in pC1 neurons (n = 7). The quantified EVP regions were marked in (B) and (D) with orange ellipses. (G) pC1 neurons of the fourth day adults had comparable cell body number when EcR-A was reduced in pC1 neurons or not (n = 7). (H) Basal GCaMP6s signals in the lateral protocerebral complex (LPC) region of pC1 neurons when EcR-A was reduced in pC1 neurons (n = 22). LPC regions, the neurites extending from pC1 cell bodies, were marked with orange square in (D1) and (D2). The comparison referred to flies with decreased EcR isoform in pC1 neurons. Female flies in (G, H) were 4-day-old adults. Scale bars are 50 μm. For all comparisons, Mann–Whitney U test is applied. Error bars indicate SEM. **p < 0.01, ***p < 0.001, ns indicates no significant difference.

Figure 6—source data 1. Fluorescence intensity, cell number, and calcium activity.

Furthermore, we asked whether reduced female copulation rate was due to that EcR-A expression affected the activity of pC1 neurons. Because all pC1 cells characterized so far project to the lateral junction of the lateral protocerebral complex (LPC) (Kimura et al., 2015; Rezával et al., 2016; Scheffer et al., 2020; Wang et al., 2020b; Wu et al., 2019; Zhou et al., 2014), we expressed GCamp6s in all pC1 neurons and tested the calcium signals in the lateral junction of LPC when EcR-A was knocked down (Figure 6D1, D2). Reduced EcR-A did not induce significantly different calcium responses in the LPC (Figure 6H). Thus, our results suggested that the decreased female copulation rate induced by reduced EcR-A in pC1 neurons was mainly due to the morphological changes of pC1b neurons, which then modulate the connections of pC1b neurons with other neurons.

The function of PTTH on EcR-A and pC1 neurons

As newly formed prepupae, the ptth-Gal4 > UAS-Grim flies display similar changes in gene expression to the genetic control flies to response to a high-titer ecdysone pulse. These genes include the repression of EcR (McBrayer et al., 2007). According to the contradictory functions of PTTH deletion and EcR-A reduction in pC1 neurons, we wanted to know whether there is a similar feedforward relationship between PTTH and EcR-A. We quantified the EcR-A expression in the whole pupa body during the start of prepupa stage, when the pC1-ss2-Gal4 expressing neurons appear. Indeed, PTTH−/− induced upregulated EcR-A compared with PTTH−/+ flies (Figure 7A). This suggested the feedforward relationship between PTTH and EcR-A expression during the start of prepupa stage. Consistent with this, when PTTH was deleted, pC1 neurons exhibited the contradictory pattern to that when EcR-A was decreased in pC1 neurons (Figure 7B, C). These suggested the feedforward relationship between PTTH and EcR-A, and may explain the contradictory functions of PTTH deletion and EcR-A reduction in pC1 neurons for female receptivity.

Figure 7. The function of prothoracicotropic hormone (PTTH) on EcR-A and pC1 neurons.

(A) qRT-PCR for EcR-A when PTTH was deleted. Bars represent mean ± SEM. p values are from Mann–Whitney U test (n = 8 for PtthDelete/+ and n = 6 for PtthDelete/PtthDelete, each sample contains about 10 bodies of newly formed prepupae). *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001, ns indicates no significant difference. (B) Deletion of PTTH induced less elaborated morphologies of pC1d axons, especially the extra vertical projection (EVP). The EVP regions of pC1d neurons was indicated by arrows. Female flies were 4-day-old adults. (C) Fluorescence intensity of EVP in pC1d neurons on the fourth day was quantified when PTTH was deleted (n = 7). The quantified EVP regions were marked in (B1) and (B2) with red ellipses. (D) Torso-Gal4 and Dsx-LexA were labeled by stinger GFP and stingerRFP, respectively. Arrows indicated the overlap of GFP and RFP signals. Representative of five female brains. Scale bars, 50 μm. (E, F) Knock-down of Torso in pC1 neurons inhibited virgin female copulation rate and enhanced latency to copulation. Females had similar locomotion speeds between groups (F). The pC1-ss2-Gal4 control causes a massive decrease in female receptivity. The comparison referred to pC1-ss2-Gal4/UAS-torso-RNAi. Female flies were 4- to 6-day-old adults. The number of female flies paired with wild-type males is displayed in parentheses. For the copulation rate, chi-square test is applied. For the latency to copulation, Kruskal–Wallis ANOVA and post hoc Mann–Whitney U tests are applied. Error bars indicate SEM, *p < 0.05, **p < 0.01, ***p < 0.001, ns indicates no significant difference.

Figure 7—source data 1. Relative mRNA level, fluorescence intensity, copulation time, and walking speed.

Furthermore, PTTH neurons are dsx-positive, almost all neurons regulating female receptivity express DsxF. We wanted to know whether PTTH neurons affect other dsx+ neurons, including pC1 neurons. Indeed, we detected the slightly overlap of dsx-LexA>LexAop-RFP and torso-Gal4>UAS-GFP during larval stage (Figure 7D). Furthermore, decreasing torso expression in pC1 neurons significantly inhibit female receptivity (Figure 7E). The inhibited virgin female receptivity had no relationship either with the locomotion activity of virgin females (Figure 7F). These results suggest that, PTTH regulates female receptivity not only through ecdysone, but also may through regulating other neurons especially DsxF-positive neurons associated with female receptivity directly.

Discussion

In this study, we found that peptide hormone PTTH negatively modulates virgin female receptivity through ecdysone. PTTH neurons are doublesex-positive and regulate virgin female receptivity during neural development. PTTH deletion resulted in the increased ecdysone receptor EcR-A expression in newly formed prepupae. Furthermore, EcR-A functions in pC1 neurons to positively regulate virgin female receptivity during metamorphosis mainly through modulating the anatomical morphology of pC1b neurons. Additionally, decreasing the expression of PTTH receptor torso in pC1 neurons inhibited female receptivity. Taken together, our results revealed the contrary functions of PTTH deletion and reduction of EcR-A in pC1 neurons during neurodevelopment. In addition, EcR-A in pC1 neurons regulates virgin female copulation rate during metamorphosis mainly through modulating the morphology of pC1b neurons.

Most of neurons regulating sexual behaviors in female flies are dsx-positive. Our results showed that PTTH neurons are also dsx+ neurons. This suggested that PTTH neurons have relationships with other dsx+ neurons and the juvenile–adult transition is regulated by doublesex gene. Indeed, we detected the overlap between torso-Gal4 signal and dsx-LexA signal at the larval stage. Furthermore, when PTTH receptor torso was decreased in dsx+ pC1 neurons, female receptivity was inhibited. This suggested that PTTH functions in pC1 neurons through neuronal projection or endocrine pathway directly to regulate female receptivity. However, we did not detect the change of female receptivity when DsxF was decreased in PTTH neurons. This suggested that DsxF functions in PTTH neurons on other aspects, such as the development of PTTH neurons or the synthesis and release of PTTH to regulate development.

PTTH regulates virgin female receptivity in an ecdysone-dependent manner before metamorphosis. Ecdysone functions through its receptor EcR which is involved in all phases of the nervous system development. In our study, reduced EcR-A expression in all pC1 neurons, which encode the mating status of females, lead to the decreased copulation rate. While, reduced EcR-A in pC1-a, c and e simultaneously did not reduce the copulation rate significantly. This suggested that EcR-A plays the critical role in pC1-b and/or -d neurons for regulating virgin female receptivity. Our results revealed that reduced EcR-A induced the more elaborated morphologies of pC1d neurons. Previous studies detected the synaptic connections between the axons of pC1d and the dendrites of DNp13 neurons (Deutsch et al., 2020; Mezzera et al., 2020). DNp13 neurons are command neurons for OE. When females extruded, the ovipositor physically impedes copulation (Mezzera et al., 2020; Wang et al., 2020a). However, reduced EcR-A expression in pC1d neurons did not affect virgin female receptivity (Figure 5—figure supplement 4). This might be due to three possibilities. First, the more elaborated morphologies of pC1d neurons did not affect synaptic connections between pC1d and DNp13 neurons. Second, the unchanged pC1 neural activity could not affect the neural activity of DNp13 neurons. Third, the morphological change of pC1d neurons is not sufficient for the decreased copulation rate. To sum, these suggest that the morphological change of pC1b neurons is necessary for the decreased copulation rate. However, due to the lack of pC1b drivers, we could not rule out morphological changes in pC1b neurons when EcR-A was reduced.

In our study, PTTH negatively regulates female receptivity, while EcR-A positively regulates female receptivity. Previous study revealed that, expression of EcR is repressed in newly formed prepupae to response to high-titer ecdysone pulse (McBrayer et al., 2007). We detected the similar feedforward relationship between PTTH and EcR-A in newly formed prepupae. Consistent with this, we detected the contrary pattern of pC1d neurons when PTTH was deleted, compare with that when EcR-A was decreased in pC1 neurons. However, it is not sure that PTTH deletion could result in the increased expression of EcR-A in pC1 neurons. In addition, PTTH deletion must affect the development of almost other neurons, but not only pC1 neurons. This maybe the reason for that reduction of Torso in pC1 neurons had contrary effect on female receptivity to that when PTTH is deleted. So, the feedforward relationship between PTTH and EcR-A in newly formed prepupae is one possible reason for the contrary functions of PTTH deletion and reduction of EcR-A in pC1 neurons on female receptivity.

Previous studies have demonstrated that the development of fru+ neurons need EcR-A in male D. melanogaster. Furthermore, reduced EcR-A in fru+ neurons induced the male–male courtship (Dalton et al., 2009). We also detected the male–male courtship behavior when PTTH was deleted (data not shown) as previous study (McBrayer et al., 2007). This remits to the impact of ecdysone on dsx+ or fru+ neurons. Similarly, PTTH deletion may also affect the development of other neurons and further other behaviors such as the female fecundity and the body size (McBrayer et al., 2007; Rewitz et al., 2009; Shimell et al., 2018), although there is no sufficient evidence for the effects of fecundity and the body size on female receptivity. So, we could not exclude all effects of other aspects on female receptivity.

Our results suggested a regulatory role of PTTH in virgin female receptivity. Even though insects and mammals represent highly diverged classes, insects have evolved a similar strategy for triggering the juvenile–adult transition (Herbison, 2016; Pan and O’Connor, 2019). The juvenile–adult transition involves the HPG axis in mammals and the PG axis in insects. Among the neurons belonging to the axis, PTTH neurons and GnRH neurons have the similar function to stimulate the PG gland and pituitary gland to release hormones which trigger maturation, respectively. It will be interesting to study the function of GnRH neurons on the mammal sexual behaviors.

This work extends the understanding of how neurodevelopmental processes regulate adult sexual behavior.

Materials and methods

Key resources table Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information	
Antibody	Anti-Bruchpilot (nc82), mouse monoclonal	Developmental Studies Hybridoma Bank	Cat# nc82, RRID: AB_2314866	IHC (1:40)	
Antibody	Anti-Drosophila ecdysone receptor (EcR-A), mouse monoclonal	Developmental Studies Hybridoma Bank	Cat# 15G1a (EcR-A), RRID: AB_528214	IHC (1:10)	
Antibody	Anti-Drosophila ecdysone receptor (EcR-B1), mouse monoclonal	Developmental Studies Hybridoma Bank	Cat# AD4.4(EcR-B1), RRID: AB_2154902	IHC (1:10)	
Antibody	Anti-GFP, rabbit polyclonal	Thermo Fisher Scientific	Cat# A-11122, RRID: AB_221569	IHC (1:1000)	
Antibody	Anti-GFP, chicken polyclonal	Thermo Fisher Scientific	Cat# A10262, RRID: AB_2534023	IHC (1:1000)	
Antibody	Alexa Fluor 488, goat anti-rabbit polyclonal	Thermo Fisher Scientific	Cat# A-11034, RRID: AB_2576217	IHC (1:500)	
Antibody	Alexa Fluor 488, goat anti-chickent polyclonal	Thermo Fisher Scientific	Cat# A-11039; RRID: AB_2534096	IHC (1:500)	
Antibody	Alexa Fluor 488, goat anti-mouse polyclonal	Thermo Fisher Scientific	Cat# A-11029, RRID: AB_2534088	IHC (1:500)	
Antibody	Alexa Fluor 546, goat anti-rabbit polyclonal	Thermo Fisher Scientific	Cat# A-11010, RRID: AB_2534077	IHC (1:500)	
Antibody	Anti-RFP, rabbit polyclonal	Thermo Fisher Scientific	Cat# R10367, RRID: AB_10563941	IHC (1:500)	
Antibody	Alexa Fluor 647, goat anti-mouse polyclonal	Thermo Fisher Scientific	Cat# A-21235,
RRID: AB_2535804	IHC (1:500)	
Antibody	Anti-PTTH, rabbit polyclonal	Zhou Lab, Chinese Academy of Sciences, this paper	N/A	IHC (1:1300)	
Chemical compound, drug	Paraformaldehyde (PFA)	Electron Microscopy Sciences	Cat#15713	8% PFA diluted in 1× PBS at 1:4 or 1:2	
Chemical compound, drug	DPX Mountant	Sigma-
Aldrich	Cat# 44581		
Chemical compound, drug	Normal goat serum	Sigma-
Aldrich	Cat# G9023		
Chemical compound, drug	20-Hydroxyecdysone	Cayman	Cat# 16145	Dissolved in 95% ethanol, 0.2 mg/ml	
Chemical compound, drug	TRIzol	Ambion	Cat# 15596018		
Genetic reagent (D. melanogaster)	LexAop2-mCD8::GFP	Bloomington Stock Center	BL# 32203, RRID:BDSC_32203		
Genetic reagent (D. melanogaster)	;;UAS-mCD8::GFP	Bloomington Stock Center	BL# 32194, RRID:BDSC_32194		
Genetic reagent (D. melanogaster)	;UAS-mCD8::GFP;	Bloomington Stock Center	BL# 5137, RRID:BDSC_5137		
Genetic reagent (D. melanogaster)	UAS-dTrpA1/cyo	Garrity Lab, Brandeis University	N/A		
Genetic reagent (D. melanogaster)	UAS-Kir2.1	Bloomington Stock Center	BL# 6595, RRID:BDSC_6595		
Genetic reagent (D. melanogaster)	Ptth-Gal4	Rao Lab, Peking University	N/A		
Genetic reagent (D. melanogaster)	PtthLexA	Rao Lab, Peking University	N/A		
Genetic reagent (D. melanogaster)	ΔPTTH	Rao Lab, Peking University	N/A		
Genetic reagent (D. melanogaster)	UAS-PTTH	Zhou Lab, Chinese Academy of Sciences, this paper	N/A		
Genetic reagent (D. melanogaster)	isoCS	Rao Lab, Peking University	N/A		
Genetic reagent (D. melanogaster)	elav-Gal4	Rao Lab, Peking University	N/A		
Genetic reagent (D. melanogaster)	UAS-GFPStinger	Janelia Research Campus	N/A		
Genetic reagent (D. melanogaster)	LexAop-tomato	Janelia Research Campus	N/A		
Genetic reagent (D. melanogaster)	LexAop2-FlpL	Janelia Research Campus	N/A		
Genetic reagent (D. melanogaster)	UAS >stop > mCD8-GFP	Janelia Research Campus	N/A		
Genetic reagent (D. melanogaster)	Dsx-Gal4	Janelia Research Campus	N/A		
Genetic reagent (D. melanogaster)	Dsx-LexA	Janelia Research Campus	N/A		
Genetic reagent (D. melanogaster)	tub-Gal80ts	Pan Lab, Southeast University	BL# 7018, RRID:BDSC_7018		
Genetic reagent (D. melanogaster)	pC1-ss1-Gal4	Wang Lab, Lingang Laboratory	N/A		
Genetic reagent (D. melanogaster)	pC1-ss2- Gal4	Wang Lab, Lingang Laboratory	N/A		
Genetic reagent (D. melanogaster)	vpoDN-ss1-Gal4	Wang Lab, Lingang Laboratory	N/A		
Genetic reagent (D. melanogaster)	vpoDN-ss2-Gal4	Wang Lab, Lingang Laboratory	N/A		
Genetic reagent (D. melanogaster)	vpoDN-ss3-Gal4	Wang Lab, Lingang Laboratory	N/A		
Genetic reagent (D. melanogaster)	UAS-EcR-RNAi	Bloomington Stock Center	BL# 9327, RRID:BDSC_9327		
Genetic reagent (D. melanogaster)	UAS-EcR-A-RNAi	Bloomington Stock Center	BL# 9328, RRID:BDSC_9328		
Genetic reagent (D. melanogaster)	UAS-EcR-B1-RNAi	Bloomington Stock Center	BL# 9329, RRID:BDSC_9329		
Genetic reagent (D. melanogaster)	pC1d-Gal4	Bloomington Stock Center	BL# 86847, RRID:BDSC_86847		
Genetic reagent (D. melanogaster)	UAS-PTTH-RNAi	VDRC	V102043		
Genetic reagent (D. melanogaster)	UAS-DsxF-RNAi	Pan Lab	N/A		
Genetic reagent (D. melanogaster)	UAS-Torso-RNAi	Liu Lab	BL# 33627, RRID:BDSC_33627		
Recombinant DNA reagent	pBSK-attP-3P3-RFP-loxP	Deng et al., 2019	N/A		
Recombinant DNA reagent	pBSK-attB-loxP-myc-T2A-Gal4Gal4-GMR-miniwhite	Deng et al., 2019	N/A		
Recombinant DNA reagent	pBSK-attB-loxP-V5-T2A-LexA::p65-GMR-miniwhite	Deng et al., 2019	N/A		
Software, algorithm	MATLAB	MathWorks, Natick, MA	https://www.mathworks.com/products/matlab.html		
Software, algorithm	ImageJ	National Institutes of Health	https://imagej.nih.gov/ij/		
Software, algorithm	Prism 7	GraphPad	https://www.graphpad.com/		
Software, algorithm	R 4.1.3	RStudio	https://www.r-project.org		

Fly stocks

Flies were reared on standard cornmeal-yeast medium under a 12-hr:12-hr dark:light cycle at 25°C and 60% humidity. All the knock-out lines in this study for screening have been published (Pavlou and Goodwin, 2013). The following strains were obtained from Dr. Yi Rao: isoCS (wild-type), ΔPtth, Ptth-Gal4, Ptth-LexA, elav-Gal4, and UAS-Kir2.1 (BL#6595). UAS-dTrpA1 was a gift from Dr. Paul Garrity. UAS-GFPStinger, LexAop-tomato, LexAop2-FlpL, UAS > stop > mCD8-GFP, dsx-Gal4, and dsx-LexA Mellert et al., 2010 have been described previously (Pfeiffer et al., 2008; Pfeiffer et al., 2010) and are obtained from Janelia Research Campus. tub-Gal80ts (BL#7018) was provided by Dr. Yufeng Pan. pC1-ss1-Gal4, pC1-ss2-Gal4, vpoDN-ss1-Gal4, vpoDN-ss2-Gal4, and vpoDN-ss3-Gal4 were provided by Dr. Kaiyu Wang. Torso-RNAi (BL# 33627) was a gift from Suning Liu. The following lines were obtained from the Bloomington Drosophila Stock Center: UAS-EcR-RNAi (BL# 9327), UAS-EcR-A-RNAi (BL# 9328), UAS-EcR-B1-RNAi (BL# 9329), UAS-mCD8::GFP (BL# 32194), LexAop2-mCD8::GFP (BL# 32203), UAS-mCD8::GFP (BL# 5137), and pC1d-Gal4 (BL# 86847). UAS-PTTH-RNAi (v102043) was from Vienna Drosophila Resource Center (VDRC).

Behavioral assays

Flies were reared at 25°C and 60% humidity under a 12-hr light:12-hr dark cycle. Virgin females and wild-type males were collected upon eclosion, placed in groups of 12 flies each and aged 4–6 days (except for the assays for PTTH mutant on different days after eclosion, and the molecular rescue assay for the 24-hr-old females) before carrying out behavioral assay except for the transient thermogenetic experiments. Female receptivity assays were conducted as previously described (Wang et al., 2022; Zhou et al., 2014). A virgin female of defined genotype and a wild-type male were gently cold anesthetized and, respectively, introduced into two layers of the courtship chambers separated by a removable transparent film. The flies were allowed to recover for at least 45 min before the film was removed to allow the pair of flies to contact. The mating behavior was recorded using a camera (Canon VIXIA HF R500) for 30 min at 17 fps for further analysis.

For transient activation experiment by dTrpA1 in adult stage, flies were reared at 23°C. Flies were loaded into courtship chamber and recovered for at least 30 min at 23°C, then were placed at 23°C (control group) or 29°C (experimental group) for 30 min prior to removing the film and videotaping. For activation experiment by dTrpA1 during development, flies were reared at 29°C during the specific stages compared with the controls who were reared at 23°C all the time. Flies were loaded into courtship chamber and recovered for at least 45 min at 23°C prior to removing the film and videotaping.

Quantification and statistical analysis of female receptivity behavior

Two parameters including copulation rate and latency to copulation were used to characterize receptivity and we got the datasets of two parameters from the same flies. The time from removing the film to successful copulation was measured for each female. The number of females that had engaged in copulation by the end of each 1 min interval within 30 min were summed and plotted as a percentage of successful copulation. The latency to copulation was the time from removing the film to successful copulation. All the time points that female successfully copulated were manually analyzed and the data of unhealthy flies were discarded.

Temporally restricted RNAi

tub-Gal80ts crosses were reared at either 18°C for control groups or 30°C for experimental groups. Virgin females were collected at eclosion and were placed in groups of 12 flies each and aged 4–6 days before carrying out behavior assay. Assays were tested at 23°C.

Male courtship index

Courtship index was defined as the proportion of time the male followed, oriented toward and attempted to copulate the female within 5 min of courtship initiation, marked by the initial orientation toward and following the female.

VPO and OE

A virgin female of defined genotype and a wild-type male were aspirated into the courtship chambers and, respectively, introduced into two layers of the courtship chambers separated by a removable transparent film. The flies were allowed to recover for 30 min before the film was removed. To allow visualization of VPO, we recorded uncompressed image sequences at 896 × 896 pixels and 50 frames per second using a Photron Mini AX camera (Photron) with an AF-S VR Micro-Nikkor 105 mm lens (Nikon). Instances of VPO and OE were scored blind to genotype from frame by-frame playback during the first 5 min of courtship or until copulation if it occurred within 5 min. Courtship initiation was defined as the male orienting toward and beginning to follow the female. Rare trials with fewer than 30 s of total courtship were discarded.

Locomotion assays

The rearing and experimental conditions in locomotion assays were the same as that in the corresponding female receptivity assays, excepting that individual females were loaded in the chambers without males. Spontaneous movements of the flies were recorded with a camera (Canon VIXIA HF R500) for 30 min at 30 fps for further analysis. The activity of flies during the middle 10 min was analyzed to calculate the average walking speed using Ctrax software.

Egg laying

Virgin females were collected upon eclosion and one fly was housed on standard medium at 25°C, 60% relative humidity, 12-hr light:12-hr dark and allowed to lay eggs in single vials. Each fly was transferred into new food tube every 24 hr. The number of eggs was counted at the end of each 24-hr period. The numbers during the third and fourth day were summed for statistics and plot.

Immunohistochemistry

Whole brains of flies were dissected in 1× PBS (phosphate buffered saline) and fixed in 2% paraformaldehyde diluted in 1× PBS for 55 min at room temperature. The samples were washed with PBT (1× PBS containing 0.3% Triton X-100) for 1 hr (3 × 20 min), followed by blocking in 5% normal goat serum (Blocking solution, diluted in 0.3% PBT) for 1 hr at room temperature. Then, the samples were incubated in primary antibodies (diluted in blocking solution) for 18–24 hr at 4°C. Samples were washed with 0.3% PBT for 1 hr (3 × 20 min), then were incubated in secondary antibodies (diluted in blocking solution) for 18–24 hr at 4°C. Samples were washed with 0.3% PBT for 1 hr (3 × 20 min), then were fixed in 4% paraformaldehyde for 4 hr at room temperature. After washed with 0.3% PBT for 1 hr (3 × 20 min), brains were mounted on poly-L-lysine-coated coverslip in 1× PBS. The coverslip was dipped for 5 min with ethanol of 30% → 50% → 70% → 95% → 100% sequentially at room temperature, and then dipped for 5 min three times with xylene. Finally, brains were mounted with DPX (Distyrene, Plasticizer and Xylene) and allowed DPX to dry for 2 days before imaging. Primary antibodies used were: chicken anti-GFP (1:1000; Life Technologies #A10262), rabbit anti-GFP (1:1000; Life Technologies #A11122), rabbit anti-RFP (1:1000; Life Technologies #R10367), rabbit anti-PTTH antibody (1:1300), mouse anti-nc82 (1:40; DSHB), mouse anti-EcR-A (1:10; AB_528214), and mouse anti-EcR-B1 (1:10; AB_2154902). Secondary antibodies used were: Alexa Fluor goat anti-chicken 488 (1:500; Life Technologies #A11039), Alexa Fluor goat anti-rabbit 488 (1:500; Life Technologies #A11034), Alexa Fluor goat anti-rabbit 546 (1:500; Life Technologies #A11010), Alexa Fluor goat anti-mouse 647 (1:500; Life Technologies #A21235), and Alexa Fluor goat anti-mouse 488 (1:500; Life Technologies #A11029).

Confocal microscopy and image analysis

Confocal imaging was performed under an LSM 710 inverted confocal microscope (ZEISS, Germany), with a Plan-Apochromat 20×/0.8 M27 objective or an EC Plan-Neofluar 40×/1.30 oil DIC M27 objective, and later analyzed using Fiji software.

Generation of anti-PTTH antibody

The antisera used to recognize PTTH peptide were raised in New Zealand white rabbits using the synthetic peptide N′-TSQSDHPYSWMNKDQPWQFKC-C′. The synthesis of antigen peptide, the production and purification of antiserum were performed by Beijing Genomics Institute (BGI).

Generation of UAS-PTTH

pJFRC28-5XUAS-IVS-GFP-p10 (#12073; Fungene Biotechnology, Shanghai, China) was used for the generation of the pJFRC28-UAS-PTTH construct. The pJFRC28-10XUAS-IVS-GFP-p10 plasmid was digested with NotI and XbaI to remove the GFP coding sequence, and then the cDNA of PTTH was cloned into this plasmid by Gibson Assembly. The Kozak sequence was added right upstream of the ATG. UAS-PTTH constructs were injected and integrated into the attP2 site on the third chromosome through phiC31 integrase mediated transgenesis. The construct was confirmed using DNA sequencing through PCR. The primers used for cloning PTTH cDNA were as follows:

UAS-PTTH-F

ATTCTTATCCTTTACTTCAGGCGGCCGCAAAATGGATATAAAAGTATGGCGACTCC

UAS-PTTH-R

GTTATTTTAAAAACGATTCATTCTAGATCACTTTGTGCAGAAGCAGCCG

Genomic DNA extraction and RT-PCR

Genomic DNA was extracted from 10 whole bodies of wandering flies using MightyPrep reagent for DNA (Takara #9182). Whole body RNA was extracted from 10 whole bodies of wandering flies using TRIzol (Ambion #15596018). cDNA was generated from total RNA using the Prime Script reagent kit (Takara #RR047A). Candidates of ΔPtth were characterized by the loss of DNA band in the deleted areas through PCR on the genomic DNA and cDNA. Primer sequences used in Figure 1 are listed in Supplementary file 1.

Measurements of pupariation timing and adult mass

The flies were reared at 25°C and 60% humidity under a 12-hr light:12-hr dark cycle. Two-hour time collections of embryos laid on standard food vials. Each vial contained 20–30 eggs. The range of time for pupariation was recorded for each vial. Sexed adults of 24-hr-old were weighted in groups of 10 flies using a NENVER-TP-214 microbalance at the same time.

Identification of sex in Drosophila larvae

Third-instar larvae can be sexed (True & John, 2014). Gonads are translucent and visible in side view in the posterior third of the larva. The male gonads are about five times bigger than the female gonads. The identified wandering female and male larvae were reared in different vials for the subsequent experiments.

Rescue by 20-hydroxyecdysone feeding

Thirty freshly ecdysed ΔPtth L3 larvae, grown at 25°C and 60% humidity under a 12-hr light:12-hr dark cycle, were washed with water and transferred to normal food for additional aging. After 20 hr, larvae were washed and transferred to a vial supplemented with either 20-hydroxyecdysone (20E, Cayman #16145, dissolved in 95% ethanol, final concentration 0.2 mg/ml) or 95% ethanol (same volume as 20E). The wild-type larvae were directly transferred to vials supplemented with 20E or 95% ethanol upon L3 ecdysis. Once seeded with L3 larvae, the vials were returned to 25°C and 60% humidity under a 12-hr light:12-hr dark cycle.

Quantification of fluorescence intensity

The fluorescence intensity was quantified using Fiji software. The areas of interest (ROI) were marked in the slices including the interested regions and quantified using the ‘plot z-axis profile’ function. The fluorescence intensity in each slice was summed for statistics and plot. The parameters used for confocal imaging of each brain were the same.

Calcium imaging

Flies aged 4–6 days were immobilized on ice for ~30 s. The brain was then dissected out in extra-cellular solution (ECS) that contains (in millimoles): 108 NaCl, 5 KC1, 5 trehalose, 5 sucrose, 5 HEPES (4-(2-Hydroxyethyl)piperazine-1-ethanesulfonic acid), 26 NaHCO3, 1 NaH2PO4, 2 CaCl2, and 1.5 MgCl2 [pH 7.1–7.3 when bubbled with 95% (vol/vol) O2/5% (vol/vol) CO2, ~290 mOsm] and mounted on a poly-D-lysine coated coverslip. The samples were continuously perfused with ECS.

Calcium imaging was performed at 21°C on a customized two-photon microscope equipped with a resonant scanner (Nikon), a piezo objective scanner (Nikon) and a 40× water-immersion objective (Nikon). GCaMP6s was excited at 920 nm.

Analysis of calcium imaging data was done offline with NIS-Elements AR 5.30.01. Briefly, the square region of interest (ROIs), 25 pixels on the pC1 neurons in the center of lateral junction, was chosen for measurements. For each frame, the average fluorescence intensity of pixels within ROIs was calculated blind to genotype. The average fluorescence intensity of ROIs in each frame covering pC1 neurons was summed for statistics and plot.

qRT-PCR

Total RNA was extracted from about 10 flies using TRIzol (Ambion #15596018). The cDNA was synthesized using Prime Script reagent kit (Takara #RR047A). Quantitative PCR was performed on Thermo Piko Real 96 (Thermo) using SYBR Green PCR Master Mix (Takara #RR820A). The mRNA expression level was calculated by the 2−ΔΔCt method and the results were plotted by using tubulin as the reference gene. Primers are listed in Supplementary file 1. All reactions were performed in triplicate. The average of four biological replicates ± SEM was plotted.

Statistical analysis

Statistical analyses were carried out using R software version 3.4.3 or Prism7 (GraphPad software). For the copulation rate, chi-square test is applied. The Mann–Whitney U test was applied for analyzing the significance of two columns. Kruskal–Wallis ANOVA test followed by post hoc Mann–Whitney U test was used to identify significant differences between multiple groups.

Funding Information

This paper was supported by the following grants:

http://dx.doi.org/10.13039/501100021177 Shenzhen Bay Laboratory 21260061 to Chuan Zhou.

http://dx.doi.org/10.13039/501100021177 Shenzhen Bay Laboratory S239201006 to Jing Li.

http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China Y711241133 to Chuan Zhou.

http://dx.doi.org/10.13039/501100002367 Chinese Academy of Sciences Y929731103 to Chuan Zhou.

Acknowledgements

We thank Yi Rao (Peking University), Yufeng Pan (Southeast University), Kaiyu Wang (Lingang Laboratory), Yan Zhu (Chinese Academy of Sciences), Paul Garrity (Brandeis University), Wei Zhang (Tsinghua University), Li Liu (Chinese Academy of Sciences), Suning Liu (South China Normal University), and Xuan Guo (Jinzhou Medical University), the Bloomington Drosophila Stock Center and Tsinghua Fly Center for sharing fly strains; Chenzhu Wang (Chinese Academy of Sciences), Yufeng Pan (Southeast University), Zhiqiang Yan (Shenzhen Bay Laboratory), and Yan Zhu (Chinese Academy of Sciences) for their comments; Xiangdong Li (Chinese Academy of Sciences), Fengming Wu (Chinese Academy of Sciences), Tao Wang (Chinese Academy of Sciences), and Jin Ge (Chinese Academy of Sciences) for assistance with behavioral assays; Yihui Chen and Hongjiang Gao for the maintenance of materials; other members of the Zhou laboratory for helpful discussions.

Additional information

Competing interests

Author contributions

Additional files

Supplementary file 1. The primers used for the verification of PtthDelete null mutant flies and for the real-time quantitative PCR of EcR-A when prothoracicotropic hormone (PTTH) is deleted.

MDAR checklist

Data availability

All study data are included in the main text and supporting information. This study does not involve new code. Fly stocks and reagents used in this study are available from the corresponding author upon reasonable request.

10.7554/eLife.92545.3.sa0
eLife assessment
Muraro Nara Ines Reviewing Editor Instituto de Investigación en Biomedicina de Buenos Aires Argentina

Convincing
Incomplete
Valuable
The aim of this valuable study is to uncover developmental roles of the neuropeptide prothoracicotropic hormone (PTTH) and ecdysone, which later regulate female receptivity of Drosophila melanogaster. The work combines spatially and temporally restricted genetic manipulation with behavior quantification to explore these molecular pathways and the neuronal substrates participating in the control of female sexual receptivity. At present, the implication of both signaling pathways in this process is convincing but the strength of the evidence is incomplete to support the main claim that PTTH pathway controls female sexual receptivity through the function of ecdysone in pC1 neurons.

10.7554/eLife.92545.3.sa1
Reviewer #1 (Public Review):
Reviewer
Summary

This article delves into the role of Ecdysone in regulating female sexual receptivity in Drosophila. The researchers discovered that PTTH, a positive regulator of Ecdysone production, hurts the receptivity of adult virgin females. Specifically, the researchers found that losing larval PTTH before metamorphosis significantly increases female receptivity immediately after adult eclosion. In addition, Ecdysone, through its receptor EcR-A, is necessary during metamorphic neurodevelopment for the proper development of P1 neurons, as its silencing leads to morphological changes associated with reduced adult female receptivity. Furthermore, Torso enhances receptivity in the adult stage. The molecular mechanisms linking each molecule to female receptivity have yet to be fully understood; therefore, the involvement of the juvenile-to-adult hormonal pathway (PTTH/Torso/ecdysone) in female receptivity is not proven.

Strengths

(1) Robust Methodology and Experimental Design: The study employs a comprehensive and well-structured experimental approach, combining genetic manipulations, behavioral assays, and molecular analyses. This multi-faceted methodology allows for a thorough investigation of the role of PTTH and Ecdysone in regulating female sexual receptivity in Drosophila. The use of specific gene knockouts, RNA interference, and overexpression techniques provides strong evidence supporting the findings.

(2) Clear and Substantial Findings: The authors provide compelling data showing that PTTH negatively regulates female receptivity during the larval stage, which is rescued by Ecdysone feeding. Instead, metamorphic Ecdysone has a positive role during neurodevelopment. The experiments demonstrate this dual and temporally distinct role of PTTH/Ecdysone, shedding light on a complex hormonal regulation mechanism.

(3) Clarification of Experimental Details: In response to the initial review, the authors have clarified important experimental details, such as the precise timing of genetic manipulations and the specific developmental stages examined. This clarification enhances the reproducibility and understanding of the study.

Weaknesses

(1) Unresolved Contradictions and Complexity in Results: Despite the detailed responses, the paper still presents complex and somewhat contradictory findings regarding the roles of PTTH, Torso, and Ecdysone. The observed increase in EcR-A expression in PTTH mutants and the nuanced explanation regarding the feedforward relationship, while insightful, do not fully resolve the initial confusion about the differing effects of PTTH and Ecdysone manipulations on female receptivity. This required more exploration.

(2) Insufficient Exploration of Mechanistic Pathways: The potential mechanisms underlying the role of PTTH/Torso-Ecdysone across different developmental stages remain underexplored. While the authors suggest a feedforward relationship and possible interaction with other neurons, these hypotheses are not thoroughly tested or elaborated upon, leaving gaps in the mechanistic understanding.

(3) Limited Scope of Validation Experiments: While the authors addressed some reviewer concerns about validation, the scope remains somewhat limited. The lack of existing PTTH mutants and the challenges in manipulating PTTH expression without affecting receptivity suggests that further work is needed to validate these pathways robustly. The inability to fully replicate the PTTHdelete phenotype through other means leaves some questions unanswered.

(4). Complexity in Interpretation of dsx-Positive Neurons: The relevance of dsx-positive neurons in the context of PTTH's effects on female receptivity remains ambiguous. Although the authors provide some context, the biological significance of these observations is not fully clarified.

Conclusion

The manuscript presents a well-conceived study with significant findings that advance the understanding of hormonal regulation of female receptivity in Drosophila. However, complexities in the data and unresolved mechanistic questions suggest that further work is needed to clarify the exact pathways and interactions involved. The authors' responses to feedback have strengthened the paper, but additional experiments and more thorough mechanistic exploration would enhance the robustness and clarity of the conclusions.

10.7554/eLife.92545.3.sa2
Reviewer #2 (Public Review):
Reviewer
Summary:

The authors tried to identify novel adult functions of the classical Drosophila juvenile-adult transition axis (i.e. ptth-ecdysone). Surprisingly, larval ptth-expressing neurons expressed the sex-specific doublesex gene, thus belonging to the sexual dimorphic circuit. Lack of ptth during late larval development caused enhanced female sexual receptivity, effect rescued by supplying ecdysone in the food. Among many other cellular players, pC1 neurons control receptivity by encoding the mating status of females. Interestingly, during metamorphosis a subtype of pC1 neurons required Ecdysone Receptor A in order to regulate such female receptivity. A transcriptomic analysis using pC1-specific Ecdyone signaling down-regulation gives some hints of possible downstream mechanisms.

Strengths:

The manuscript showed solid genetic evidence that lack of ptth during development caused enhanced copulation rate in female flies, which includes ptth mutant rescue experiments by over-expressing ptth as well as by adding ecdysone-supplemented food. They also present elegant data dissecting the temporal requirements of ptth-expressing neurons by shifting animals from non-permissive to permissive temperatures, in order to inactivate neuronal function (although not exclusively ptth function). They showed that EcR-A is up-regulated in ptth mutant background. By combining different drivers together with EcR-A RNAi and torso RNAi lines authors also identified the Ecdysone receptor and torso requirements of a particular subtype of pC1 neurons during metamorphosis. Convincing live calcium imaging showed no apparent effect of EcR-A in neural activity, although some effect on morphology is uncovered. Finally, bulk RNAseq shows differential gene expression after EcR-A down-regulation.

Weaknesses:

The paper has three main weaknesses. The first one refers to temporal requirements of ptth and ecdysone signaling. Whereas ptth is necessary during larval development, ecdysone effect appears during pupal development. ptth induces ecdysone synthesis during larval development but there is no published evidence about a similar role for ptth during pupal stages. The down-regulation of EcR-A by RNAi requires at least 8 h to be complete, whereas the activation of ptth neurons in larva stages is immediate. Furthermore, larval and pupal ecdysone functions are different (triggering metamorphosis vs tissue remodeling). The second caveat is the fact that ptth and ecdysone/torso loss-of-function experiments render opposite effects (enhancing and decreasing copulation rates, respectively). The most plausible explanation is that both functions are independent of each other, also suggested by differential temporal requirements. Finally, in order to identify the effect in the transcriptional response of down-regulating EcR-A in a very small population of neurons, a scRNAseq study should have been performed instead of bulk RNAseq.

In summary, despite the authors providing convincing evidence that ptth and ecdysone signaling pathways are involved in female receptivity, the main claim that ptth regulates this process through ecdysone is not supported by results. More likely, they'd rather be independent processes.

10.7554/eLife.92545.3.sa3
Reviewer #3 (Public Review):
Reviewer
Summary:

This manuscript shows that mutations that disable the gene encoding the PTTH gene cause an increase in female receptivity (they mate more quickly), a phenotype that can be reversed by feeding these mutants the molting hormone, 20-hydoxyecdysone (20E). The use of an inducible system reveals that inhibition or activation of PTTH neurons during the larval stages increases and decreases female receptivity, respectively, suggesting that PTTH is required during the larval stages to affect the receptivity of the (adult) female fly. Showing that these neurons express the sex-determining gene dsx leads the authors to show that interfering with 20E actions in pC1 neurons, which are dsx-positive neurons known to regulate female receptivity, reduces female receptivity and increases the arborization pattern of pC1 neurons. The work concludes by showing that targeted knockdown of EcRA in pC1 neurons causes 527 genes to be differentially expressed in the brains of female flies, of which 123 passed a false discovery rate cutoff of 0.01; interestingly, the gene showing the greatest down-regulation was the gene encoding dopamine beta-monooxygenase.

This reviewer appreciates the effort that was done to revise the manuscript and address the various comments made by the reviewers. Nevertheless, I feel that the main concerns remain. These are not necessarily due to an unwillingness on the part of the authors to address them, but rather to difficulties that are inherent to trying to assign specific roles to EcR and pC1 neurons at a time when major changes are occurring (or are about to occur) in the nervous system, and do so using tools that are currently not sharp or specific enough. Many of the conclusions are supported by the results and those that may have alternative interpretations can remain more speculative until better tools become available. It is, nevertheless, an interesting and provocative piece of work.

Strengths

This is an interesting piece of work, which may shed light on the basis for the observation noted previously that flies lacking PTTH neurons show reproductive defects ("... females show reduced fecundity"; McBrayer, 2007; DOI 10.1016/j.devcel.2007.11.003).

Weaknesses:

There are some results whose interpretation seem ambiguous and findings whose causal relationship is implied but not demonstrated.

(1) At some level, the findings reported here are not at all surprising. Since 20E regulates the profound changes that occur in the central nervous system (CNS) during metamorphosis, it is not surprising that PTTH would play a role in this process. Although animals lacking PTTH (rather paradoxically) live to adulthood, they do show greatly extended larval instars and a corresponding great delay in the 20E rise that signals the start of metamorphosis. For this reason, concluding that PTTH plays a SPECIFIC role in regulating female receptivity seems a little misleading, since the metamorphic remodeling of the entire CNS is likely altered in PTTH mutants. Since these mutants produce overall normal (albeit larger--due to their prolonged larval stages) adults, these alterations are likely to be subtle. Courtship has been reported as one defect expressed by animals lacking PTTH neurons, but this behavior may stand out because reduced fertility and increased male-male courtship (McBrayer, 2007) would be noticeable defects to researchers handling these flies. By contrast, detecting defects in other behaviors (e.g., optomotor responses, learning and memory, sleep, etc) would require closer examination. For this reason I would ask the authors to temper their statement that PTTH is SPECIFICALLY involved in regulating female receptivity.

(2) The link between PTTH and the role of pC1 neurons in regulating female receptivity is not clear. Again, since 20E controls the metamorphic changes that occur in the CNS, it is not surprising that 20E would regulate the arborization of pC1 neurons. And since these neurons have been implicated in female receptivity, it would therefore be expected that altering 20E signaling in pC1 neurons would affect this phenotype. However, this does not mean that the defects in female receptivity expressed by PTTH mutants are due to defects in pC1 arborization. For this the authors would at least have to show that PTTH mutants show the changes in pC1 arborization shown in Fig. 6. And even then the most that could be said is that the changes observed in these neurons "may contribute" to the observed behavioral changes. Indeed, the changes observed in female receptivity may be caused by PTTH/20E actions on different neurons.

(3) Some of the results need commenting on, or refining, or revising:

(a) For some assays PTTH behaves sometimes like a recessive gene and at other times like a semi-dominant, and yet at others like a dominant gene. For instance, in Fig. 1D-G, PTTH[-]/+ flies behave like wildtype (D), express an intermediate phenotype (E-F), or behave like the mutant (G). This may all be correct but merits some comment.

(b) Some of the conclusions are overstated. (i) Although Fig. 2E-G does show that silencing the PTTH neurons during the larval stages affects copulation rate (E) the strength of the conclusion is tempered by the behavior of one of the controls (tub-GAL80[ts]/+, UAS-Kir2.1/+) in panels F and G, where it behaves essentially the same as the experimental group (and quite differently from the PTTH-GAL4/+ control; blue line).(Incidentally, the corresponding copulation latency should also be shown for these data.). (ii) For Fig. 5I-K, the conclusion stated is that "Knock-down of EcR-A during pupal stage significantly decreased the copulation rate." Although strictly correct, the problem is that panel J is the only one for which the behavior of the control lacking the RNAi is not the same as that of the experimental group. Thus, it could just be that when the experiment was done at the pupal stage is the only situation when the controls were both different from the experimental. Again, the results shown in J are strictly speaking correct but the statement is too definitive given the behavior of one of the controls in panels I and K. Note also that panel F shows that the UAS-RNAi control causes a massive decrease in female fertility, yet no mention is made of this fact.

10.7554/eLife.92545.3.sa4
Author response
Li Jing Author Shenzhen Bay Laboratory Shenzhen China

Ning Chao Author Institute of Zoology, Chinese Academy of Sciences Beijing China

Liu Yaohua Author Institute of Zoology Beijing China

Deng Bowen Author https://ror.org/029819q61 Chinese Institute for Brain Research, Beijing Beijing China

Wang Bingcai Author Institute of Zoology Beijing China

Shi Kai Author Institute of Zoology Beijing China

Wang Rencong Author Institute of Zoology Beijing China

Fang Ruixin Author Shenzhen Bay Laboratory Shenzhen China

Zhou Chuan Author Shenzhen Bay Laboratory Shenzhen China

The following is the authors’ response to the original reviews.

Reviewer #1 (Public Review):

Summary: This article explores the role of Ecdysone in regulating female sexual receptivity in Drosophila. The researchers found that PTTH, throughout its role as a positive regulator of ecdysone production, negatively affects the receptivity of adult virgin females. Indeed, loss of larval PTTH before metamorphosis significantly increases female receptivity right after adult eclosion and also later. However, during metamorphic neurodevelopment, Ecdysone, primarily through its receptor EcR-A, is required to properly develop the P1 neurons since its silencing led to morphological changes associated with a reduction in adult female receptivity. Nonetheless, the result shown in this manuscript sheds light on how Ecdysone plays a dual role in female adult receptivity, inhibiting it during larval development and enhancing it during metamorphic development. Unfortunately, this dual and opposite effect in two temporally different developmental stages has not been highlighted or explained.

Strengths: This paper exhibits multiple strengths in its approach, employing a well-structured experimental methodology that combines genetic manipulations, behavioral assays, and molecular analysis to explore the impact of Ecdysone on regulating virgin female receptivity in Drosophila. The study provides clear and substantial findings, highlighting that removing PTTH, a positive Ecdysone regulator, increases virgin female receptivity. Additionally, the research expands into the temporal necessity of PTTH and Ecdysone function during development.

Weaknesses:

There are two important caveats with the data that are reflecting a weakness:

(1) Contradictory Effects of Ecdysone and PTTH: One notable weakness in the data is the contrasting effects observed between Ecdysone and its positive regulator PTTH. PTTH loss of function increases female receptivity, while ecdysone loss of function reduces it. Given that PTTH positively regulates Ecdysone, one would expect that the loss of function of both would result in a similar phenotype or at least a consistent directional change.

A1. As newly formed prepupae, the ptth-Gal4>UAS-Grim flies display similar changes in gene expression to the genetic control flies to response to a high-titer ecdysone pulse. These include the repression of EcR (McBrayer et al.,2007). We tested whether there is a similar feedforward relationship between PTTH and EcR-A. We quantified the EcR-A mRNA level of PTTH -/- and PTTH -/+ in the whole body of newly formed prepupae. Indeed, PTTH -/- induced increased EcR-A expression in the whole body of newly formed prepupae compared with PTTH -/+ flies. Because of the function of EcR-A in gene expression, this suggests that PTTH -/- disturbs the regulation of a serious of gene expressions during metamorphosis. However, it is not sure that the EcR-A expression in pC1 neurons is increased compared with genetic controls when PTTH is deleted. Furthermore, PTTH -/- must affect development of other neurons rather than only pC1 neurons. So, the feedforward relationship between PTTH and EcRA at the start of prepupal stage is one possible cause for the contradictory effects of PTTH -/- and EcR-A RNAi in pC1 neurons.

(2) Discordant Temporal Requirements for Ecdysone and PTTH: Another weakness lies in the different temporal requirements for Ecdysone and PTTH. The data from the manuscript suggest that PTTH is necessary during the larval stage, as shown in Figure 2 E-G, while Ecdysone is required during the pupal stage, as indicated in Figure 5 I-K. Ecdysone is a crucial developmental hormone with precisely regulated expression throughout development, exhibiting several peaks during both larval and pupal stages. PTTH is known to regulate Ecdysone during the larval stage, specifically by stimulating the kinetics of Ecdysone peaking at the wandering stage. However, it remains unclear whether pupal PTTH, expressed at higher levels during metamorphosis, can stimulate Ecdysone production during the pupal stage. Additionally, given the transient nature of the Ecdysone peak produced at wandering time, which disappears shortly before the end of the prepupal stage, it is challenging to infer that larval PTTH will regulate Ecdysone production during the pupal stage based on the current state of knowledge in the neuroendocrine field.

Considering these two caveats, the results suggest that the authors are witnessing distinct temporal and directional effects of Ecdysone on virgin female receptivity.

A2. First of all, it is necessary to clarify the detailed time for the manipulation of Ptth gene and PTTH neurons. In Figure 3, activation of PTTH neurons during the stage 2 inhibited the female receptivity. The “stage 2” is from six hours before the 3rd-instar larvae to the end of the wandering larvae (the start of prepupae). In Figure 5, The “pupal stage” is from the prepupal stage to the end of pupal stage. This “pupal stage” includes the forming of prepupae when the ecdysone peak is not disappeared. The time of manipulating Ptth and EcR-A in pC1 neurons are continuous. In addition, the pC1-Gal4 expressing neurons appear also at the start of prepupal stage. So, it is possible that PTTH regulates female receptivity through the function of EcR-A in pC1 neurons.

Reviewer #1 (Recommendations For The Authors):

In light of the significant caveat previously discussed, I will just make a few general suggestions:

(1) The paper primarily focuses on robust phenotypes, particularly in PTTH mutants, with a well-detailed execution of several experiments, resulting in thorough and robust outcomes. However, due to the caveat previously presented (opposite effect in larva and pupa), consider splitting the paper into two parts: Figures 1 to 4 deal with the negative effect of PTTH-Ecdysone on early virgin female receptivity, while Figures 5 to 7 focus on the positive metamorphic effect of Ecdysone in P1 metamorphic neurodevelopment. However, in this scenario, the mechanism by which PTTH loss of function increases female receptivity should be addressed.

A3. It is a good suggestion that splitting the paper into two parts associated with the PTTH function and EcR function in pC1 neurons separately, if it is impossible that PTTH functions in female receptivity through the function of EcR-A in pC1 neurons. However, because of the feedforward relationship between PTTH and EcR-A in the newly formed prepupae, and the time of manipulating Ptth and EcR-A in pC1 neurons is continuous, it is possible that these two functions are not independent of each other. So, we still keep the initial edition.

(2) Validate the PTTH mutants by examining homozygous mutant phenotypes and the dose-dependent heterozygous mutant phenotype using existing PTTH mutants. This could also be achieved using RNAi techniques.

A4. We did not get other existing PTTH mutants. We instead decreased the PTTH expression in PTTH neurons and dsx+ neurons, but did not detect the similar phenotype to that of PTTH -/-. Similarly, the overexpression through PTTH-Gal4>UAS-PTTH is also not sufficient to change female receptivity. It is possible that both decreasing and increasing PTTH expression are not sufficient to change female receptivity.

(3) Clarify if elav-Gal4 is not expressed in PTTH neurons and discuss how the rescue mechanisms work (hormonal, paracrine, etc.) in the text.

A5. We tested the overlap of elav-Gal4>GFP signal and the stained PTTH with PTTH antibody. We did not detect the overlap. It suggests that elav-Gal4 is not expressed in PTTH neurons. However, we detected the expression of PTTH (PTTH antibody) in CNS when overexpressed PTTH using elav-Gal4>UASPTTH based on PTTH -/-. Furthermore, this rescued the phenotype of PTTH -/- in female receptivity. Insect PTTH isoforms have similar probable signal peptide for secreting. Indeed, except for the projection of axons to PG gland, PTTH also carries endocrine function acting on its receptor Torso in light sensors to regulate light avoidance of larvae. The overexpressed PTTH in other neurons through elav-Gal4>UASPTTH may act on the PG gland through endocrine function and then induce the ecdysone synthesis and release. So that, although elav-Gal4 is not expressed in PTTH neurons, the ecdysone synthesis triggered by PTTH from the hemolymph may result in the rescued PTTH -/- phenotype in female receptivity.

(4) Consider renaming the new PTTH mutant to avoid confusion with the existing PTTHDelta allele.

A6. We have renamed our new PTTH mutant as PtthDelete.

(5) Include the age of virgin females in each figure legend, especially for Figures 2 to 7, to aid in interpretation. This is essential information since wild-type early virgins -day 1- show no receptivity. In contrast, they reach a typical 80% receptivity later, and the mechanism regulating the first face might differ from the one occurring later.

A7. We have included the age of virgin females in each figure legend.

(6) Explain the relevance of observing that PTTH adult neurons are dsx-positive, as it's unclear why this observation is significant, considering that these neurons are not responsible for the observed receptivity effect in virgin females. Alternatively, address this in the context of the third instar larva or clarify its relevance.

A8. We decreased the DsxF expression in PTTH neurons and did not detect significantly changed female receptivity. Almost all neurons regulating female receptivity, including pC1 neurons, express DsxF. We suppose that PTTH neurons have some relationship with other DsxF-positive neurons which regulate female receptivity. Indeed, we detected the overlap of dsx-LexA>LexAop-RFP and torso-Gal4>UAS-GFP during larval stage. Furthermore, decreasing Torso expression in pC1 neurons significantly inhibit female receptivity.

These results suggest that, PTTH regulates female receptivity not only through ecdysone, but also may through regulating other neurons especially DsxF-positive neurons associated with female receptivity directly.

Reviewer #2 (Public Review):

Summary: The authors tried to identify novel adult functions of the classical Drosophila juvenile-adult transition axis (i.e. ptth-ecdysone). Surprisingly, larval ptth-expressing neurons expressed the sex-specific doublesex gene, thus belonging to the sexual dimorphic circuit. Lack of ptth during late larval development caused enhanced female sexual receptivity, an effect rescued by supplying ecdysone in the food. Among many other cellular players, pC1 neurons control receptivity by encoding the mating status of females. Interestingly, during metamorphosis, a subtype of pC1 neurons required Ecdysone Receptor A in order to regulate such female receptivity. A transcriptomic analysis using pC1-specific Ecdyone signaling down-regulation gives some hints of possible downstream mechanisms.

Strengths: the manuscript showed solid genetic evidence that lack of ptth during development caused enhanced copulation rate in female flies, which includes ptth mutant rescue experiments by overexpressing ptth as well as by adding ecdysone-supplemented food. They also present elegant data dissecting the temporal requirements of ptth-expressing neurons by shifting animals from non-permissive to permissive temperatures, in order to inactivate neuronal function (although not exclusively ptth function). By combining different drivers together with a EcR-A RNAi line authors also identified the Ecdysone receptor requirements of a particular subtype of pC1 neurons during metamorphosis. Convincing live calcium imaging showed no apparent effect of EcR-A in neural activity, although some effect on morphology is uncovered. Finally, bulk RNAseq shows differential gene expression after EcR-A down-regulation.

Weaknesses: the paper has three main weaknesses. The first one refers to temporal requirements of ptth and ecdysone signaling. Whereas ptth is necessary during larval development, the ecdysone effect appears during pupal development. ptth induces ecdysone synthesis during larval development but there is no published evidence about a similar role for ptth during pupal stages. Furthermore, larval and pupal ecdysone functions are different (triggering metamorphosis vs tissue remodeling). The second caveat is the fact that ptth and ecdysone loss-of-function experiments render opposite effects (enhancing and decreasing copulation rates, respectively). The most plausible explanation is that both functions are independent of each other, also suggested by differential temporal requirements. Finally, in order to identify the effect in the transcriptional response of down-regulating EcR-A in a very small population of neurons, a scRNAseq study should have been performed instead of bulk RNAseq.

In summary, despite the authors providing convincing evidence that ptth and ecdysone signaling pathways are involved in female receptivity, the main claim that ptth regulates this process through ecdysone is not supported by results. More likely, they'd rather be independent processes.

B1. Clarification: in Figure 3, activation of PTTH neurons during the stage 2 inhibited the female receptivity. The “stage 2” is from six hours before the 3rd-instar larvae to the end of the wandering larvae (the start of prepupae). In Figure 5, The “pupal stage” is from the start of prepupal stage to the end of pupal stage. This “pupal stage” includes the forming of prepupae when the ecdysone peak is not disappeared. The time of manipulating Ptth and EcR-A in pC1 neurons are continuous. In addition, the pC1-Gal4 expressing neurons appear also at the start of prepupal stage. So, it is possible that PTTH regulates female receptivity through the function of EcR-A in pC1 neurons.

B2. During the forming of prepupae, the ptth-Gal4>UAS-Grim flies display similar changes in gene expression to the genetic control flies to response to a high-titer ecdysone pulse. These include the repression of EcR (McBrayer et al.,2007). We tested whether there is a similar feedforward relationship between PTTH and EcR-A. We quantified the EcR-A mRNA level of PTTH -/- and PTTH -/+ in the whole body of newly formed prepupae. Indeed, PTTH -/- induced increased EcR-A compared with PTTH -/+ flies. Because of the function of EcR-A in gene expression, this suggests that PTTH -/- disturbs the regulation of a serious of gene expressions during metamorphosis. However, it is not sure that the EcR-A expression in pC1 neurons is increased compared with genetic controls when PTTH is deleted. Furthermore, PTTH -/- must affect the development of other neurons rather than only pC1 neurons. So, the feedforward relationship between PTTH and EcR-A at the start of prepupal stage is one possible cause for the contradictory effects of PTTH -/- and EcR-A RNAi in pC1 neurons.

B3. We will do single cell sequencing in pC1 neurons for the exploration of detailed molecular mechanism of female receptivity in the future.

Reviewer #2 (Recommendations For The Authors):

Additional experiments and suggestions:

- torso LOF in the PG to determine whether or not the ecdysone peak regulated by ptth (there is a 1-day delay in pupation) is responsible for the ptth effect in L3. In the same line, what happens if torso is downregulated in the pC1 neurons? Is there any effect on copulation rates?

B4. Because the loss of phm-Gal4, we could not test female receptivity when decreasing the expression of Torso in PG gland. However, decreasing Torso expression in pC1 neurons significantly inhibit female receptivity. This suggests that PTTH regulates female receptivity not only through ecdysone but also through regulating dsx+ pC1 neurons in female receptivity directly.

- What is the effect of down-regulating ptth in the dsx+ neurons? No ptth RNAi experiments are shown in the paper.

B5. We decreased PTTH expression in dsx+ neurons but did not detect the change in female receptivity. We also decreased PTTH expression in PTTH neurons using PTTH-Gal4, also did not detect the change in female receptivity. Similarly, the overexpression through PTTH-Gal4>UAS-PTTH is also not sufficient to change female receptivity. It is possible that both decreasing and increasing PTTH expression are not sufficient to change female receptivity.

- Why are most copulation rate experiments performed between 4-6 days after eclosion? ptth LOF effect only lasts until day 3 after eclosion (but very weak-fig 1). Again, this supports the idea that ptth and ecdysone effects are unrelated.

B6. Most behavioral experiments were performed between 4-6 days after eclosion as most other studies in flies, because the female receptivity reaches the peak at that time. Ptth LOF made female receptivity enhanced from the first day after eclosion. This seems like the precocious puberty. Wild type females reach high receptivity at 2 days after eclosion (about 75% within 10 min). We suppose that Ptth LOF effect only lasts until day 3 after eclosion because too high level of receptivity of control flies to exceed.

It is not sure whether the effect of PTTH-/- in female receptivity disappears after the 3rd day of adult flies. So that it is not sure whether PTTH and EcR-A effects in pC1 neurons are unrelated.

- The fact that pC1d neuronal morphology changes (and not pC1b) does not explain the effect of EcR-A LOF. Despite it is highlighted in the discussion, data do not support the hypothesis. How do these pC1 neurons look like in a ptth mutant animal regarding Calcium imaging and/or morphology?

B7. We detected the pattern of pC1 neurons when PTTH is deleted. Consistent with the feedforward relationship between PTTH and expression of EcR-A in newly formed prepupae, PTTH deletion induced less established pC1-d neurons contrary to that induced by EcR-A reduction in pC1 neurons. However, it is not sure that the expression of EcR-A in pC1 neurons is increased when PTTH is deleted. Furthermore, on the one hand, manipulation of PTTH has general effect on the neurodevelopment not only regulating pC1 neurons. On the other hand, the detailed pattern of pC1-b neurons which is the key subtype regulating female receptivity when EcR-A is decreased in pC1 neurons or PTTH is deleted could not be seen clearly. So, the abnormal development of pC1-b neurons, if this is true, is just one of the possible reasons for the effect of PTTH deletion on female receptivity.

- The discussion is incomplete, especially the link between ptth and ecdysone; discuss why the phenotype is the opposite (ptth as a negative regulator of ecdysone in the pupa, for instance); the difference in size due to ptth LOF might be related to differential copulation rates.

B8. We have revised the discussion. We could not exclude the effect of size of body on female receptivity when PTTH was deleted or PTTH neurons were manipulated, although there was not enough evidence for the effect of body size on female receptivity.

- scheme of pC neurons may help.

B9. We have tried to label pC1 neurons with GFP and sort pC1 neurons through flow cytometry sorting, but could not success. This may because the number of pC1 neurons is too low in one brain. We will try single-cell sequencing in the future.

- Immunofluorescence images are too small.

B10. We have resized the small images.

Reviewer #3 (Public Review):

Summary:

This manuscript shows that mutations that disable the gene encoding the PTTH gene cause an increase in female receptivity (they mate more quickly), a phenotype that can be reversed by feeding these mutants the molting hormone, 20-hydoxyecdysone (20E). The use of an inducible system reveals that inhibition or activation of PTTH neurons during the larval stages increases and decreases female receptivity, respectively, suggesting that PTTH is required during the larval stages to affect the receptivity of the (adult) female fly. Showing that these neurons express the sex-determining gene dsx leads the authors to show that interfering with 20E actions in pC1 neurons, which are dsx-positive neurons known to regulate female receptivity, reduces female receptivity and increases the arborization pattern of pC1 neurons. The work concludes by showing that targeted knockdown of EcRA in pC1 neurons causes 527 genes to be differentially expressed in the brains of female flies, of which 123 passed a false discovery rate cutoff of 0.01; interestingly, the gene showing the greatest down-regulation was the gene encoding dopamine beta-monooxygenase.

Strengths

This is an interesting piece of work, which may shed light on the basis for the observation noted previously that flies lacking PTTH neurons show reproductive defects ("... females show reduced fecundity"; McBrayer, 2007; DOI 10.1016/j.devcel.2007.11.003).

Weaknesses:

There are some results whose interpretation seem ambiguous and findings whose causal relationship is implied but not demonstrated.

(1) At some level, the findings reported here are not at all surprising. Since 20E regulates the profound changes that occur in the central nervous system (CNS) during metamorphosis, it is not surprising that PTTH would play a role in this process. Although animals lacking PTTH (rather paradoxically) live to adulthood, they do show greatly extended larval instars and a corresponding great delay in the 20E rise that signals the start of metamorphosis. For this reason, concluding that PTTH plays a SPECIFIC role in regulating female receptivity seems a little misleading, since the metamorphic remodeling of the entire CNS is likely altered in PTTH mutants. Since these mutants produce overall normal (albeit larger--due to their prolonged larval stages) adults, these alterations are likely to be subtle. Courtship has been reported as one defect expressed by animals lacking PTTH neurons, but this behavior may stand out because reduced fertility and increased male-male courtship (McBrayer, 2007) would be noticeable defects to researchers handling these flies. By contrast, detecting defects in other behaviors (e.g., optomotor responses, learning and memory, sleep, etc) would require closer examination. For this reason, I would ask the authors to temper their statement that PTTH is SPECIFICALLY involved in regulating female receptivity.

C1. We agree with that, it is not surprising that PTTH regulates the profound changes that occur in the CNS during metamorphosis through ecdysone. Also, the behavioral changes induced by PTTH mutants include not only female receptivity. We will temper the statement about the function of PTTH on female receptivity.

We think there are two new points in our text although more evidences are needed in the future. On the one hand, PTTH deletion and the reduction of EcR-A in pC1 neurons during metamorphosis have opposite effects on female receptivity. On the other hand, development of pC1-b neurons regulated by EcR-A during metamorphosis is important for female receptivity.

(2) The link between PTTH and the role of pC1 neurons in regulating female receptivity is not clear. Again, since 20E controls the metamorphic changes that occur in the CNS, it is not surprising that 20E would regulate the arborization of pC1 neurons. And since these neurons have been implicated in female receptivity, it would therefore be expected that altering 20E signaling in pC1 neurons would affect this phenotype. However, this does not mean that the defects in female receptivity expressed by PTTH mutants are due to defects in pC1 arborization. For this, the authors would at least have to show that PTTH mutants show the changes in pC1 arborization shown in Fig. 6. And even then the most that could be said is that the changes observed in these neurons "may contribute" to the observed behavioral changes. Indeed, the changes observed in female receptivity may be caused by PTTH/20E actions on different neurons.

C2. As newly formed prepupae, the ptth-Gal4>UAS-Grim flies display similar changes in gene expression to the genetic control flies to response to a high-titer ecdysone pulse. These include the repression of EcR (McBrayer et al., 2007). We tested whether there is a similar feedforward relationship between PTTH and EcR-A. We quantified the EcR-A mRNA level of PTTH -/- and PTTH -/+ in the whole body of newly formed prepupae. Indeed, PTTH -/- induced upregulated EcR-A in the whole body of newly formed prepupae compared with PTTH -/+ flies. We also detected the pattern of pC1 neurons when PTTH is deleted. Consistent with the feedforward relationship between PTTH and expression of EcR-A in newly formed prepupae, PTTH deletion induced less established pC1-d neurons contrary to that induced by EcR-A reduction in pC1 neurons.

However, it is not sure that the expression of EcR-A in pC1 neurons increases compared with genetic controls when PTTH is deleted. Furthermore, on the one hand, manipulation of PTTH has general effect on the neurodevelopment. On the other hand, the detailed pattern of pC1-b neurons which is the key subtype regulating female receptivity through EcR-A function in pC1 neurons could not be seen clearly. So, the abnormal development of pC1b neurons, if this is true, is just one of the possible reasons for the effect of PTTH deletion on female receptivity.

(3) Some of the results need commenting on, or refining, or revising: a- For some assays PTTH behaves sometimes like a recessive gene and at other times like a semidominant, and yet at others like a dominant gene. For instance, in Fig. 1D-G, PTTH[-]/+ flies behave like wildtype (D), express an intermediate phenotype (E-F), or behave like the mutant (G). This may all be correct but merits some comment.

C3. Female receptivity increases with the increase of age after eclosion, not only for wild type flies but also PTTH mutants. At the first day after eclosion (Figure 1D), maybe the loss of PTTH in PTTH[-]/+ flies is not enough for sexual precocity as in PTTH -/-. At the second day after eclosion and after (Figure 1E-G), the loss of PTTH in PTTH[-]/+ flies is sufficient to enhance female receptivity compared with wild type flies. However, After the 2nd day of adult, female receptivity of all genotype flies increases sharply. At the 3rd day of adult and after, female receptivity of PTTH -/- reaches the peak and the receptivity of PTTH[-]/+ reaches more nearly to PTTH -/- when flies get older.

b - Some of the conclusions are overstated. (i) Although Fig. 2E-G does show that silencing the PTTH neurons during the larval stages affects copulation rate (E) the strength of the conclusion is tempered by the behavior of one of the controls (tub-Gal80[ts]/+, UAS-Kir2.1/+) in panels F and G, where it behaves essentially the same as the experimental group (and quite differently from the PTTH-Gal4/+ control; blue line).(Incidentally, the corresponding copulation latency should also be shown for these data.). (ii) For Fig. 5I-K, the conclusion stated is that "Knock-down of EcR-A during pupal stage significantly decreased the copulation rate." Although strictly correct, the problem is that panel J is the only one for which the behavior of the control lacking the RNAi is not the same as that of the experimental group. Thus, it could just be that when the experiment was done at the pupal stage is the only situation when the controls were both different from the experimental. Again, the results shown in J are strictly speaking correct but the statement is too definitive given the behavior of one of the controls in panels I and K. Note also that panel F shows that the UAS-RNAi control causes a massive decrease in female fertility, yet no mention is made of this fact.

C4. (i) For all figures in the text, only when all the control groups were significant different from assay group, we say the assay group is significantly different. In Figure 2E-G, the control groups were both different from the assay group only at the larval stage. The difference between two control groups may due to the genetic background. We have described more detailed statistical analysis in the legend. In addition, the corresponding copulation latency has been shown. (ii) For Figure 5, we have revised the conclusion in text as “when the experiment was done at the pupal stage is the only situation when the controls were both different from the experimental.” Besides, the UAS-RNAi control causes a massive decrease in female fertility in panel F has been mentioned.

Reviewer #3 (Recommendations For The Authors):

(1) I am not sure that PTTH neurons should be referred to as "PG neurons". I am aware that this name has been used before but the PG is a gland that does not have neurons; it is not even innervated in all insects.

C5. Agree. “PG neurons” has been changed into “PTTH neurons”.

(2) Fig. 1A warrants some explanation. One can easily imagine what it shows but a description is warranted.

C6. Explanation has been added.

(3) When more than one genotype is compared it would be more useful to use letters to mark the genotypes that are not statistically different from each other rather than simply using asterisks. For instance, in the case of copulation latencies shown in Fig. 1E-G, which result does the comparison refer to? For example, since the comparisons are the result of ANOVAs, which comparison receives "*" in Fig. 1F? Is it PTTH[-]/+ vs PTTH[-]/PTTH[-] or vs. +/+?

C7. Referred genotypes and conditions were marked in all figure legends.

(4) Fig. 1H: Why is copulation latency of PTTH[-]/PTTH[-]+elav-GAL4 significantly different from that of PTTH[-]/PTTH[-]? This merits a comment. Also, why was elav-GAL4 used to effect the rescue and not the PTTH-GAL4 driver?

C8. We could not explain this phenomenon. This may due to the different genetic backgrounds between controls. We have mentioned this in figure legend.

(5) Fig. 2C, the genotype is written in a confusing order, GAL4+UAS should go together as should LexA+LexAop.

C9. We have revised for avoiding confusion.

(6) In Fig. 2, is "larval stage" the same period that is shown in Fig. 3A? Please clarify.

C10. We have clarified this in text and legends.

(7) Fig. 6. The fact that pC1 neurons can be labeled using the pC1-ss2-Gal4 at the start of the pupal stage does not mean that this is when these neurons appear (are born), only when they start expressing this GAL4. Other types of evidence would be needed to make a statement about the birthdate of these neurons.

C11. We have revised the description for the appearance of pC1-ss2-Gal4>GFP. The detailed birth time of pC1 neurons will be tested in future.

(8) The results shown in Fig. 7 are not pursued further and thus appear like a prelude to the next manuscript. Unless the authors have more to add regarding the role of one of the differentially expressed genes (e.g., dopamine beta-monooxygenase, which they single out) I would suggest leaving this result out.

C12. We have leave this out.

(9) Female flies lacking PTTH neurons were reported to show lower fecundity by McBrayer et al. (2007) and should be cited.

C13. This important study has been cited in the first manuscript. In this revision, we have cited it again when mentioning the lower fecundity of female flies lacking PTTH neurons.

(10) Line 230: when were PTTH neurons activated? Since they are dead by 10h post-eclosion it isn't clear if this experiment even makes sense.

C14. Yes, we did this for making sure that PTTH neurons do not affect female receptivity at adult stage again.

(11) Line 338: the statements in the figures say that PTTH function is required during the larval stages, not during metamorphosis

C15. This has been revised as “The result suggested that EcR-A in pC1 neurons plays a role in virgin female receptivity during metamorphosis. This is consistent with that PTTH regulates virgin female receptivity before the start of metamorphosis.”

(12) Did the authors notice any abnormal behavior in males? McBrayer et al. (2007) mention that males lacking PTTH neurons show male-male courtship. This may remit to the impact of 20E on other dsx[+] neurons.

C16. Yes, we have noticed that males lacking PTTH show male-male courtship. It is possible that PTTH deletion induces male-male courtship through the impact of 20E on other dsx+ or fru+ neurons. We have added the corresponding discussion.

(13) Line 145: please define CCT at first use

C17. CCT has been defined.

(14) Overall the manuscript is well written; however, it would still benefit from editing by a native English speaker. I have marked a few corrections that are needed, but I probably missed some.

+ Line 77: "If female is not willing..." should say "If THE female is not willing..."

+ Line 78 "...she may kick the legs, flick the wings," should say "...she may kick HER legs, flick HER wings,"

+ Lines 93-94 this sentence is unclear: "...while the neurons in that fru P1 promoter or dsx is expressed regulate some aspects..."

+ Line 108 "...similar as the function of hypothalamic-pituitary-gonadal (HPG).." should say "...similar

TO the function of hypothalamic-pituitary-gonadal (HPG).."

+ Line 152 "Due to that 20E functions through its receptor EcR.." should say ""BECAUSE 20E ACTS through its receptor EcR.."

+ Lines 155, 354 "unnormal" is not commonly used (although it is an English word); "abnormal" is usually used instead.

+ Line 273: "....we then asked that whether ecdysone regulates" delete "that" + Sentences lines 306-309 need to be revised.

C18. Thank you for your suggestions. We have revised as you advise.

No competing interests declared.

Conceptualization, Data curation, Software, Formal analysis, Supervision, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft, Project administration, Writing – review and editing.

Data curation, Software, Formal analysis, Investigation, Visualization, Methodology.

Data curation, Formal analysis, Investigation.

Resources.

Software.

Software.

Software.

Data curation, Formal analysis, Investigation.

Conceptualization, Resources, Data curation, Software, Supervision, Funding acquisition, Validation, Investigation, Methodology, Project administration.
==== Refs
References

Avila FW Sirot LK LaFlamme BA Rubinstein CD Wolfner MF 2011 Insect seminal fluid proteins: identification and function Annual Review of Entomology 56 21 40 10.1146/annurev-ento-120709-144823 20868282
Billeter JC Villella A Allendorfer JB Dornan AJ Richardson M Gailey DA Goodwin SF 2006 Isoform-specific control of male neuronal differentiation and behavior in Drosophila by the fruitless gene Current Biology 16 1063 1076 10.1016/j.cub.2006.04.039 16753560
Clowney EJ Iguchi S Bussell JJ Scheer E Ruta V 2015 Multimodal chemosensory circuits controlling male courtship in Drosophila Neuron 87 1036 1049 10.1016/j.neuron.2015.07.025 26279475
Connolly K Cook R 1973 Rejection responses by female Drosophila melanogaster: Their ontogeny, causality and effects upon the behaviour of the courting male Behaviour 44 142 165 10.1163/156853973X00364
Dai JD Gilbert LI 1991 Metamorphosis of the corpus allatum and degeneration of the prothoracic glands during the larval-pupal-adult transformation of Drosophila melanogaster: A cytophysiological analysis of the ring gland Developmental Biology 144 309 326 10.1016/0012-1606(91)90424-2 1901285
Dalton JE Lebo MS Sanders LE Sun F Arbeitman MN 2009 Ecdysone receptor acts in fruitless- expressing neurons to mediate Drosophila courtship behaviors Current Biology 19 1447 1452 10.1016/j.cub.2009.06.063 19646872
Demir E Dickson BJ 2005 fruitless splicing specifies male courtship behavior in Drosophila Cell 121 785 794 10.1016/j.cell.2005.04.027 15935764
Deng B Li Q Liu X Cao Y Li B Qian Y Xu R Mao R Zhou E Zhang W Huang J Rao Y 2019 Chemoconnectomics: mapping chemical transmission in Drosophila Neuron 101 876 893 10.1016/j.neuron.2019.01.045 30799021
Deutsch D Pacheco D Encarnacion-Rivera L Pereira T Fathy R Clemens J Girardin C Calhoun A Ireland E Burke A Dorkenwald S McKellar C Macrina T Lu R Lee K Kemnitz N Ih D Castro M Halageri A Jordan C Silversmith W Wu J Seung HS Murthy M 2020 The neural basis for a persistent internal state in Drosophila females eLife 9 e59502 10.7554/eLife.59502 33225998
Dickson BJ 2008 Wired for sex: the neurobiology of Drosophila mating decisions Science 322 904 909 10.1126/science.1159276 18988843
Feng K Palfreyman MT Häsemeyer M Talsma A Dickson BJ 2014 Ascending SAG neurons control sexual receptivity of Drosophila females Neuron 83 135 148 10.1016/j.neuron.2014.05.017 24991958
Ferveur JF 2010 Drosophila female courtship and mating behaviors: sensory signals, genes, neural structures and evolution Current Opinion in Neurobiology 20 764 769 10.1016/j.conb.2010.09.007 20934322
Fuyama Y Ueyama M 1997 Ovulation and the suppression of mating in Drosophila melanogaster females: behavioral basis Behavior Genetics 27 483 488 10.1023/a:1025630602057 9336085
Ganter GK Walton KL Merriman JO Salmon MV Brooks KM Maddula S Kravitz EA 2007 Increased male-male courtship in ecdysone receptor deficient adult flies Behavior Genetics 37 507 512 10.1007/s10519-006-9140-1 17238001
Greenspan RJ Ferveur JF 2000 Courtship in Drosophila Annual Review of Genetics 34 205 232 10.1146/annurev.genet.34.1.205 11092827
Hall JC 1978 Courtship among males due to a male-sterile mutation in Drosophila melanogaster Behavior Genetics 8 125 141 10.1007/BF01066870 99136
Hall JC 1994 The mating of a fly Science 264 1702 1714 10.1126/science.8209251 8209251
Hamada FN Rosenzweig M Kang K Pulver SR Ghezzi A Jegla TJ Garrity PA 2008 An internal thermal sensor controlling temperature preference in Drosophila Nature 454 217 220 10.1038/nature07001 18548007
Häsemeyer M Yapici N Heberlein U Dickson BJ 2009 Sensory neurons in the Drosophila genital tract regulate female reproductive behavior Neuron 61 511 518 10.1016/j.neuron.2009.01.009 19249272
Herbison AE 2016 Control of puberty onset and fertility by gonadotropin-releasing hormone neurons Nature Reviews. Endocrinology 12 452 466 10.1038/nrendo.2016.70 27199290
Hoopfer ED Jung Y Inagaki HK Rubin GM Anderson DJ 2015 P1 interneurons promote a persistent internal state that enhances inter-male aggression in Drosophila eLife 4 e11346 10.7554/eLife.11346 26714106
Imura E Shimada-Niwa Y Nishimura T Hückesfeld S Schlegel P Ohhara Y Kondo S Tanimoto H Cardona A Pankratz MJ Niwa R 2020 The Corazonin-ptth neuronal axis controls systemic body growth by regulating basal ecdysteroid biosynthesis in Drosophila melanogaster Current Biology 30 2156 2165 10.1016/j.cub.2020.03.050 32386525
Ishimoto H Kamikouchi A 2020 A feedforward circuit regulates action selection of pre-mating courtship behavior in female Drosophila Current Biology 30 396 407 10.1016/j.cub.2019.11.065 31902724
Ito H Sato K Koganezawa M Ote M Matsumoto K Hama C Yamamoto D 2012 Fruitless recruits two antagonistic chromatin factors to establish single-neuron sexual dimorphism Cell 149 1327 1338 10.1016/j.cell.2012.04.025 22682252
Jang YH Chae HS Kim YJ 2017 Female-specific myoinhibitory peptide neurons regulate mating receptivity in Drosophila melanogaster Nature Communications 8 1630 10.1038/s41467-017-01794-9 29158481
Kimura KI Hachiya T Koganezawa M Tazawa T Yamamoto D 2008 Fruitless and doublesex coordinate to generate male-specific neurons that can initiate courtship Neuron 59 759 769 10.1016/j.neuron.2008.06.007 18786359
Kimura K Sato C Koganezawa M Yamamoto D 2015 Drosophila ovipositor extension in mating behavior and egg deposition involves distinct sets of brain interneurons PLOS ONE 10 e0126445 10.1371/journal.pone.0126445 25955600
Kohatsu S Koganezawa M Yamamoto D 2011 Female contact activates male-specific interneurons that trigger stereotypic courtship behavior in Drosophila Neuron 69 498 508 10.1016/j.neuron.2010.12.017 21315260
Kubli E 2003 Sex-peptides: seminal peptides of the Drosophila male Cellular and Molecular Life Sciences 60 1689 1704 10.1007/s00018-003-3052 14504657
Kurtovic A Widmer A Dickson BJ 2007 A single class of olfactory neurons mediates behavioural responses to A Drosophila sex pheromone Nature 446 542 546 10.1038/nature05672 17392786
Kvitsiani D Dickson BJ 2006 Shared neural circuitry for female and male sexual behaviours in Drosophila Current Biology 16 R355 R356 10.1016/j.cub.2006.04.025 16713940
Lavrynenko O Rodenfels J Carvalho M Dye NA Lafont R Eaton S Shevchenko A 2015 The ecdysteroidome of Drosophila: influence of diet and development Development 142 3758 3768 10.1242/dev.124982 26395481
Ma B Wang R Liu Y Deng B Wang T Wu F Zhou C 2022 Serotonin signaling modulates sexual receptivity of virgin female Drosophila Neuroscience Bulletin 38 1277 1291 10.1007/s12264-022-00908-8 35788510
Manoli DS Foss M Villella A Taylor BJ Hall JC Baker BS 2005 Male-specific fruitless specifies the neural substrates of Drosophila courtship behaviour Nature 436 395 400 10.1038/nature03859 15959468
Manoli DS Meissner GW Baker BS 2006 Blueprints for behavior: genetic specification of neural circuitry for innate behaviors Trends in Neurosciences 29 444 451 10.1016/j.tins.2006.06.006 16806511
Manoli DS Fan P Fraser EJ Shah NM 2013 Neural control of sexually dimorphic behaviors Current Opinion in Neurobiology 23 330 338 10.1016/j.conb.2013.04.005 23680385
McBrayer Z Ono H Shimell M Parvy JP Beckstead RB Warren JT Thummel CS Dauphin-Villemant C Gilbert LI O’Connor MB 2007 Prothoracicotropic hormone regulates developmental timing and body size in Drosophila Developmental Cell 13 857 871 10.1016/j.devcel.2007.11.003 18061567
McGuire SE Mao Z Davis RL 2004 Spatiotemporal gene expression targeting with the TARGET and gene-switch systems in Drosophila Science’s STKE 2004 l6 10.1126/stke.2202004pl6 14970377
Mellert DJ Knapp JM Manoli DS Meissner GW Baker BS 2010 Midline crossing by gustatory receptor neuron axons is regulated by fruitless, doublesex and the Roundabout receptors Development 137 323 332 10.1242/dev.045047 20040498
Mellert DJ Robinett CC Baker BS 2012 doublesex functions early and late in gustatory sense organ development PLOS ONE 7 e51489 10.1371/journal.pone.0051489 23240029
Mezzera C Brotas M Gaspar M Pavlou HJ Goodwin SF Vasconcelos ML 2020 Ovipositor extrusion promotes the transition from courtship to copulation and signals female acceptance in Drosophila melanogaster Current Biology 30 3736 3748 10.1016/j.cub.2020.06.071 32795437
Neckameyer WS 1998 Dopamine modulates female sexual receptivity in Drosophila melanogaster Journal of Neurogenetics 12 101 114 10.3109/01677069809167259 10197160
Pan Y Robinett CC Baker BS 2011 Turning males on: activation of male courtship behavior in Drosophila melanogaster PLOS ONE 6 e21144 10.1371/journal.pone.0021144 21731661
Pan Y Meissner GW Baker BS 2012 Joint control of Drosophila male courtship behavior by motion cues and activation of male-specific P1 neurons PNAS 109 10065 10070 10.1073/pnas.1207107109 22645338
Pan Y Baker BS 2014 Genetic identification and separation of innate and experience-dependent courtship behaviors in Drosophila Cell 156 236 248 10.1016/j.cell.2013.11.041 24439379
Pan X O’Connor MB 2019 Developmental maturation: Drosophila AstA signaling provides a kiss to grow up Current Biology 29 R161 R164 10.1016/j.cub.2019.01.040 30836086
Pavlou HJ Goodwin SF 2013 Courtship behavior in Drosophila melanogaster: towards a “courtship connectome.” Current Opinion in Neurobiology 23 76 83 10.1016/j.conb.2012.09.002 23021897
Pfeiffer BD Jenett A Hammonds AS Ngo TTB Misra S Murphy C Scully A Carlson JW Wan KH Laverty TR Mungall C Svirskas R Kadonaga JT Doe CQ Eisen MB Celniker SE Rubin GM 2008 Tools for neuroanatomy and neurogenetics in Drosophila PNAS 105 9715 9720 10.1073/pnas.0803697105 18621688
Pfeiffer BD Ngo TTB Hibbard KL Murphy C Jenett A Truman JW Rubin GM 2010 Refinement of tools for targeted gene expression in Drosophila Genetics 186 735 755 10.1534/genetics.110.119917 20697123
Rewitz KF Yamanaka N Gilbert LI O’Connor MB 2009 The insect neuropeptide PTTH activates receptor tyrosine kinase torso to initiate metamorphosis Science 326 1403 1405 10.1126/science.1176450 19965758
Rezával C Nojima T Neville MC Lin AC Goodwin SF 2014 Sexually dimorphic octopaminergic neurons modulate female postmating behaviors in Drosophila Current Biology 24 725 730 10.1016/j.cub.2013.12.051 24631243
Rezával C Pattnaik S Pavlou HJ Nojima T Brüggemeier B D’Souza LAD Dweck HKM Goodwin SF 2016 Activation of latent courtship circuitry in the brain of Drosophila females induces male-like behaviors Current Biology 26 2508 2515 10.1016/j.cub.2016.07.021 27568592
Riddiford LM Cherbas P Truman JW 2000 Ecdysone receptors and their biological actions Vitamins and Hormones 60 1 73 10.1016/s0083-6729(00)60016-x 11037621
Rideout EJ Dornan AJ Neville MC Eadie S Goodwin SF 2010 Control of sexual differentiation and behavior by the doublesex gene in Drosophila melanogaster Nature Neuroscience 13 458 466 10.1038/nn.2515 20305646
Roy S Saha TT Zou Z Raikhel AS 2018 Regulatory pathways controlling female insect reproduction Annual Review of Entomology 63 489 511 10.1146/annurev-ento-020117-043258 29058980
Ruta V Datta SR Vasconcelos ML Freeland J Looger LL Axel R 2010 A dimorphic pheromone circuit in Drosophila from sensory input to descending output Nature 468 686 690 10.1038/nature09554 21124455
Scheffer LK Xu CS Januszewski M Lu Z Takemura SY Hayworth KJ Huang GB Shinomiya K Maitlin-Shepard J Berg S Clements J Hubbard PM Katz WT Umayam L Zhao T Ackerman D Blakely T Bogovic J Dolafi T Kainmueller D Kawase T Khairy KA Leavitt L Li PH Lindsey L Neubarth N Olbris DJ Otsuna H Trautman ET Ito M Bates AS Goldammer J Wolff T Svirskas R Schlegel P Neace E Knecht CJ Alvarado CX Bailey DA Ballinger S Borycz JA Canino BS Cheatham N Cook M Dreher M Duclos O Eubanks B Fairbanks K Finley S Forknall N Francis A Hopkins GP Joyce EM Kim S Kirk NA Kovalyak J Lauchie SA Lohff A Maldonado C Manley EA McLin S Mooney C Ndama M Ogundeyi O Okeoma N Ordish C Padilla N Patrick CM Paterson T Phillips EE Phillips EM Rampally N Ribeiro C Robertson MK Rymer JT Ryan SM Sammons M Scott AK Scott AL Shinomiya A Smith C Smith K Smith NL Sobeski MA Suleiman A Swift J Takemura S Talebi I Tarnogorska D Tenshaw E Tokhi T Walsh JJ Yang T Horne JA Li F Parekh R Rivlin PK Jayaraman V Costa M Jefferis GS Ito K Saalfeld S George R Meinertzhagen IA Rubin GM Hess HF Jain V Plaza SM 2020 A connectome and analysis of the adult Drosophila central brain eLife 9 e57443 10.7554/eLife.57443 32880371
Schretter CE Aso Y Robie AA Dreher M Dolan MJ Chen N Ito M Yang T Parekh R Branson KM Rubin GM 2020 Cell types and neuronal circuitry underlying female aggression in Drosophila eLife 9 e58942 10.7554/eLife.58942 33141021
Sengupta S Chan YB Palavicino-Maggio CB Kravitz EA 2022 GABA transmission from mAL interneurons regulates aggression in Drosophila males PNAS 119 e2117101119 10.1073/pnas.2117101119 35082150
Shimell M Pan X Martin FA Ghosh AC Leopold P O’Connor MB Romero NM 2018 Prothoracicotropic hormone modulates environmental adaptive plasticity through the control of developmental timing Development 145 dev159699 10.1242/dev.159699 29467242
Siwicki KK Kravitz EA 2009 Fruitless, doublesex and the genetics of social behavior in Drosophila melanogaster Current Opinion in Neurobiology 19 200 206 10.1016/j.conb.2009.04.001 19541474
Stockinger P Kvitsiani D Rotkopf S Tirián L Dickson BJ 2005 Neural circuitry that governs Drosophila male courtship behavior Cell 121 795 807 10.1016/j.cell.2005.04.026 15935765
Taisz I Donà E Münch D Bailey SN Morris BJ Meechan KI Stevens KM Varela-Martínez I Gkantia M Schlegel P Ribeiro C Jefferis G Galili DS 2023 Generating parallel representations of position and identity in the olfactory system Cell 186 2556 2573 10.1016/j.cell.2023.04.038 37236194
Terhzaz S Rosay P Goodwin SF Veenstra JA 2007 The neuropeptide SIFamide modulates sexual behavior in Drosophila Biochemical and Biophysical Research Communications 352 305 310 10.1016/j.bbrc.2006.11.030 17126293
True & John 2014 Atlas of Drosophila morphology: Wild-type and classical mutants Quarterly Review of Biology 89 188 10.1086/676090
Truman JW Talbot WS Fahrbach SE Hogness DS 1994 Ecdysone receptor expression in the CNS correlates with stage-specific responses to ecdysteroids during Drosophila and Manduca development Development 120 219 234 10.1242/dev.120.1.219 8119129
Truman JW Riddiford LM 2023 Drosophila postembryonic nervous system development: a model for the endocrine control of development GENETICS 223 iyac184 10.1093/genetics/iyac184 36645270
von Philipsborn AC Liu T Yu JY Masser C Bidaye SS Dickson BJ 2011 Neuronal control of Drosophila courtship song Neuron 69 509 522 10.1016/j.neuron.2011.01.011 21315261
Wang L Anderson DJ 2010 Identification of an aggression-promoting pheromone and its receptor neurons in Drosophila Nature 463 227 231 10.1038/nature08678 19966787
Wang F Wang K Forknall N Parekh R Dickson BJ 2020a Circuit and behavioral mechanisms of sexual rejection by Drosophila Females Current Biology 30 3749 3760 10.1016/j.cub.2020.07.083 32795445
Wang F Wang K Forknall N Patrick C Yang T Parekh R Bock D Dickson BJ 2020b Neural circuitry linking mating and egg laying in Drosophila females Nature 579 101 105 10.1038/s41586-020-2055-9 32103180
Wang K Wang F Forknall N Yang T Patrick C Parekh R Dickson BJ 2021 Neural circuit mechanisms of sexual receptivity in Drosophila females Nature 589 577 581 10.1038/s41586-020-2972-7 33239786
Wang T Jing B Deng B Shi K Li J Ma B Wu F Zhou C 2022 Drosulfakinin signaling modulates female sexual receptivity in Drosophila eLife 11 e76025 10.7554/eLife.76025 35475782
Wu Y Bidaye SS Mahringer D 2019 Drosophila Female-Specific Brain Neuron Elicits Persistent Position- and Direction-Selective Male-like Social Behaviors bioRxiv 10.1101/594960
Yamamoto D 2007 The neural and genetic substrates of sexual behavior in Drosophila Advances in Genetics 59 39 66 10.1016/S0065-2660(07)59002-4 17888794
Yamamoto D Koganezawa M 2013 Genes and circuits of courtship behaviour in Drosophila males Nature Reviews. Neuroscience 14 681 692 10.1038/nrn3567 24052176
Yamanaka N Romero NM Martin FA Rewitz KF Sun M O’Connor MB Léopold P 2013 Neuroendocrine control of Drosophila larval light preference Science 341 1113 1116 10.1126/science.1241210 24009394
Yang CH Rumpf S Xiang Y Gordon MD Song W Jan LY Jan YN 2009 Control of the postmating behavioral switch in Drosophila females by internal sensory neurons Neuron 61 519 526 10.1016/j.neuron.2008.12.021 19249273
Zhou C Pan Y Robinett CC Meissner GW Baker BS 2014 Central brain neurons expressing doublesex regulate female receptivity in Drosophila Neuron 83 149 163 10.1016/j.neuron.2014.05.038 24991959
