
==== Front
PLoS One
PLoS One
plos
PLOS ONE
1932-6203
Public Library of Science San Francisco, CA USA

10.1371/journal.pone.0309944
PONE-D-24-20217
Research Article
Biology and life sciences
Biochemistry
Nucleic acids
RNA
Non-coding RNA
Natural antisense transcripts
MicroRNAs
Biology and life sciences
Genetics
Gene expression
Gene regulation
MicroRNAs
Biology and Life Sciences
Organisms
Eukaryota
Plants
Grasses
Wheat
Biology and Life Sciences
Genetics
Gene Expression
Biology and Life Sciences
Organisms
Eukaryota
Plants
Grasses
Wheat
Common Wheat
Biology and Life Sciences
Plant Science
Plant Anatomy
Leaves
Biology and Life Sciences
Molecular Biology
Molecular Biology Techniques
Artificial Gene Amplification and Extension
Polymerase Chain Reaction
Research and Analysis Methods
Molecular Biology Techniques
Artificial Gene Amplification and Extension
Polymerase Chain Reaction
Biology and Life Sciences
Agriculture
Crop Science
Crops
Cereal Crops
Biology and Life Sciences
Genetics
Genetic Loci
Expression patterns of candidate genes for the Lr46/Yr29 “slow rust” locus in common wheat (Triticum aestivum L.) and associated miRNAs inform of the gene conferring the Puccinia triticina resistance trait
Deciphering Lr46/Yr29: Genes & miRNAs in wheat rust resistance
https://orcid.org/0000-0003-1734-3803
Spychała Julia Data curation Formal analysis Investigation Methodology Writing – original draft Writing – review & editing 1 2
https://orcid.org/0000-0001-9516-8911
Tomkowiak Agnieszka Conceptualization Data curation Formal analysis Supervision Writing – review & editing 1 *
https://orcid.org/0000-0002-0673-9784
Noweiska Aleksandra Investigation Writing – review & editing 1 2
Bobrowska Roksana Investigation Project administration 1
https://orcid.org/0000-0002-2429-8054
Rychel-Bielska Sandra Data curation Methodology Writing – review & editing 3
https://orcid.org/0000-0002-0102-0084
Bocianowski Jan Data curation Software Writing – review & editing 4
https://orcid.org/0000-0002-3626-4388
Wolko Łukasz Investigation Methodology 5
https://orcid.org/0000-0002-0153-4624
Kowalczewski Przemysław Łukasz Writing – review & editing 6
https://orcid.org/0000-0002-2655-5464
Nowicki Marcin Formal analysis Writing – original draft Writing – review & editing 7 *
https://orcid.org/0000-0001-9442-3124
Kwiatek Michał Tomasz Conceptualization Funding acquisition Validation Writing – review & editing 1 8
1 Department of Genetics and Plant Breeding, Poznań University of Life Sciences, Poznań, Poland
2 Plant Breeding and Acclimatization Institute - National Research Institute in Radzików, Poznań Division, Department of Oilseed Crops, Poznań, Poland
3 Department of Genetics, Plant Breeding and Seed Production, Wrocław University of Environmental and Life Sciences, Wrocław, Poland
4 Department of Mathematical and Statistical Methods, Poznań University of Life Sciences, Poznań, Poland
5 Department of Biochemistry and Biotechnology, Poznań University of Life Sciences, Poznań, Poland
6 Department of Food Technology of Plant Origin, Poznań University of Life Sciences, Poznań, Poland
7 Department of Entomology and Plant Pathology, Institute of Agriculture, University of Tennessee, Knoxville, Tennessee, United States of America
8 Plant Breeding and Acclimatization Institute - National Research Institute in Radzików, Radzikow, Poland
Singh Vaibhav Kumar Editor
Indian Agricultural Research Institute, INDIA
Competing Interests: The authors have declared that no competing interests exist.

* E-mail: agnieszka.tomkowiak@up.poznan.pl (AT); mnowicki@utk.edu (MN)
6 9 2024
2024
19 9 e030994419 5 2024
22 8 2024
© 2024 Spychała et al
2024
Spychała et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Leaf rust caused by Puccinia triticina (Pt) is one of the most impactful diseases causing substantial losses in common wheat (Triticum aestivum L.) crops. In adult plants resistant to Pt, a horizontal adult plant resistance (APR) is observed: APR protects the plant against multiple pathogen races and is distinguished by durable persistence under production conditions. The Lr46/Yr29 locus was mapped to chromosome 1B of common wheat genome, but the identity of the underlying gene has not been demonstrated although several candidate genes have been proposed. This study aimed to analyze the expression of nine candidate genes located at the Lr46/Yr29 locus and their four complementary miRNAs (tae-miR5384-3p, tae-miR9780, tae-miR9775, and tae-miR164), in response to Pt infection. The plant materials tested included five reference cultivars in which the molecular marker csLV46G22 associated with the Lr46/Yr29-based Pt resistance was identified, as well as one susceptible control cultivar. Biotic stress was induced in adult plants by inoculation with fungal spores under controlled conditions. Plant material was sampled before and at 6, 12, 24, 48 hours post inoculation (hpi). Differences in expression of candidate genes at the Lr46/Yr29 locus were analyzed by qRT-PCR and showed that the expression of the genes varied at the analyzed time points. The highest expression of Lr46/Yr29 candidate genes (Lr46-Glu1, Lr46-Glu2, Lr46-Glu3, Lr46-RLK1, Lr46-RLK2, Lr46-RLK3, Lr46-RLK4, Lr46-Snex, and Lr46-WRKY) occurred at 12 and 24 hpi and such expression profiles were obtained only for one candidate gene among the nine genes analyzed (Lr46-Glu2), indicating that it may be a contributing factor in the resistance response to Pt infection.

Ministry of Agriculture and Rural Development (Poland) DHR.hm.802.11.2023 https://orcid.org/0000-0001-9442-3124
Kwiatek Michał Tomasz University of Tennessee Open Access Publishing Fund https://orcid.org/0000-0002-2655-5464
Nowicki Marcin This study was financed by the framework of Ministry of Agriculture and Rural Development (Poland) program: “Biological Progress in Plant Production” in years 2021–2027, task No. 5: “A molecular analysis of an adult plant slow rusting genes conferring resistance to rusts caused by Puccinia sp.” (DHR.hm.802.11.2023); Project leader: M.T. Kwiatek. Publication costs were covered by the University of Tennessee Open Access Publishing Fund awarded to M. Nowicki. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityAll relevant data are within the manuscript and its Supporting information files.
Data Availability

All relevant data are within the manuscript and its Supporting information files.
==== Body
pmcIntroduction

Common wheat (Triticum aestivum L.) is one of staple crop species of enormous global importance. Worldwide, wheat cultivation is extremely relevant as it is connected with the crop’s large share in human and animal nutrition. Currently, the primary directions of wheat breeding focus mainly on high yield, high commercial quality, and resistance to biotic and abiotic stresses [1–3]. Among the most threatening diseases leading to substantial losses in world’s wheat crops is leaf rust caused by the fungus Puccinia triticina Eriks (Pt). It occurs more frequently than other rust diseases and is comparatively more prevalent worldwide [4]. Wheat leaf rust contributes substantially to the crop losses [4, 5]. Pt is an obligate parasite capable of producing infectious urediniospores that can spread over long distances, which may result in an epidemic of leaf rust on a national or even continental scale [6]. Scientists’ efforts are being focused on the possible future threats posed by climate change that renders negative impacts on global crop production and food security. Modern breeding technologies and biotechnology strategies are valuable tools to create climate-smart crops. In addition, to understand plant responses under various abiotic and biotic stresses, the most urgent need currently is to investigate their respective genetic basis and molecular mechanisms [7]. In 2020, Prasad et al. [5] analyzed hundreds of major scientific reports on mechanisms of plant resistance to fungal pathogens, including Pt. So far, the number of identified leaf rust resistance genes (Lr) is limited, and potential co-expression data have not yet been sufficiently examined. To understand the variability of Lr genes and the molecular mechanisms used to activate their expression after infection, the pursuit to clone more Lr genes is essential. The search for diverse and durable resistance to Pt must continue using advanced tools and techniques, including molecular methods [5].

Common wheat (Triticum aestivum L.) is an allohexaploid species (2n = 6× = 42 chromosomes; AABBDD) as a result of its dynamic domestication history [8]. This polyploidy is the result of two rounds of hybridization: the first interspecific between T. urartu (2n = 2× = 14 chromosomes; AA) and Aegilops spp. (genome BB), then between T. turgidum (2n = 4× = 28 chromosomes; AABB) and A. tauschii (2n = 2× = 14 chromosomes; DD) [9, 10]. The resulting common wheat genome is exceptionally large (approximately 16 Gbp) and, similar to other large plant genomes, its repeat sequences (including retrotransposons) account for as much as about 85%. Over the past decades, numerous studies have led to the identification of approximately 100 Lr genes and many important quantitative trait loci (QTLs) on various chromosomes of wheat genome [11, 12]. However, due to the size and complexity of the wheat genome, only a few Lr genes have been cloned so far. These include seven genes (Lr1, Lr10, Lr21, Lr34, Lr42, Lr47, and Lr67) cloned by classical map-based cloning and four genes obtained by rapid gene-cloning approaches (Lr9, Lr13, Lr14a, and Lr22a) [5, 13]. Genetically determined resistance to Pt has been characterized both in young plants (seedling resistance; SR) and plants at the mature stage (adult plant resistance; APR). APR is characterized by a comparatively greater persistence than SR [14]. Genes that underlie APR confer quantitative resistance, also known as horizontal resistance, that provides trait stability and reduced risk of future susceptibility. Majority of characterized Lr genes confer the SR type resistance at the seedling stage and are race-specific; exceptions include the few known APR genes such as Lr34/Yr18/Sr57, Lr46/Yr29/Sr58, Lr67/Yr46/Sr55, and Lr68 [15–18]. In the APR-type Pt-resistant wheat cultivars, the observed slow rust impacts manifest as partial but durable Pt resistance [19]. An example of a gene with such resistance is the well-studied Lr34 gene [20–25]. Lr genes have been successfully used in many breeding programs to develop novel wheat cultivars with improved pathogen resistance. Currently, only a few APR genes, such as Lr34 and Lr46, are meaningfully useful in Pt-resistance breeding and are widely used in wheat breeding [25–27].

The Lr46 gene was first described in the cultivar ’Pavon 76’ [28]. Wheat genotypes showing Lr46/Yr29 are characterized by resistance to leaf and stripe rust pathogens; in addition, they have been characterized as donors of resistance to powdery mildew (Pm39) and stem rust pathogens (Sr58) [6]. The associated locus Lr46/Yr29/Sr58/Pm39 was mapped to chromosome 1BL, but the specific genes are yet to be identified. Based on high-resolution mapping of wheat QYr.ucw-1BL, 13 candidate genes for Lr46/Yr29 were selected and analyzed [29]. However, it remains unclear whether this locus of resistance to multiple pathogens is the result of the pleiotropic action of a single causal gene or a small cluster of tightly linked genes [30]. Detailed functional characterization of the Lr46/Yr29 is essential to determine the allelic variability of the gene(s) that underlies the Pt resistance trait and to establish the molecular mechanism(s) of such a function [20].

Resistance and susceptibility are regulated by mechanisms for rapid recognition of invading pathogens and efficient activation of host plant defense mechanisms. Small non-coding RNAs, which can be subdivided into microRNAs (miRNAs) and small interfering RNAs (siRNAs), are global regulators of gene expression. In recent years, many miRNAs specific for plant development and various biotic and abiotic stress responses have been identified in wheat. In plants, regulation of expression by miRNAs is mainly through post-transcriptional regulation. miRNAs regulate not only the processes of plant growth and development but also actively participate in plant responses to biotic stress agents [31–34]. Plant miRNAs are small molecules of approximately 21 bp (base pairs) [35]. They recognize specific target mRNAs based on sequence complementarity and repress expression of the target gene(s) by targeting the mRNA for degradation or by inhibiting translation [36–38]. Obtaining a holistic knowledge of the functional dynamics and conservation of miRNAs in wheat can provide valuable information for the development of cultivars with improved stress resistance and yield [31, 39].

In this study, we analyzed the expression levels of nine candidate genes encompassed by Lr46/Yr29, selected based on the work by Cobo et al. [29]. These candidate genes mapped the QYr.ucw-1BL region to chromosome 1BL, which overlapped with the current genetic maps of the Pt resistance gene Yr29 (also known as Lr46) [28]. The results suggest that QTL (QYr.ucw-1BL) and Lr46/Yr29 map to the same gene conferring similar resistance responses. Previous data [29] highlighted the need to investigate the trait’s expression in different genotypes with and without pathogen inoculation to determine whether there are differences in the expression levels among candidate genes for Lr46/Yr29. As a result, 13 candidate genes were identified for Lr46/Yr29, but three of them were discarded (TraesCS1B02G454300, TraesCS1B02G454700, and TraesCS1B02G454900), because the first gene is annotated as a transposable element and there are no exome capture data; the other two genes were excluded because they are likely to be unexpressed pseudogenes. To confirm the obtained amplicons, we performed Sanger sequencing of all amplified products and compared the assembled sequences with homologues of genes located on other chromosomes: 1A, 1D, 2A, 2B, and 2D. Furthermore, we used stem-loop Reverse Transcription PCR (RT-PCR) and droplet digital PCR (ddPCR) methods to analyze the expression of miRNA molecules complementary to candidate genes for Lr46/Yr29, which can influence or modulate their expression over time.

Materials and methods

Plant growth, pathogen inoculation, and leaf sample collection

Plant materials consisted of six common wheat cultivars whose seeds were obtained from the National Small Grains Collection (Agricultural Research Station in Aberdeen, WA, USA). Five of the common wheat cultivars tested were found to be highly valuable sources of Pt resistance genes: spring cultivars Artigas (“PI 192535”), NP846 (“PI 322263”), Glenlea (“CItr 17272”), Lerma Rojo (“CItr 13651”), and one winter wheat cultivar TX89D6435 (“PI 584759”). The susceptibility control (lack of molecular markers linked to Lr34, Lr46, or Lr67) was the spring cultivar Artigas* (“PI 73046”) [20, 40]. Identification of molecular markers for the Lr46/Yr29 locus of Artigas* and the listed Pt-resistant wheat cultivars analyzed in this paper was recently carried out by our research team [20]. The csLV46G22 marker linked to the Lr46/Yr29 locus (E. Lagudah, unpublished data) was identified in all five resistant wheat genotypes [20].

The experiment was conducted in a growth chamber under controlled conditions: the temperature was set at 18 °C during the day and 16 °C at night with a 16-hour photoperiod, a relative humidity of 60 to 70% was established. In addition, the emission spectrum of the light source was fixed with a photon flux of 572 μE. One month after setting up the experiment, the temperature in the phytotron was raised to 20 °C and 17 °C during the day and night, respectively. Plants were grown to the adult plant stage, i.e., the formation of the flag leaf; plants were inoculated at 34 days after sowing. Cultivars at the adult plant stage were inoculated with Pt by spraying a suspension of urediniospores at a concentration of approximately 5 × 105 spores/mL. Inoculum suspension was an equimolar mixture of four Pt strains suspended in water with 1% v/v Tween 20 reagent and prepared immediately before inoculation [40, 41]. Fungal spores were collected from infected field experiments located in various parts of Poland [40]. Samples of leaf tissue fragments were collected at five time points: 0 (before inoculation), 6, 12, 24, and 48 hours post inoculation (hpi), in three biological replicates. Leaf tissue samples were immediately frozen in liquid nitrogen and stored at -80 °C.

Candidate gene expression analysis using Quantitative Reverse Transcription PCR (qRT-PCR)

Based on the work of Cobo et al. [29], 10 candidate genes for the Lr46/Yr29 gene (Table 1) whose sequences were found in the Ensembl Plants database for common wheat (https://plants.ensembl.org/Triticum_aestivum/Info/Index) were selected and downloaded in FASTA format. These sequences were used to design primers for qRT-PCR reactions, using the Primer3Plus tool (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). The Lr46/Yr29 region described by Cobo et al. [29] involves four copies of the RECEPTOR-LIKE PROTEIN KINASE (RLK) gene, three copies of GLUCAN ENDO-1,3-BETA-GLUCOSIDASES (Glu), as well as one copy each of SORTING NEXIN (Snex), SUGAR TRANSPORTER (STr), and a TRANSCRIPTION FACTOR CARRYING THE WRKY DOMAIN (WRKY). Of all the candidate genes listed, only the STr gene has no other close analogues in the reference wheat genome [42]. The sequences of the two candidate genes Lr46-Snex and Lr46-WRKY were similar to one another, which allowed universal primers to be designed to detect any transcript including homologues in other chromosomes. For the Lr46-Snex gene, a pair of universal primers was designed to allow detection of potential homologue transcripts on chromosomes 1A, 1B, and 1D. Similar was true for the Lr46-WRKY gene, for which a pair of universal primers was designed to allow the detection of potential gene transcripts of homologues on chromosomes 1B and 1D. Regarding the RLK and Glu genes, very similar gene arrangements are found on the other two chromosomes: 1A and 1D, in the region similar to 1B chromosome. Therefore, a comparison was made of only those few copies of genes found in the QYr.ucw-1BL region described, on chromosome 1B. These genes are so highly differentiated that it is not possible to design universal primers for them. Based on the T. aestivum reference genome sequence (taxid: 4565), primers were designed. Isolation of total RNA from leaf tissue samples collected as biological replicates and at variable time points (0, 6, 12, 24, and 48 hpi) was performed using the Maxwell RSC Plant RNA Kit isolation (Promega, Madison, WI, USA). The concentration and purity of isolated total RNA were assessed using a NanoDrop spectrophotometer and A260/A280 ratio. First-strand cDNA synthesis was performed using the iScript™ Reverse Transcription Supermix kit for RT-qPCR (Bio-Rad, Hercules, CA, USA), according to the protocol provided by the manufacturer. A temperature gradient PCR was performed for each investigated amplicon (each primer pair) to optimize the thermal profile applied. The gradient was set in the temperature range from 50 °C to 58 °C. The optimized amplification temperature was set at 53.5 °C after obtaining a specific product in a 2% agarose gel. In order to perform amplification standard curves, the amplicons obtained were individually purified using the QIAquick PCR Purification Kit (Qiagen Inc., Hilden, Germany) according to the protocol provided by the company. In the next step, a series of dilutions were performed for each purified amplicon to obtain standard curves of qRT-PCR efficiency (%E) and R2 values (Table 2). The standard curves were developed according to the protocol described previously [43].

10.1371/journal.pone.0309944.t001 Table 1 Presentation of 10 genes located in the candidate region for Lr46/Yr29 gene and QYr.ucw-1BL region, predicted function and their localization on reference wheat genome TGACv2 (GCA_900241085.1).

No.	Gene ID	Gene abbreviation	Gene predicted function	Physical localization	
1.	TraesCS1B02G453900.1	Lr46-Glu1	Glucan endo-1,3- β -glucosidase	1B: 669,922,599–669,924,501	
2.	TraesCS1B02G454200.1	Lr46-Glu2	Glucan endo-1,3- β -glucosidase	1B: 670,142,374–670,144,629	
3.	TraesCS1B02G454500.1	Lr46-Glu3	Glucan endo-1,3- β -glucosidase	1B: 670,158,858–670,161,009	
4.	TraesCS1B02G454000.2	Lr46-RLK1	RLK (receptor-like kinase)	1B: 670,025,362–670,028,705	
5.	TraesCS1B02G454100.1	Lr46-RLK2	RLK (receptor-like kinase)	1B: 670,034,245–670,037,207	
6.	TraesCS1B02G454400.1	Lr46-RLK3	RLK (receptor-like kinase)	1B: 670,152,915–670,155,867	
7.	TraesCS1B02G454600.1	Lr46-RLK4	RLK (receptor-like kinase)	1B: 670,164,777–670,167,783	
8.	TraesCS1B02G454800.2	Lr46-STr	Sugar transporter	1B: 670,185,922–670,187,880	
9.	TraesCS1B02G453700.1	Lr46-Snex	Sorting nexin	1B: 669,895,813–669,902,629	
10.	TraesCS1B02G455000.1	Lr46-WRKY	WRKY transcription factor	1B: 670,202,181–670,203,493	

10.1371/journal.pone.0309944.t002 Table 2 Name and sequences of designed primers based on candidate gene sequences for Lr46/Yr29.

The table also shows qPCR efficiency (%E) and R2 values by performing standard curves.

Gene abbreviation	Primer sequence (5’- 3’)	Product size (bp)	Amplification efficiency (%E)	R2	Tm (°C)	
Lr46-Glu1	F GGTGCAGAGCAATGTGAA
R AGCTGAGAGTTTAGTTGG	102	84.4	0.999	84.5	
Lr46-Glu2	F TATCTCTTGTTCCGCCCC
R CCATCGCATAGTACACAG	103	84.3	0.998	84.5	
Lr46-Glu3	F ACTCCAGACGTCATTCCC
R GAACCGGTCTGTCGGAAAA	99	93.1	0.999	85.5	
Lr46-RLK1	F ACGGGAAGGAAGAACAAT
R ATCCATCATGTCCAACACC	105	109.4	0.998	79.5	
Lr46-RLK2	F TGAGATCGTGACGGGAAG
R CTAGCATCTCCAGTAGTGT	114	95.3	0.998	83.5	
Lr46-RLK3	F CAGGGACCTTAAAGCTAAT
R GGTTTGAGTATGAGTGTG	109	92.0	0.999	80.5	
Lr46-RLK4	F TTCAGCTTTGGCGTATTGCAAC
R ACGGGTCTAGCATCTCCAGT	101	91.3	0.998	83.0	
Lr46-STr	F GGCCGTGAACGTGTATAT
R GTGTCGGTGCCATTTCAG	107	-	-	-	
Lr46-Snex	F CTTTGATAGTTCTGTTTCGC
R TTTGTTTTGGCAAGTGGG	103	92.1	1.000	81.5	
Lr46-WRKY	F TTTCTTCGCCTCTTTTGAC
R GTGGAACCAATTCTCGTA	120	94.2	0.999	82.5	

qRT-PCR was performed using iTaq Universal SYBR Green Supermix and CFX96 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). A negative No Template Control (NTC) was also performed for each analyzed gene. The composition of the qRT-PCR reaction mix was as follows: supermix—5 μL, primers (10 μM)—0.5 μL each, nuclease-free water—3 μL, and cDNA template -1 μL. Following current MIQUE recommendations on the validity of real-time PCR analyses, three biological replicates were used for each gene type/timepoint for a given wheat cultivar, and three technical repeats were prepared for each [44]. The following temperature profile was used: initial denaturation for 3 min at 95 °C; then 40 cycles: denaturation for 10 sec at 95 °C, annealing of primers for 30 sec at 53.5 °C. Melt stage (melt curve): melting temperature range 65 °C to 90 °C; every 5 seconds the temperature was increased by 0.5 °C and a fluorescence measurement was taken. Data analyses were performed using Bio-Rad CFX Maestro software and the Gene Study tool (Bio-Rad Laboratories, Inc., Hercules, CA, USA), which allowed to compare the expression of all genes at different time points of each cultivar.

Reference genes for Real-Time Quantitative Reverse Transcription PCR (qRT-PCR)

Based on literature data, four reference genes were selected for stable expression: TUBβ, ARF, RLI [45], and EF2-1 [46]. After analyzing the standard curves for these reference genes, two genes, TUBβ and ARF, were selected and qRT-PCR analyses were performed for them on a test cDNA template [40]. The selection and testing of reference genes were developed according to a previously reported protocol [40]. The analysis of reference genes for the test samples was essential for statistical calculations because the expression of the reference gene was compared to the expression of the gene analyzed for each sample using the Gene Study tool (CFX Maestro from Bio-Rad Laboratories, Inc., Hercules, CA, USA).

Preparation of candidate gene amplicons for Sanger sequencing

Sanger sequencing was performed to confirm that the desired amplicons were obtained for the candidate genes for Lr46/Yr29 and to characterize the possible sequence polymorphism(s) among the resistant genotype (Glenlea cultivar) and the susceptible genotype (Artigas* cultivar). The majority of amplicons for sequencing were amplified from cDNA. However, Lr46-RLK1, Lr46-RLK2, and Lr46-RLK4 were exceptions that resulted from obtaining a low quantity and/or quality PCR products using cDNA; in these cases, genomic DNA was used as template, isolated from leaves using the GeneMATRIX Plant and Fungi DNA Purification Kit (EURx Ltd, Gdańsk, Poland), according to the protocol provided by the manufacturer. For sequence confirmation of the analyzed candidate genes in the Lr46/Yr29 locus, PCR reactions were performed for the respective primer pairs. GoTaq G2 Flexi DNA Polymerase reagents (Promega, Madison, WI, USA) were used to prepare the PCR reaction [40], otherwise identical in composition to qRT-PCR described above. The following amplification temperature profile was used: initial denaturation for 2 min at 94°C; followed by 35 cycles: denaturation for 1 min at 95 °C, annealing of primers for 30 s at 53.5 °C, extension for 30 s at 72 °C, extension for 30 s at 72 °C; final extension for 5 min at 72 °C and cooling to 4 °C. Purification of amplicons was performed using the QIAquick PCR Purification Kit (Qiagen Inc., Hilden, Germany), according to the protocol provided by the manufacturer. After purification, samples were resuspended in an elution buffer in a volume of 30 μL. Purified amplicons were directly sequenced using the Sanger method with the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) and a 3730xl capillary DNA analyzer (Applied Biosystems) by Genomed (Warsaw, Poland). The results obtained were assembled using Geneious v8.1 software [47].

Validation of miRNAs and analysis of their expression using stem-loop RT-PCR and ddPCR

In this study, the expression of four miRNAs was analyzed: three related to the candidate gene Lr46-Glu2 (tae-miR5384-3p, tae-miR9780, tae-miR9775, tae-miR9780 also being complementary to Lr46-RLK2), and tae-miR164 complementary to Lr46-RLK3. The coding sequences of these candidate target genes downloaded from the Ensembl Plants database (https://plants.ensembl.org/Triticum_aestivum/Info/Index), were analyzed in the psRNATarget database (http://plantgrn.noble.org/psRNATarget/). The sequences of the four miRNAs analyzed were found in the miRBase database (https://www.mirbase.org/) and downloaded in FASTA format and using the Integrated DNA Technologies website (https://eu.idtdna.com/pages), stem-loop primers were designed for miRNA reverse transcription and ddPCR reactions according to the protocols [48–50]. The mirVana™ miRNA Isolation Kit with phenol (Thermo Fisher Scientific, Waltham, MA, USA) was used to extract the RNA fraction containing miRNA, the concentration and purity of which were measured spectrophotometrically using NanoDrop. The extracted miRNA fraction was then reversely transcribed using SuperScript IV Reverse Transcriptase (Thermo Fisher Scientific, Waltham, MA, USA), using stem-loop primers and the following protocol: incubation at 16 °C for 30 min; 60 cycles at 30 °C for 30 sec, 42 °C for 30 sec, and 50 °C for 1 sec; incubation at 85 °C for 5 min [51]. To quantify the number of miRNA molecules in the plant samples, a ddPCR mixture composed of 10 μL of ddPCR Super Mix Eva Green, primers (the final concentration of each primer was 200 nM), template (reversely transcribed, elongated miRNA), and RNase-free H2O was used. A 20 μL reaction mixture was used to generate the reaction droplets in an 8-well cartridge using a QX100 droplet generator (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The droplets were carefully transferred to a 96-well ddPCR plate and heat-sealed with plastic covers with thermal foil (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Then, cDNA was amplified in a T100 PCR thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA) under the following cycling conditions: denaturation at 95 °C for 5 min, followed by 40 cycles with a three-step thermal profile of denaturation at 95 °C for 30 sec, annealing at 58 °C for 30 sec, and extension at 72 °C for 45 sec. Subsequently, the products were kept at 72 °C for 2 min for the final extension. After amplification, the products were cooled to 4 °C for 5 min and then heated to 90 °C for 5 min and finally cooled again to 12 °C. The droplets were quantified in a QX100 droplet reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The data acquisition and analysis were conducted using QuantaSoft version 1.7 software (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Positive droplets containing amplification products were distinguished from negative droplets by setting the fluorescence amplitude threshold to the lowest value of the positive droplet cluster. Yeast tRNA-Thr (TGT) molecules with the encoded sequence were added to each RT reaction as an internal control.

Statistical analysis

The Kolmogorov–Smirnov test was used to evaluate the null hypothesis that a set of normalized expression data for a particular gene and cultivar comes from a normal distribution. To assess the homogeneity of variances, Bartlett’s test was used. Two-way analyses of variance (ANOVA) were carried out to determine the main effects of cultivar and time point as well as cultivar × time point interaction on the variability of the individual expression profiles of the analyzed genes of candidate genes for Lr46/Yr29. For comparison of means of expression in each examined time point after inoculation to expression before inoculation, the elementary contrasts were performed, conducted for each cultivar independently. The expression of the analyzed candidate genes is shown as heatmaps. Tukey’s Honestly Significant Difference tests (post-hoc factorial one- or two-way ANOVA, depending on ANOVA’s results) were performed in R v.4.4.0 [52] using package agricolae v.1.3–7 [53] at α = 0.05. We referred to the expression values of the candidate genes miRNAs analyzed as ’relative expression’ for the expression level, as our results represent differences in expression compared to the values before inoculation. For visualization of gene expression results, cluster analysis (UPGMA method) with Euclidean distances was performed. All these analyses were conducted using the GenStat statistical software package [54].

Results

Sanger sequencing results

The Lr46/Yr29 region described in Cobo et al. [29] contains as many as four copies of the RECEPTOR-LIKE PROTEIN KINASE (RLK) gene and three copies of GLUCAN ENDO-1,3-BETA-GLUCOSIDASES (Glu) genes, and one copy each of the SORTING NEXIN (Snex) and the WRKY TRANSCRIPTION FACTOR (WRKY). The RLK and Glu genes occur in up to hundreds of copies throughout the wheat genome (https://www.ncbi.nlm.nih.gov/datasets/genome/GCF_018294505.1/, https://plants.ensembl.org/Triticum_aestivum/Info/Index). In addition, very similar gene arrangements are found on the two homoeologous chromosomes 1A and 1D in the same region as on 1B (Fig 1). Sequence similarity analysis of the Lr46-Glu3 amplicon after Sanger sequencing also revealed the presence of copies on chromosomes 2A, 2B, and 2D. Therefore, a comparison was made of only those few copies of genes found in the region described, on chromosome 1B. These genes are highly differentiated, and it was not possible to design universal primers for them. Therefore, specific primers were designed, for each copy of the gene.

10.1371/journal.pone.0309944.g001 Fig 1 Localization of 10 candidate genes for Lr46/Yr29 on chromosome 1B and homologues on wheat chromosomes 1A, 1D, 2A, 2B and 2D.

Candidate genes for Lr46/Yr29, including the QYr.ucw-1BL region, have been highlighted by colors as per their biological functions/family identified in the legend (bottom). The selected candidate gene homologues were selected based on comparative analysis following Sanger sequencing of the obtained amplicons. The position of marker csLV46G22 has also been indicated [29, 55]. ‘Ch1A’ and similar stand for the name of the chromosome and the abbreviation ‘Mb’ next to the scale stands for the Megabase unit referring to the physical length of the chromosomes. The genetic map was constructed using the MG2C_v2.1 tool [56].

Analytical sequencing succeeded in obtaining the sequences for the majority of the target amplicons (Table 3). The full sequences of the obtained amplicons, location, and characterization of candidate genes for the Lr46/Yr29 gene can be found in S1 File. For the first candidate, Lr46-Glu1, the TraesCS1B02G453900.1 sequence was amplified, but with a single nucleotide polymorphism (G) at position 40 compared with the TraesCS1A02G422500.1 sequence (G). For the ‘Glenlea’ cultivar, we observed a C+G at position 40, yielding a comparable level of amplification of TraesCS1B02G453900.1 and TraesCS1A02G422500.1. The Lr46-Glu2 gene in the Artigas* cultivar amplified the TraesCS1A02G422900.1 sequence (with polymorphic A at position 38) and TraesCS1B02G454200.1 (with polymorphic G at position 38) (Fig 1). In the Glenlea cultivar, the exact TraesCS1A02G422900.1 homolog sequence was amplified (Fig 1). We failed to obtain a sequence that could be read correctly for Lr46-RLK1 despite exhaustive attempts. For the Lr46-RLK3, the sequence of TraesCS1B02G454400.1 gene was amplified, with a small level of homolog TraesCS1D02G431000.1 (position 52) (Fig 1). The last candidate gene analyzed using the Sanger method was Lr46-WRKY, for which we obtained an amplicon (118 bp) of the TraesCS1D02G431600.1 gene, thus a homologue of the candidate gene TraesCS1B02G455000.1(Fig 1, Table 3, S1 File).

10.1371/journal.pone.0309944.t003 Table 3 Description of the resulting amplicons and candidate genes for Lr46/Yr29 by Sanger sequencing.

Candidate gene abbreviation	Gene ID	Fragment length (bp)	Gene length (bp)	Amplified region (bp)	Gene symbol	UniProt accession	
Lr46-Glu1	TraesCS1B02G453900.1	102	1722	308–410	LOC123100246	A0A3B5Z521	
Lr46-Glu2	TraesCS1B02G454200.1	103	2529	677–779	LOC123148549	A0A3B5Z537	
Lr46-Glu3	TraesCS1B02G454500.1	99	1968	635–733	LOC123100285	A0A3B5Z6G2	
Lr46-RLK1	TraesCS1B02G454000.2	105	-	-	-	-	
Lr46-RLK2	TraesCS1B02G454100.1	114	2526	1935–2047	LOC123148523	A0A3B5Z656	
Lr46-RLK3	TraesCS1B02G454400.1	109	2217	1419–1527	LOC123100274	A0A3B5Z530	
Lr46-RLK4	TraesCS1B02G454600.1	101	2514	1959–2041	LOC123148523	A0A3B5Z5H2	
Lr46-Snex	TraesCS1B02G453700.1	103	3742	278–380	LOC123148452	A0A3B5Z651	
Lr46-WRKY	TraesCS1D02G431600.1	118	1226	906–1024	LOC123100317	A0A3B6A1Y2	

Expression of candidate genes in analyzed varieties at different time-points (hpi)

The qRT-PCR analyses of candidate genes in all studied wheat cultivars and at different time points are summarized as heatmap graphs (Fig 2). The raw data obtained from candidate gene expression analyses for Lr46/Yr29 are presented in S1 Table. The elemental contrast values of the candidate genes tested are shown in S2 Table. Regarding the gene Lr46-Glu1, its expression varied greatly among the analyzed wheat cultivars as well as among the time points, therefore we did not observe any major common expression pattern (Fig 2). A decrease in the expression level of Lr46-Glu2 gene was observed immediately after inoculation (6 hpi) for all cultivars except Glenlea. At 12 hpi, a further decrease in Lr46-Glu2 expression levels was observed for all resistant cultivars (Fig 2). The inflection point occurred at 24 hpi when the defense response was activated for all cultivars. The expression level of Lr46-Glu2 far exceeded the baseline level (0 hpi). At 48 hpi, the expression level of Lr46-Glu2 decreased in all cultivars but still exceeded the baseline in Artigas, Glenlea, Lerma Rojo, and TX89D6435 cultivars. For the Lr46-Glu3 gene, expression before as well as after inoculation was at very low levels (Fig 2). The only exception was the Glenlea cultivar at 24 hpi, where gene expression increased significantly. In the genes Lr46-RLK1 and Lr46-RLK2, the observed expression increased at 6 hpi, shortly after inoculation, then decreased at 12 hpi, and we observed a renewed increase at 24 hpi. The highest expression levels at 6 hpi and 24 hpi, were observed in the NP846 cultivar and at 6 hpi in the ‘Glenlea’ (Fig 2). For Lr46-RLK3, the highest increases in expression after inoculation were observed in the cultivars TX89D6435 and NP946 at 24 hpi; whereas, in ‘Glenlea’ at 6 hpi and 24 hpi. However, this gene was expressed at relatively low levels (Fig 2). A special case is the expression of the Lr46-RLK4 gene, whose highest expression values were observed in the Artigas* cultivar, in which, according to our team’s study, no molecular markers associated with the resistance conferred by Lr34, Lr46, or Lr67 were identified [20, 40]. Expression of the Lr46-RLK4 gene in the Artigas* cultivar was very high already before inoculation at 0 hpi (Fig 2). The Lr46-Snex gene showed low expression with two exceptions: at 12 hpi in the Artigas* cultivar and at 24 hpi in ‘Glenlea’ (Fig 2). In the Lr46-WRKY gene, we observed the highest values in ‘Artigas*’ at all time points except 48 hpi and in the Glenlea cultivar at 24 hpi (Fig 2). The qRT-PCR analyses of the Lr46-STr gene obtained many non-specific PCR products, which was particularly evident in the melt curve; as such, we decided to discard this gene’s data from further analyses (Table 2).

10.1371/journal.pone.0309944.g002 Fig 2 Expression heatmap of the nine Lr46/Yr29 candidate genes in leaf tissues under Puccinia triticina infection.

The graphs were generated based on the elemental contrasts carried out for each cultivar independently, and separately for each candidate gene. Tukey’s HSD test post ANOVA was carried out and the groups are shown on the heatmap as various letters, for statistically different groups at α = 0.05. Groups indicated on the heatmap denote significant interaction of cultivar × time point (hpi), whereas groups along horizontal axis (time points [hpi]) and/or vertical axis (cultivars) denote significance for single factors but not their interaction. The evaluation included reference cultivars of common wheat (Artigas*, Artigas, Glenlea, Lerma Rojo, TX89D6435, and NP846) indicated at the vertical axes at various time points (0, 6, 12, 24, and 48 hpi) identified at horizontal axes. Red indicates lower normalized expression and yellow—higher expression.

A two-way analysis of variance (ANOVA) was performed and identified the differences in the individual expression profiles of the analyzed genes for the cultivars at specific time points (Table 4). An additional source of variation was the cultivar × time point interaction. As each gene has a specific expression level, the analysis of variance was performed for each gene separately (Table 4). Cultivars exhibited unique patterns of gene expression in response to Pt infection. For example, ’Glenlea’ showed particularly high expression levels for several genes at 24 hpi, whereas ’Lerma Rojo’ exhibited relatively low expression levels across the majority of analyzed time points (S1 Table; Fig 2). For the majority of the Lr46/Yr29 candidate genes, their expression significantly varied in time across the analyzed cultivars. Each gene responded differently to pathogen infection and varied in its expression levels across cultivars and time points. Notably, Lr46-Glu2 consistently showed high expression levels across all cultivars and time points, indicating its potential importance in the defense response against Pt. For the Lr46-Glu2 gene, we obtained comparably the highest values of mean squares compared to the other candidate genes (Table 4). The results obtained may thus suggest that the Lr46-Glu2 gene harbors a special role in the Pt resistance response. In contrast, Lr46-Snex showed relatively low expression levels compared to other genes and exhibited variation across the analyzed time points but not among the cultivars. The analysis across the candidate genes for Lr46/Yr29 revealed significant effects of both cultivar and time on gene expression in wheat. Notably, the susceptible cultivar Artigas* consistently exhibited lower expression levels compared to the resistant cultivars for various analyzed genes, which indicated its distinct gene expression profile under the Pt stress. For several analyzed genes, including Lr46-Glu1 and Lr46-Glu2, significant interactions between cultivar and time underscored the dynamic nature of gene expression in response to temporal factors and genetic variation. Post-hoc analysis further elucidated these findings and revealed distinct expression patterns among wheat cultivars across different time points (Fig 2). Resistant cultivars often exhibited comparatively higher expression levels compared to the susceptible control cultivar, thus emphasizing their potential role in mediating wheat’s defense response against Pt.

10.1371/journal.pone.0309944.t004 Table 4 Mean squares from two-way analysis of variance (ANOVA) for the individual expression profiles of the analyzed genes of candidate genes for Lr46/Yr29.

Source of variation	Cultivar	Time point	Cultivar × time point interaction	Residual DF	Residual	
Degrees of freedom
(DF)	5	4	20	(variable)	50	
Lr46-Glu1	38.87 ***	34.65***	13.98*	59	6.35	
Lr46-Glu2	93.29***	126.35***	17.02*	60	9.3	
Lr46-Glu3	0.8425**	1.791***	0.717***	60	0.24	
Lr46-RLK1	0.031***	0.028***	0.009***	59	0.002	
Lr46-RLK2	0.034***	0.025***	0.006ns	52	0.004	
Lr46-RLK3	6.629***	8.579***	2.164***	59	0.746	
Lr46-RLK4	0.106***	0.002ns	0.006ns	57	0.009	
Lr46-Snex	0.913**	0.682*	0.478*	60	0.26	
Lr46-WRKY	0.082***	0.035*	0.011ns	48	0.01	
*, **, ***–significant at 0.05, 0.01, 0.001 levels, respectively;

ns–not significant

A comparison of expression profiles between genes was also attempted by correlation analysis (Fig 3). Among the candidate genes tested, the highest positive correlation was observed for the expression profile between candidate genes: Lr46-Glu2 and Lr46-RLK2 (0.794; p < 0.001) (Fig 3). There was also a positive correlation for the Lr46-Glu1 gene between the genes: Lr46-Glu2, Lr46-RLK1, Lr46-RLK2 and Lr46-RLK3, where there were high correlations between the Lr46-Glu1 gene and the genes: Lr46-Glu2 and Lr46-RLK3 (0.726 and 0.730, respectively; p < 0.001) (Fig 3). The Lr46-Glu2 gene showed positive correlations (p < 0.001) with the other candidate genes tested except for genes: Lr46-RLK4, Lr46-Snex, and Lr46-WRKY, where the correlation was close to 0 with p > 0.05 (Fig 3). The Lr46-Glu3 gene showed a positive and statistically significant correlations with the majority of candidate genes except Lr46-RLK1 and Lr46-RLK2 (0.108 and 0.093, respectively, not statistically significant). Interestingly, for the genes: Lr46-RLK1, Lr46-RLK2, and Lr46-RLK3, we observed a general presence of correlation with Glu or RLK candidate genes, but general absence of correlation with other candidate genes (Fig 3). However, a distinct trend was observed for Lr46-RLK4, where we observed correlations with only two genes: Lr46-Snex and Lr46-WRKY (0.495 and 0.702, respectively; p < 0.001). Interestingly, there was a tendency between the Lr46-RLK4, Lr46-Snex, and Lr46-WKRY genes to correlate with each other (Fig 3). The exception is Lr46-Snex, where there is a high correlation also between the Lr46-Glu3 gene (0.735, p < 0.001).

10.1371/journal.pone.0309944.g003 Fig 3 Heat maps of Pearson’s linear pairwise correlation coefficients between the observed candidate genes for Lr46/Yr29 based on the values of their individual expression profiles.

Significance of pairwise correlations is marked: * p < 0.05, ** p < 0.01, *** p < 0.001. Heatmap color scheme (labeled at the bottom) informs of more positive (red hue) or negative (blue hue) correlations.

Expression of miRNAs complementary to target candidate genes

Using stem-loop RT-PCR and ddPCR, we performed expression analysis of miRNAs selected from databases as complementary to several candidate genes for Lr46/Yr29. Contrast analysis was performed for the expression data of miRNAs, and the resulting elemental contrast values for the expression of miRNAs complementary to the candidate genes can be found in S3 Table. We compared the expression results of the candidate genes with the respective values for the miRNAs complementary to them. According to the databases, tae-miR9780 is complementary to two candidate genes, Lr46-Glu2 (TraesCS1B02G454200.1) and Lr46-RLK2 (TraesCS1B02G454100.1). Towards the Lr46-Glu2 gene, tae-miR9775 is also complementary. Unfortunately, the expression of tae-miR9775 was at a low level and did not allow for confident inferences. In the Lr46-Glu2 gene, we analyzed the expression of two miRNAs: tae-miR9780 and tae-miR5384-3p. The expression of tae-miR9780 in the majority of the tested wheat cultivars was at a constant level, both before and after inoculation. The exceptions were the TX89D6435 and Lerma Rojo cultivars where values higher than at 0 hpi were observed (Fig 4). Especially for the TX89D6435 cultivar, the results suggested an up-regulation. The tae-miR5384-3p expression showed fairly constant expression levels at all time points. Here, again in the Lerma Rojo cultivar, the miRNA was expressed with values higher than at 0 hpi. At 6 hpi, expression increased with the Lr46-Glu2 gene, whereas it decreased slightly at 12 hpi with a large increase in its complementary candidate gene expression. On the other hand, at 24 hpi, tae-miR5384-3p expression increased again together with an increase in its complementary candidate gene, whereas at 48 hpi we observed a large decrease in Lr46-Glu2 expression together with an increase in tae-miR5384-3p (Fig 4). In the case Lr46-RLK2, to which tae-miR9780 is also complementary, relationships similar to those of Lr46-Glu2 were observed. The expression of both Lr46-RLK2 and tae-miR9780 showed very low values (Fig 5). In contrast, tae-miR164, which is complementary to the candidate gene Lr46-RLK3 (TraesCS1B02G454400.1), showed differential expression at pre- and post-inoculation. The expression of the Lr46-RLK3 gene and its complementary tae-miR164 is shown in Fig 6 and suggests that tae-miR164 is a molecule that may be down-regulating its target gene’s expression. In the majority of the tested wheat cultivars, when candidate gene expression increased, then tae-miR164 was down-regulated, and vice versa: when miRNA expression increased then candidate gene expression was down-regulated (Fig 6).

10.1371/journal.pone.0309944.g004 Fig 4 Analysis of complementary miRNAs expression compared to Lr46-Glu2 expression patterns during Puccinia triticina infection.

The numbers 6, 12, 24, and 48 stand for hours post inoculation (hpi). The graphs show relative expression values compared to the 0 hpi time point. The error bars indicate the standard error (SE). Data were obtained from the average of three biological replicates, and each biological replicate had three technical replicates, according to the MIQUE protocol.

10.1371/journal.pone.0309944.g005 Fig 5 Analysis of complementary miRNA expression compared to Lr46-RLK2 expression patterns during Puccinia triticina infection.

The numbers 6, 12, 24 and 48 stand for hours post inoculation (hpi). The graphs show relative expression values compared to the 0 hpi time point. The error bars indicate the standard error (SE). Data were obtained from the average of three biological replicates, and each biological replicate had three technical replicates, according to the MIQUE protocol.

10.1371/journal.pone.0309944.g006 Fig 6 Analysis of complementary miRNA expression compared to Lr46-RLK3 expression patterns during Puccinia triticina infection.

The numbers 6, 12, 24 and 48 stand for hours post inoculation (hpi). The graphs show relative expression values compared to the 0 hpi time point. The error bars indicate the standard error (SE). Data were obtained from the average of three biological replicates, and each biological replicate had three technical replicates, according to the MIQUE protocol.

Discussion

In this study, we attempted to analyze the expression of candidate genes for the Lr46/Yr29 locus—selected region of QYr.ucw-1BL [29]—after inoculation with the fungus P. triticina under controlled conditions. Our research hypothesis recognizes that a single causal gene is responsible for the desirable APR-type Pt resistance; however, we cannot exclude the alternative hypothesis of a cluster of closely linked resistance genes, each effective against different pathogen(s). Although cloning of these genes would be necessary to provide a conclusive test for this hypothesis, determining the ability of the QYr.ucw-1BL region to confer APR against leaf rust, stem rust, and powdery mildew pathogens could provide valuable information to experimentally validate this hypothesis. We functionally examined the candidate genes and most of them were potentially related to plant defense, making it difficult to identify the actual causal gene for Lr46/Yr29/Sr58. We were able to analyze the expression profiles for nine out of ten candidate genes encompassed by that locus at five time points (0, 6, 12, 24, and 48 hpi): TraesCS1B02G453900.1, TraesCS1B02G454200.1, TraesCS1B02G454500.1, TraesCS1B02G454000.2, TraesCS1B02G454100.1, TraesCS1B02G454400.1, TraesCS1B02G454600.1, TraesCS1B02G453700.1, and TraesCS1B02G455000.1. Consistent with our research assumption, the highest expression of Lr46/Yr29 candidate genes occurred at 12 and 24 hpi, as confirmed by literature data for the Lr genes [57, 58]. Such an expression profile was obtained for only one candidate gene among the nine studied candidate genes (TraesCS1B02G454200.1; gene abbreviation Lr46-Glu2), which may suggest its involvement in the immune response mechanisms to Pt infection. Future studies will address this gene’s functional validation by gene knockout or overexpression studies, to confirm its role in Pt resistance. Similarly, future integration of transcriptomic, proteomic, and metabolomic data could provide a more comprehensive understanding of the molecular mechanisms underlying resistance to Pt. Multi-omics approaches enable the identification of key pathways and regulatory networks involved in the defense response, offering novel targets for genetic improvement [59]. Our study explored the expression patterns across various wheat cultivars, whereas their genetic background and specific resistance mechanisms are not thoroughly known. Investigating the genetic diversity and evolutionary history of these cultivars could provide context for interpreting the observed gene expression patterns. For example, future investigations of the genomic context and copy number variation of candidate genes could elucidate their evolutionary history and functional significance in relation to resistance or other desirable phenotypes.

The study by Prasad et al. [5] meta-analyzed 298 major scientific reports on mechanisms of plant resistance to fungal pathogens, including Pt. The authors indicated that the continued search for diverse and durable resistance to Pt must be pursued using advanced tools and techniques, including molecular methods. Understanding the molecular basis of plant-pathogen interactions will enable the development of new strategies for Pt resistance in common wheat. To date, information on the cloning of the following Lr genes has been reported in the literature: Lr1, Lr10, Lr21, Lr22a, Lr34/Yr18/Pm38/Sr57, and Lr67/Yr46/Pm46/Sr55 [5, 21, 60–63]. Despite tangible progress in comprehending the molecular basis of Pt resistance, the role of miRNAs in modulating gene expression has only been studied for a few major R genes, which included Lr24, Lr28, and Sr24 [35, 39, 64, 65]. miRNAs have been shown to perform important roles as negative regulators through repression of translation or degradation of host and/or pathogen target mRNAs [32, 66]. In common wheat, although the role of miRNAs in pathogen resistance has been analyzed, including resistance to Pt involving the Lr46/Yr29 gene [50], very few similar studies have been conducted for genes that confer the APR-type of resistance.

The qRT-PCR method is an irreplaceable tool for the amplification, identification, and quantification of nucleic acids. The technique is distinguished by its ability to detect genes and measure gene expression quantitatively and specifically. qRT-PCR is a valued method for both research and diagnostic applications. Cobo et al. [29] highlighted the need to examine the expression in different host plant genotypes with and without pathogen inoculation to determine whether there are differences in candidate gene expression associated with differences in immunity. In the presented study, we report the results of candidate gene expression analyses for Lr46/Yr29. Except for the Lr46-RLK2, Lr46-RLK4, and Lr46-WRKY genes, ANOVA indicated interactions in the expression profiles for the remaining six genes between the analyzed wheat cultivars and the time points. In the candidate gene region, three genes have been identified as GLUCAN ENDO-1,3-BETA-GLUCOSIDASES (TraesCS1B02G453900.1, TraesCS1B02G454200.1, TraesCS1B02G454500.1) [29]. These genes are found in many seed plant species and are involved in plant defense against pathogens, and their expression is often dramatically induced when plants are infected by fungal, bacterial, or viral pathogens [29, 67]. Glucan endo-1,3-β-glucosidases (β-1,3-glucanases) are one of the important hydrolytic enzymes among the pathogenesis-related proteins (PR proteins) that are abundant in many plant species after infection with different types of pathogens [68, 69]. A single plant species may have various homologues of the glucano-1,3-β-glucosidase genes, important for retarding the growth of pathogenic fungi by the decomposition of their cell walls which contain β-glucans. Glucan endo-1,3-β-glucosidase appears to be overexpressed together with chitinases after fungal infection. The induction of these two hydrolytic enzymes has been described in a number of plant species, including pea, bean, tomato, tobacco, maize, soybean, potato, and wheat [67–72]. Notably, an increase in levels of glucan endo-1,3-β-glucosidase was observed during drought stress [73].

Many RECEPTOR-LIKE PROTEIN KINASE (RLK) gene families can be found in plants. RLKs are membrane proteins located in the extracellular domain of the plant reception networks and are involved in both biotic and abiotic stress responses. The extracellular ligand-binding domain, the transmembrane domain, and the intracellular protein kinase domain are typical components of RLKs. The extracellular domain, which is specific to individual RLKs, binds a particular ligand and allows RLKs to respond to different types of signals. Among the RLKs, variants such as leucine-rich repeats, lectin, lysine motif, or wall-associated kinases are distinguished [74, 75]. RLKs make up the largest known family of protein kinases that are important in the plant response to pathogen infection. Gu et al. [74] discovered a new cysteine-rich RLK gene, TaCRK2, which positively regulated resistance to infection caused by Pt in wheat. In our study, four of the candidate genes are RLKs (Lr46-RLK1, Lr46-RLK2, Lr46-RLK3, and Lr46-RLK4) and encode proteins important for the recognition of extracellular signals and the initiation of intracellular signaling cascades in reaction to those stimuli [76]. The RLKs in the Lr46/Yr29 locus encode proteins with two extracellular domains that are characteristic of the subgroup of CYSTEINE-RICH RECEPTOR KINASES. [29]. It has been proposed that members of this sub-group may be involved in redox signaling [77]. In a recent study [78], researchers investigated differential gene expression under Pt stress, which was analyzed in a close isogenic line carrying the leaf rust resistance gene Lr57. The highest number of transcripts undergoing expression was detected at 12 hpi. Interestingly, among these transcripts, a cysteine-rich RLKs expressed only in the resistant genotypes at 12 hpi.

The WRKY family represents another group of transcription factors important in regulating plant responses to stress factors. In Arabidospis, overexpression of WRKY63/ABO3 [79] and WRKY57 [80] resulted in increased drought stress tolerance in an ABA-dependent manner. Numerous data indicate that overexpression of genes encoding proteins belonging to the WRKY family also increases dehydration tolerance in crop species [81–83]. Many research papers have described WRKY gene family in crops, including rice (Oryza sativa), maize (Zea mays), sorghum (Sorghum bicolor), and cabbage (Brassica rapa) [76, 84, 85].

Another method that allows expression analysis is ddPCR (droplet digital PCR), referred to as the third-generation PCR method. This technique is characterized by high sensitivity and precision in amplicon detection. The system exclusively reads the target molecules as positive and all others as negative, based on which the number of target molecules in the sample is calculated, without the need to refer to standard curves or a reference gene (in contrast to the qRT-PCR method) [86]. In our work, ddPCR was used to analyze the expression of miRNA molecules: tae-miR5384-3p, tae-miR9780, tae-miR9775, and tae-miR164. Previous sequence analysis revealed the involvement of tae-miR5384-3p (as well as tae-miR164 and tae-miR9679-5p) in targeting the TaAFB6 gene (TraesCS5A02G281100), which encodes the AUXIN SIGNALING F-BOX (AFB) protein [87]. This suggested the possibility of post-transcriptional regulation of TaAFB-type gene expression. In that study, researchers analyzed the expression of genes of selected AFBs for this purpose by carrying out inoculation with spores of Pt taking wheat leaf fragments at five time points (0, 12, 48, 120, and 168 hpi) [87]. The fraction of AFB genes analyzed showed the highest expression at 12 and 48 hpi in both susceptible and resistant isogenic wheat lines. All known TaAFB-type genes are involved in the auxin-activated signaling pathway that results in the ubiquitination process [87].

The tae-miR5384-3p can inhibit a number of genes in the TaFAB2 subfamily, which are associated with the formation of unsaturated fatty acids that play an important role in plant development and in response to biotic and abiotic stresses [88]. In contrast, tae-miR5384-3p showed a very high increase in expression after treating wheat seedlings with a chitosan suspension [89]. The type of fluctuating relative expression profiles is commonly observed for small RNA sequencing or qPCR-based miRNA expression analysis under different biotic and abiotic stress conditions [90]. Such a phenomenon may relate to changing defense mechanisms in the early and late stages of the plant response. A recent study [91] used computational methods to investigate the interaction between the wheat miRNA transcriptome and mosaic viruses in wheat. In wheat streak mosaic virus (WSMV) and wheat mosaic virus (TriMV) infections, three miRNAs (including tae-miR5384-3p) were among the most up-regulated miRNAs. This may suggest the involvement of this miRNA in the overall immune response in wheat.

The miR164 family is one of the most conserved groups of miRNAs in plants [92]. One miRNA molecule can control multiple target genes, similar to plant transcription factors. Previous studies have shown that miR164 targets plant-specific NAC transcription factors [93]. The majority of NACs play an essential role in the regulation of plant development and the response to abiotic and biotic stresses. The functions of miR164 have been associated with plant responses to biotic stresses. The main function attributed to miR164 is to regulate transcript levels of relevant genes [92, 94, 95]. This miRNA also targets Lr46-RLK3 candidate gene. In our study, in the majority of tested wheat cultivars, when candidate gene expression increased, tae-miR164 was down-regulated, and vice versa: when miRNA expression increased, the candidate gene expression values were down-regulated. The decrease in tae-miR164 may be related to the activation of Lr46-RLK3 gene-dependent immune mechanisms, observed as a rapid gene response to the pathogen. Moreover, we observed similar relationships in our previous work on tae-miR164 [50]. Exploring the regulatory networks involving miRNAs and their target genes in the future could uncover additional layers of complexity in the defense responses of wheat to Pt.

Conclusions

In this study, we tracked down the desirable APR-type Pt resistance in wheat conferred by a single gene(s). Our qRT-PCR experiment successfully studied the expression of nine analyzed candidate genes encompassed by the Lr46/Yr29 locus, except the candidate gene Lr46-STr. Among these genes, the least differential expression profile was observed for the candidate gene Lr46-Glu2, with an increase in its expression after 24 hours, which may suggest activation of the defense response in all resistant cultivars. The expression level of Lr46-Glu2 far exceeded the pre-inoculation baseline. After 48 hpi, the expression level of Lr46-Glu2 declined in all cultivars but in cultivars Artigas, Glenlea, Lerma Rojo, and TX89D6435 it still exceeded the pre-inoculation baseline. The possibility that the expression of the candidate gene Lr46-Glu2 was controlled by tae-miR5384-3p was observed: For the cultivars Glenlea and NP846 at all time points at which the expression of this gene increases, the expression of its complementary tae-miR5384-3p decreases. Conversely, when the expression of Lr46-Glu2 decreased, the expression of tae-miR5384-3p increased. For other cultivars, similar patterns were observed only at specific time points: Artigas (6 hpi), Lerma Rojo (12 hpi), and TX89D6435 (6 hpi and 12 hpi). Our research highlights the need to understand the molecular basis of plant-pathogen interactions, and this will enable the development of new strategies for Pt resistance. Cloning and functional analyses of the Lr46/Yr29 locus are essential to determine the allelic variation of the gene(s) and to establish their function(s). Obtaining more information and knowing the gene sequence that confers Pt resistance would enable the development of more specific molecular markers for Lr46/Yr29, which would facilitate line selection in wheat resistance breeding.

Supporting information

S1 File Characterization of the obtained amplicons (candidate genes for Lr46/Yr29) by Sanger sequencing.

(PDF)

S1 Table Expression of the nine Lr46/Yr29 candidate genes in leaf tissues under Puccinia triticina infection.

(PDF)

S2 Table Elemental contrast values for candidate genes expression.

The table shows the elemental contrasts for each cultivar independently in order to compare mean expression at each time point tested after inoculation to expression before inoculation.

(PDF)

S3 Table Elemental contrast values for expression of miRNA molecules complementary to candidate genes.

The table shows the elemental contrasts for each cultivar independently to compare the average expression at each time point tested after inoculation with the expression before inoculation.

(PDF)
==== Refs
References

1 Ahmar S , Gill RA , Jung K-H , Faheem A , Qasim MU , Mubeen M , et al . Conventional and molecular techniques from simple breeding to speed breeding in crop plants: Recent advances and future outlook. International Journal of Molecular Sciences. 2020;21 (7 ):2590. doi: 10.3390/ijms21072590 32276445
2 Bokore FE , Cuthbert RD , Knox RE , Hiebert CW , Pozniak CJ , Berraies S , et al . Genetic mapping of leaf rust (Puccinia triticina Eriks) resistance genes in six Canadian spring wheat cultivars. Frontiers in Plant Science. 2023;14 :1130768. doi: 10.3389/fpls.2023.1130768 37021307
3 Walkowiak S , Gao L , Monat C , Haberer G , Kassa MT , Brinton J , et al . Multiple wheat genomes reveal global variation in modern breeding. Nature. 2020;588 (7837 ):277–83. doi: 10.1038/s41586-020-2961-x 33239791
4 Ellis JG , Lagudah ES , Spielmeyer W , Dodds PN . The past, present and future of breeding rust resistant wheat. Frontiers in plant science. 2014;5 :641. doi: 10.3389/fpls.2014.00641 25505474
5 Prasad P , Savadi S , Bhardwaj S , Gupta P . The progress of leaf rust research in wheat. Fungal Biology. 2020;124 (6 ):537–50. doi: 10.1016/j.funbio.2020.02.013 32448445
6 Kolmer J , Lagudah E , Lillemo M , Lin M , Bai G . The Lr46 gene conditions partial adult‐plant resistance to stripe rust, stem rust, and powdery mildew in Thatcher wheat. Crop Science. 2015;55 (6 ):2557–65. doi: 10.2135/cropsci2015.02.0082
7 Raza A , Razzaq A , Mehmood SS , Zou X , Zhang X , Lv Y , et al . Impact of climate change on crops adaptation and strategies to tackle its outcome: A review. Plants. 2019;8 (2 ):34. doi: 10.3390/plants8020034 30704089
8 Petersen G , Seberg O , Yde M , Berthelsen K . Phylogenetic relationships of Triticum and Aegilops and evidence for the origin of the A, B, and D genomes of common wheat (Triticum aestivum). Molecular Phylogenetics and Evolution. 2006;39 (1 ):70–82. doi: 10.1016/j.ympev.2006.01.023 16504543
9 Alonge M , Shumate A , Puiu D , Zimin AV , Salzberg SL . Chromosome-scale assembly of the bread wheat genome reveals thousands of additional gene copies. Genetics. 2020;216 (2 ):599–608. doi: 10.1534/genetics.120.303501 32796007
10 Juery C , Concia L , De Oliveira R , Papon N , Ramírez‐González R , Benhamed M , et al . New insights into homoeologous copy number variations in the hexaploid wheat genome. The Plant Genome. 2021;14 (1 ):e20069. doi: 10.1002/tpg2.20069 33155760
11 Kumar S , Bhardwaj SC , Gangwar OP , Sharma A , Qureshi N , Kumaran VV , et al . Lr80: A new and widely effective source of leaf rust resistance of wheat for enhancing diversity of resistance among modern cultivars. Theoretical and Applied Genetics. 2021;134 :849–58. doi: 10.1007/s00122-020-03735-5 33388887
12 Qureshi N , Bariana H , Kumran VV , Muruga S , Forrest KL , Hayden MJ , et al . A new leaf rust resistance gene Lr79 mapped in chromosome 3BL from the durum wheat landrace Aus26582. Theoretical and Applied Genetics. 2018;131 :1091–8. doi: 10.1007/s00122-018-3060-3 29396589
13 Li H , Hua L , Zhao S , Hao M , Song R , Pang S , et al . Cloning of the wheat leaf rust resistance gene Lr47 introgressed from Aegilops speltoides. Nature Communications. 2023;14 (1 ):6072.: doi: 10.1038/s41467-023-41833-2 37770474
14 Krattinger SG , Kang J , Bräunlich S , Boni R , Chauhan H , Selter LL , et al . Abscisic acid is a substrate of the ABC transporter encoded by the durable wheat disease resistance gene Lr34. New Phytologist. 2019;223 (2 ):853–66. doi: 10.1111/nph.15815 30913300
15 Cloutier S , Reimer E , Khadka B , McCallum BD . Variations in exons 11 and 12 of the multi-pest resistance wheat gene Lr34 are independently additive for leaf rust resistance. Frontiers in Plant Science. 2023;13 :1061490. doi: 10.3389/fpls.2022.1061490 36910459
16 Herrera-Foessel SA , Singh RP , Huerta-Espino J , Rosewarne GM , Periyannan SK , Viccars L , et al . Lr68: a new gene conferring slow rusting resistance to leaf rust in wheat. Theoretical and Applied Genetics. 2012;124 :1475–86. doi: 10.1007/s00122-012-1802-1 22297565
17 Reynolds MP , Braun H-J . Wheat improvement: food security in a changing climate. Braun MPRaH-J , editor. Cham: Springer International Publishing; 2022.
18 Vikas V , Pradhan AK , Budhlakoti N , Mishra DC , Chandra T , Bhardwaj S , et al . Multi-locus genome-wide association studies (ML-GWAS) reveal novel genomic regions associated with seedling and adult plant stage leaf rust resistance in bread wheat (Triticum aestivum L.). Heredity. 2022;128 (6 ):434–49. doi: 10.1038/s41437-022-00525-1 35418669
19 Ye B , Singh RP , Yuan C , Liu D , Randhawa MS , Huerta-Espino J , et al . Three co-located resistance genes confer resistance to leaf rust and stripe rust in wheat variety Borlaug 100. The Crop Journal. 2022;10 (2 ):490–7. doi: 10.1016/j.cj.2021.07.004
20 Bobrowska R , Noweiska A , Spychała J , Tomkowiak A , Nawracała J , Kwiatek MT . Diagnostic accuracy of genetic markers for identification of the Lr46/Yr29 “slow rusting” locus in wheat (Triticum aestivum L.). Biomolecular Concepts. 2022;13 (1 ):1–9. doi: 10.1515/bmc-2022-0002 35212495
21 Krattinger SG , Lagudah ES , Spielmeyer W , Singh RP , Huerta-Espino J , McFadden H , et al . A putative ABC transporter confers durable resistance to multiple fungal pathogens in wheat. Science. 2009;323 (5919 ):1360–3. doi: 10.1126/science.1166453 19229000
22 Kumar S , Singh RP , Joshi AK , Röder MS , Chhuneja P , Mavi GS , et al . Association of Lr34 gene complex with spot blotch disease resistance at molecular level in wheat (Triticum aestivum L.). INDIAN JOURNAL OF GENETICS AND PLANT BREEDING. 2018;78 (03 ):302–8. doi: 10.31742/IJGPB.78.3.11
23 Lagudah ES , Krattinger SG , Herrera-Foessel S , Singh RP , Huerta-Espino J , Spielmeyer W , et al . Gene-specific markers for the wheat gene Lr34/Yr18/Pm38 which confers resistance to multiple fungal pathogens. Theoretical and Applied Genetics. 2009;119 :889–98.: doi: 10.1007/s00122-009-1097-z 19578829
24 Lillemo M , Asalf B , Singh R , Huerta-Espino J , Chen X , He Z , et al . The adult plant rust resistance loci Lr34/Yr18 and Lr46/Yr29 are important determinants of partial resistance to powdery mildew in bread wheat line Saar. Theoretical and Applied Genetics. 2008;116 :1155–66. doi: 10.1007/s00122-008-0743-1 18347772
25 Aktar-Uz-Zaman M , Tuhina-Khatun M , Hanafi MM , Sahebi M . Genetic analysis of rust resistance genes in global wheat cultivars: An overview. Biotechnology & Biotechnological Equipment. 2017;31 (3 ):431–45. doi: 10.1080/13102818.2017.1304180
26 Bokore FE , Knox RE , Hiebert CW , Cuthbert RD , DePauw RM , Meyer B , et al . A combination of leaf rust resistance genes, including Lr34 and Lr46, is the key to the durable resistance of the Canadian wheat cultivar, Carberry. Frontiers in plant science. 2022;12 :775383. doi: 10.3389/fpls.2021.775383 35069630
27 Lillemo M , Joshi AK , Prasad R , Chand R , Singh RP . QTL for spot blotch resistance in bread wheat line Saar co-locate to the biotrophic disease resistance loci Lr34 and Lr46. Theoretical and applied genetics. 2013;126 :711–9. doi: 10.1007/s00122-012-2012-6 23139144
28 William M , Singh R , Huerta-Espino J , Islas SO , Hoisington D . Molecular marker mapping of leaf rust resistance gene Lr46 and its association with stripe rust resistance gene Yr29 in wheat. Phytopathology. 2003;93 (2 ):153–9. doi: 10.1094/PHYTO.2003.93.2.153 18943129
29 Cobo N , Wanjugi H , Lagudah E , Dubcovsky J . A high‐resolution map of wheat QYr. ucw‐1BL, an adult plant stripe rust resistance locus in the same chromosomal region as Yr29. The plant genome. 2019;12 (1 ):180055. doi: 10.3835/plantgenome2018.08.0055 30951084
30 Tong J , Zhao C , Liu D , Jambuthenne DT , Sun M , Dinglasan E , et al . Genome-wide atlas of rust resistance loci in wheat. Theoretical and Applied Genetics. 2024;137 (8 ):179. doi: 10.1007/s00122-024-04689-8 38980436
31 Budak H , Khan Z , Kantar M . History and current status of wheat miRNAs using next-generation sequencing and their roles in development and stress. Briefings in functional genomics. 2015;14 (3 ):189–98. doi: 10.1093/bfgp/elu021 24962995
32 Feng H , Wang B , Zhang Q , Fu Y , Huang L , Wang X , et al . Exploration of microRNAs and their targets engaging in the resistance interaction between wheat and stripe rust. Frontiers in Plant Science. 2015;6 :469. doi: 10.3389/fpls.2015.00469 26175740
33 Inal B , Türktaş M , Eren H , Ilhan E , Okay S , Atak M , et al . Genome-wide fungal stress responsive miRNA expression in wheat. Planta. 2014;240 :1287–98. doi: 10.1007/s00425-014-2153-8 25156489
34 Li Y-F , Wei K , Wang M , Wang L , Cui J , Zhang D , et al . Identification and temporal expression analysis of conserved and novel microRNAs in the leaves of winter wheat grown in the field. Frontiers in Genetics. 2019;10 :779. doi: 10.3389/fgene.2019.00779 31552091
35 Gupta OP , Permar V , Koundal V , Singh UD , Praveen S . MicroRNA regulated defense responses in Triticum aestivum L. during Puccinia graminis f. sp. tritici infection. Molecular Biology Reports. 2012;39 :817–24. doi: 10.1007/s11033-011-0803-5 21633895
36 Budak H , Akpinar BA . Plant miRNAs: Biogenesis, organization and origins. Functional & integrative genomics. 2015;15 :523–31. doi: 10.1007/s10142-015-0451-2 26113396
37 Budak H , Kantar M , Bulut R , Akpinar BA . Stress responsive miRNAs and isomiRs in cereals. Plant science. 2015;235 :1–13. doi: 10.1016/j.plantsci.2015.02.008 25900561
38 Sunkar R , Li Y-F , Jagadeeswaran G . Functions of microRNAs in plant stress responses. Trends in plant science. 2012;17 (4 ):196–203. doi: 10.1016/j.tplants.2012.01.010 22365280
39 Kumar D , Dutta S , Singh D , Prabhu KV , Kumar M , Mukhopadhyay K . Uncovering leaf rust responsive miRNAs in wheat (Triticum aestivum L.) using high-throughput sequencing and prediction of their targets through degradome analysis. Planta. 2017;245 :161–82. doi: 10.1007/s00425-016-2600-9 27699487
40 Spychała J , Tomkowiak A , Noweiska A , Bobrowska R , Bocianowski J , Książkiewicz M , et al . Expression profiling of the slow rusting resistance genes Lr34/Yr18 and Lr67/Yr46 in common wheat (Triticum aestivum L.) and associated miRNAs patterns. Genes. 2023;14 (7 ):1376. doi: 10.3390/genes14071376 37510281
41 Kwiatek MT , Ulaszewski W , Belter J , Phillips D , Skowrońska R , Noweiska A , et al . Development and cytomolecular identification of monosomic alien addition and substitution lines of Triticale (× Triticosecale Wittmack) with 2Sk chromosome conferring leaf rust resistance derived from Aegilops kotschyi Boiss. Frontiers in Plant Science. 2020;11 :509481. doi: 10.3389/fpls.2020.509481 33381128
42 Consortium IWGS, Appels R , Eversole K , Stein N , Feuillet C , Keller B , et al . Shifting the limits in wheat research and breeding using a fully annotated reference genome. Science. 2018;361 (6403 ):eaar7191. doi: 10.1126/science.aar7191 30115783
43 Rychel-Bielska S , Plewiński P , Kozak B , Galek R , Ksia̧żkiewicz M . Photoperiod and vernalization control of flowering-related genes: a case study of the narrow-leafed Lupin (Lupinus angustifolius L.). Frontiers in Plant Science. 2020;11 :572135. doi: 10.3389/fpls.2020.572135 33193508
44 Bustin SA , Benes V , Garson JA , Hellemans J , Huggett J , Kubista M , et al . The MIQE Guidelines: Minimum information for Publication of quantitative Real-Time PCR experiments. Oxford University Press; 2009.
45 Scholtz JJ , Visser B . Reference gene selection for qPCR gene expression analysis of rust-infected wheat. Physiological and Molecular Plant Pathology. 2013;81 :22–5. doi: 10.1016/j.pmpp.2012.10.006
46 Xie L-h , Quan X , Zhang J , Yang Y-y , Sun R-h , Xia M-c , et al . Selection of reference genes for real-time quantitative PCR normalization in the process of Gaeumannomyces graminis var. tritici infecting wheat. The plant pathology journal. 2019;35 (1 ):11. doi: 10.5423/PPJ.OA.03.2018.0038 30828275
47 Kearse M , Moir R , Wilson A , Stones-Havas S , Cheung M , Sturrock S , et al . Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics. 2012;28 (12 ):1647–9. doi: 10.1093/bioinformatics/bts199 22543367
48 Forero DA , González-Giraldo Y , Castro-Vega LJ , Barreto GE . qPCR-based methods for expression analysis of miRNAs. Biotechniques. 2019;67 (4 ):192–9. doi: 10.2144/btn-2019-0065 31560239
49 Kramer MF . Stem‐loop RT‐qPCR for miRNAs. Current protocols in molecular biology. 2011;95 (1 ):15.0. 1–.0. doi: 10.1002/0471142727.mb1510s95 21732315
50 Tomkowiak A , Jędrzejewski T , Spychała J , Kuczyński J , Kwiatek MT , Tyczewska A , et al . Analysis of miRNA expression associated with the Lr46 gene responsible for APR resistance in wheat (Triticum aestivum L.). Journal of Applied Genetics. 2020;61 (4 ):503–11. doi: 10.1007/s13353-020-00573-5 32812165
51 Varkonyi-Gasic E , Wu R , Wood M , Walton EF , Hellens RP . Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods. 2007;3 :1–12. doi: 10.1186/1746-4811-3-12 17207290
52 R CT. R: A language and environment for statistical computing. Vienna, Austrial: R Foundation for Statistical Computing; 2020.
53 de Mendiburu MF. Package ‘agricolae’. R Package, version2019. p. 1143–49.
54 International V. GenStat for Windows. Hemel Hempstead, UK: VSN International; 2023.
55 Ren Y , Singh RP , Basnet B , Lan C , Huerta-Espino J , Lagudah E , et al . Identification and mapping of adult plant resistance loci to leaf rust and stripe rust in common wheat cultivar Kundan. Plant Disease. 2017;101 (3 ):456–63. doi: 10.1094/PDIS-06-16-0890-RE 30677352
56 Chao J , Li Z , Sun Y , Aluko OO , Wu X , Wang Q , et al . MG2C: A user-friendly online tool for drawing genetic maps. Molecular horticulture. 2021;1 :1–4.37789402
57 Casassola A , Brammer SP , Chaves MS , Martinelli JA , Stefanato F , Boyd LA . Changes in gene expression profiles as they relate to the adult plant leaf rust resistance in the wheat cv. Toropi. Physiological and Molecular Plant Pathology. 2015;89 :49–54. doi: 10.1016/j.pmpp.2014.12.004 25892845
58 Milne RJ , Dibley KE , Schnippenkoetter W , Mascher M , Lui AC , Wang L , et al . The wheat Lr67 gene from the sugar transport protein 13 family confers multipathogen resistance in barley. Plant Physiology. 2019;179 (4 ):1285–97. doi: 10.1104/pp.18.00945 30305371
59 Shah T , Xu J , Zou X , Cheng Y , Nasir M , Zhang X . Omics approaches for engineering wheat production under abiotic stresses. International Journal of Molecular Sciences. 2018;19 (8 ):2390. doi: 10.3390/ijms19082390 30110906
60 Cloutier S , McCallum BD , Loutre C , Banks TW , Wicker T , Feuillet C , et al . Leaf rust resistance gene Lr1, isolated from bread wheat (Triticum aestivum L.) is a member of the large psr567 gene family. Plant molecular biology. 2007;65 :93–106. doi: 10.1007/s11103-007-9201-8 17611798
61 Huang L , Brooks SA , Li W , Fellers JP , Trick HN , Gill BS . Map-based cloning of leaf rust resistance gene Lr21 from the large and polyploid genome of bread wheat. Genetics. 2003;164 (2 ):655–64. doi: 10.1093/genetics/164.2.655 12807786
62 Moore JW , Herrera-Foessel S , Lan C , Schnippenkoetter W , Ayliffe M , Huerta-Espino J , et al . A recently evolved hexose transporter variant confers resistance to multiple pathogens in wheat. Nature genetics. 2015;47 (12 ):1494–8. doi: 10.1038/ng.3439 26551671
63 Thind AK , Wicker T , Šimková H , Fossati D , Moullet O , Brabant C , et al . Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly. Nature Biotechnology. 2017;35 (8 ):793–6. doi: 10.1038/nbt.3877 28504667
64 Jain N , Sinha N , Krishna H , Singh PK , Gautam T , Prasad P , et al . A study of miRNAs and lncRNAs during Lr28-mediated resistance against leaf rust in wheat (Triticum aestivum L.). Physiological and Molecular Plant Pathology. 2020;112 :101552. doi: 10.1016/j.pmpp.2020.101552
65 Kumar D , Singh D , Kanodia P , Prabhu KV , Kumar M , Mukhopadhyay K . Discovery of novel leaf rust responsive microRNAs in wheat and prediction of their target genes. Journal of Nucleic Acids. 2014;2014 (1 ):570176. doi: 10.1155/2014/570176 25180085
66 Dutta S , Jha SK , Prabhu KV , Kumar M , Mukhopadhyay K . Leaf rust (Puccinia triticina) mediated RNAi in wheat (Triticum aestivum L.) prompting host susceptibility. Functional & integrative genomics. 2019;19 :437–52. doi: 10.1007/s10142-019-00655-6 30671704
67 Kebede A , Kebede M . In silico analysis of promoter region and regulatory elements of glucan endo-1,3-beta-glucosidase encoding genes in Solanum tuberosum: cultivar DM 1–3 516 R44. Journal of Genetic Engineering and Biotechnology. 2021;19 (1 ):145. doi: 10.1186/s43141-021-00240-0 34591228
68 Cheong YH , Kim CY , Chun HJ , Moon BC , Park HC , Kim JK , et al . Molecular cloning of a soybean class III β-1,3-glucanase gene that is regulated both developmentally and in response to pathogen infection. Plant Science. 2000;154 (1 ):71–81. doi: 10.1016/S0168-9452(00)00187-4 10725560
69 Doxey AC , Yaish MW , Moffatt BA , Griffith M , McConkey BJ . Functional divergence in the Arabidopsis β-1,3-glucanase gene family inferred by phylogenetic reconstruction of expression states. Molecular Biology and Evolution. 2007;24 (4 ):1045–55. doi: 10.1093/molbev/msm024 17272678
70 Bettini P , Cosi E , Pellegrini MG , Turbanti L , Vendramin G , Buiatti M . Modification of competence for in vitro response to Fusarium oxysporum in tomato cells. III. PR-protein gene expression and ethylene evolution in tomato cell lines transgenic for phytohormone-related bacterial genes. Theoretical and applied genetics. 1998;97 :575–83. doi: 10.1007/s001220050933
71 Confortin TC , Spannemberg SS , Todero I , Luft L , Brun T , Alves EA , et al . Microbial enzymes as control agents of diseases and pests in organic agriculture. In: Pandey VKGaA , editor. New and Future Developments in Microbial Biotechnology and Bioengineering. Amsterdam: Elsevier; 2019. p. 321–32.
72 Li W , Faris J , Muthukrishnan S , Liu D , Chen P , Gill B . Isolation and characterization of novel cDNA clones of acidic chitinases and β-1,3-glucanases from wheat spikes infected by Fusarium graminearum. Theoretical and Applied Genetics. 2001;102 :353–62. doi: 10.1007/s001220051653
73 Bernardo L , Morcia C , Carletti P , Ghizzoni R , Badeck FW , Rizza F , et al . Proteomic insight into the mitigation of wheat root drought stress by arbuscular mycorrhizae. Journal of Proteomics. 2017;169 :21–32. doi: 10.1016/j.jprot.2017.03.024 28366879
74 Gu J , Sun J , Liu N , Sun X , Liu C , Wu L , et al . A novel cysteine‐rich receptor‐like kinase gene, TaCRK2, contributes to leaf rust resistance in wheat. Molecular Plant Pathology. 2020;21 (5 ):732–46. doi: 10.1111/mpp.12929 32196909
75 Yan J , Su P , Meng X , Liu P . Phylogeny of the plant receptor-like kinase (RLK) gene family and expression analysis of wheat RLK genes in response to biotic and abiotic stresses. BMC Genomics. 2023;24 (1 ):224. doi: 10.1186/s12864-023-09303-7 37127571
76 Chen F , Hu Y , Vannozzi A , Wu K , Cai H , Qin Y , et al . The WRKY transcription factor family in model plants and crops. Critical Reviews in Plant Sciences. 2017;36 (5–6 ):311–35. doi: 10.1080/07352689.2018.1441103
77 Chen Z. A superfamily of proteins with novel cysteine-rich repeats. Plant physiology. 2001;126 (2 ):473–6. doi: 10.1104/pp.126.2.473 11402176
78 Yadav IS , Sharma A , Kaur S , Nahar N , Bhardwaj SC , Sharma TR , et al . Comparative temporal transcriptome profiling of wheat near isogenic line carrying Lr 57 under compatible and incompatible interactions. Frontiers in Plant Science. 2016;7 :1943. doi: 10.3389/fpls.2016.01943 28066494
79 Ren X , Chen Z , Liu Y , Zhang H , Zhang M , Liu Q , et al . ABO3, a WRKY transcription factor, mediates plant responses to abscisic acid and drought tolerance in Arabidopsis. The Plant Journal. 2010;63 (3 ):417–29. doi: 10.1111/j.1365-313X.2010.04248.x 20487379
80 Jiang Y , Liang G , Yu D . Activated expression of WRKY57 confers drought tolerance in Arabidopsis. Molecular plant. 2012;5 (6 ):1375–88. doi: 10.1093/mp/sss080 22930734
81 Khoso MA , Hussain A , Ritonga FN , Ali Q , Channa MM , Alshegaihi RM , et al . WRKY transcription factors (TFs): Molecular switches to regulate drought, temperature, and salinity stresses in plants. Frontiers in plant science. 2022;13 :1039329. doi: 10.3389/fpls.2022.1039329 36426143
82 Song H , Wang P , Hou L , Zhao S , Zhao C , Xia H , et al . Global analysis of WRKY genes and their response to dehydration and salt stress in soybean. Frontiers in Plant Science. 2016;7 :9. doi: 10.3389/fpls.2016.00009 26870047
83 Wang C-T , Ru J-N , Liu Y-W , Li M , Zhao D , Yang J-F , et al . Maize WRKY transcription factor ZmWRKY106 confers drought and heat tolerance in transgenic plants. International Journal of Molecular Sciences. 2018;19 (10 ):3046. doi: 10.3390/ijms19103046 30301220
84 Jiang J , Ma S , Ye N , Jiang M , Cao J , Zhang J . WRKY transcription factors in plant responses to stresses. Journal of integrative plant biology. 2017;59 (2 ):86–101. doi: 10.1111/jipb.12513 27995748
85 Tripathi P , Rabara RC , Rushton PJ . A systems biology perspective on the role of WRKY transcription factors in drought responses in plants. Planta. 2014;239 :255–66. doi: 10.1007/s00425-013-1985-y 24146023
86 Jouanin A , Tenorio-Berrio R , Schaart JG , Leigh F , Visser RG , Smulders MJ . Optimisation of droplet digital PCR for determining copy number variation of α-gliadin genes in mutant and gene-edited polyploid bread wheat. Journal of Cereal Science. 2020;92 :102903. doi: 10.1016/j.jcs.2019.102903
87 Gidhi A , Mohapatra A , Fatima M , Jha SK , Kumar M , Mukhopadhyay K . Insights of auxin signaling f-box genes in wheat (Triticum aestivum l.) and their dynamic expression during the leaf rust infection. Protoplasma. 2023;260 (3 ):723–39. doi: 10.1007/s00709-022-01808-4 36100728
88 Hajiahmadi Z , Abedi A , Wei H , Sun W , Ruan H , Zhuge Q , et al . Identification, evolution, expression, and docking studies of fatty acid desaturase genes in wheat (Triticum aestivum L.). BMC Genomics. 2020;21 :1–20. doi: 10.1186/s12864-020-07199-1 33167859
89 Zhang L , Wang K , Han Y , Yan L , Zheng Y , Bi Z , et al . Genome-wide analysis of the VQ motif-containing gene family and expression profiles during phytohormones and abiotic stresses in wheat (Triticum aestivum L.). BMC Genomics. 2022;23 (1 ):292. doi: 10.1186/s12864-022-08519-3 35410124
90 Pandey R , Joshi G , Bhardwaj AR , Agarwal M , Katiyar-Agarwal S . A comprehensive genome-wide study on tissue-specific and abiotic stress-specific miRNAs in Triticum aestivum. PloS one. 2014;9 (4 ):e95800. doi: 10.1371/journal.pone.0095800 24759739
91 Soylu I , Lakshman DK , Tatineni S , Galvez LC , Mitra A . Differential regulation of miRNAs involved in the susceptible and resistance responses of wheat cultivars to wheat streak mosaic virus and Triticum mosaic virus. BMC genomics. 2024;25 (1 ):221. doi: 10.1186/s12864-024-10128-1 38418960
92 Feng H , Duan X , Zhang Q , Li X , Wang B , Huang L , et al . The target gene of tae‐miR164, a novel NAC transcription factor from the NAM subfamily, negatively regulates resistance of wheat to stripe rust. Molecular plant pathology. 2014;15 (3 ):284–96. doi: 10.1111/mpp.12089 24128392
93 Chi Q , Du L-y , Ma W , Niu R-y , Wu B-w , Guo L-j , et al . The miR164-TaNAC14 module regulates root development and abiotic-stress tolerance in wheat seedlings. Journal of Integrative Agriculture. 2023;22 (4 ):981–98. doi: 10.1016/j.jia.2022.08.016
94 Bazzini A , Hopp H , Beachy R , Asurmendi S . Infection and coaccumulation of tobacco mosaic virus proteins alter microRNA levels, correlating with symptom and plant development. Proceedings of the National Academy of Sciences. 2007;104 (29 ):12157–62. doi: 10.1073/pnas.0705114104 17615233
95 Jia X , Ren L , Chen Q-J , Li R , Tang G . UV-B-responsive microRNAs in Populus tremula. Journal of plant physiology. 2009;166 (18 ):2046–57. doi: 10.1016/j.jplph.2009.06.011 19628301
