
==== Front
Eye Vis (Lond)
Eye Vis (Lond)
Eye and Vision
2326-0254
BioMed Central London

39237996
401
10.1186/s40662-024-00401-5
Research
An L-type calcium channel blocker nimodipine exerts anti-fibrotic effects by attenuating TGF-β1 induced calcium response in an in vitro model of thyroid eye disease
Chen Qian 12
Pan Yuan 1
Hu Yunwei 13
Chen Guanyu 1
Chen Xiaoqing 1
Xie Yanyan 1
Wang Minzhen 1
Li Zhuang 1
Huang Jun 13
Shi Yuxun 1
Huang Haixiang 1
Zhang Te 1
Wang Mei 4
Zeng Peng 4
Wang Sha 5
Chen Rongxin 1
Zheng Yongxin 1
Zhong Liuxueying 1
Yang Huasheng 1
http://orcid.org/0000-0002-7617-0204
Liang Dan liangdan@gzzoc.com

1
1 grid.12981.33 0000 0001 2360 039X State Key Laboratory of Ophthalmology, Zhongshan Ophthalmic Center, Sun Yat-sen University, Guangdong Provincial Key Laboratory of Ophthalmology Visual Science, Guangzhou, 510060 China
2 https://ror.org/0064kty71 grid.12981.33 0000 0001 2360 039X Department of Ophthalmology, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou, 510630 China
3 https://ror.org/042v6xz23 grid.260463.5 0000 0001 2182 8825 Ophthalmic Center, The Second Affiliated Hospital, Jiangxi Medical College, Nanchang University, Nanchang, 330006 China
4 grid.412536.7 0000 0004 1791 7851 Department of Ophthalmology, Sun Yat-sen Memorial Hospital, Sun Yat-sen University, Guangzhou, 510120 China
5 grid.452223.0 0000 0004 1757 7615 Eye Center of Xiangya Hospital, Central South University, Hunan Key Laboratory of Ophthalmology, Changsha, 410008 China
6 9 2024
6 9 2024
2024
11 3712 1 2024
2 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

Thyroid eye disease (TED) is a vision-threatening autoimmune disorder. Orbital tissue fibrosis leading to intractable complications remains a troublesome issue in TED management. Exploration of novel therapeutic targets and agents to ameliorate tissue fibrosis is crucial for TED. Recent work suggests that Ca2+ signaling participates in tissue fibrosis. However, whether an alteration of Ca2+ signaling has a role in fibrogenesis during TED remains unclear. In this study, we aimed to investigate the role of Ca2+ signaling in the fibrogenesis process during TED and the potential therapeutic effects of a highly selective inhibitor of the L-type calcium channel (LTCC), nimodipine, through a TGF-β1 induced in vitro TED model.

Methods

Primary culture of orbital fibroblasts (OFs) were established from orbital adipose connective tissues of patients with TED and healthy control donors. Real-time quantitative polymerase chain reaction (RT-qPCR) and RNA sequencing were used to assess the genes expression associated with LTCC in OFs. Flow cytometry, RT-qPCR, 5-ethynyl-2′-deoxyuridine (EdU) proliferation assay, wound healing assay and Western blot (WB) were used to assess the intracellular Ca2+ response on TGF-β1 stimulation, and to evaluate the potential therapeutic effects of nimodipine in the TGF-β1 induced in vitro TED model. The roles of Ca2+/calmodulin-dependent protein kinase II (CaMKII) and signal transducer and activator of transcription 1 (STAT1) in fibrogenesis during TED were determined by immunohistochemistry, WB, flow cytometry and co-immunoprecipitation assay. Selective inhibitors were used to explore the downstream signaling pathways.

Results

LTCC inhibitor nimodipine blocked the TGF-β1 induced intracellular Ca2+ response and further reduced the expression of alpha-smooth muscle actin (α-SMA), collagen type I alpha 1 (Col1A1) and collagen type I alpha 2 (Col1A2) in OFs. Besides, nimodipine inhibited cell proliferation and migration of OFs. Moreover, our results provided evidence that activation of the CaMKII/STAT1 signaling pathway was involved in fibrogenesis during TED, and nimodipine inhibited the pro-fibrotic functions of OFs by down-regulating the CaMKII/STAT1 signaling pathway.

Conclusions

TGF-β1 induces an LTCC-mediated Ca2+ response, followed by activation of CaMKII/STAT1 signaling pathway, which promotes the pro-fibrotic functions of OFs and participates in fibrogenesis during TED. Nimodipine exerts potent anti-fibrotic benefits in vitro by suppressing the CaMKII/STAT1 signaling pathway. Our work deepens our understanding of the fibrogenesis process during TED and provides potential therapeutic targets and alternative candidate for TED.

Supplementary Information

The online version contains supplementary material available at 10.1186/s40662-024-00401-5.

Keywords

Thyroid eye disease
Fibrosis
Nimodipine
Calcium signaling
Orbital fibroblasts
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China U22A20308 82301259 Pan Yuan Liang Dan http://dx.doi.org/10.13039/501100010256 Guangzhou Municipal Science and Technology Project 202102010208 SL2023A04J00243 Pan Yuan Chen Xiaoqing issue-copyright-statement© Wenzhou Medical University 2024
==== Body
pmcBackground

Thyroid eye disease (TED), also known as Graves’ orbitopathy, is a complex organ-specific disorder [1–6]. The prevalence of TED is highest among patients with Graves’ disease (GD) and the overall pooled prevalence is 40% (CI 0.32 to 0.48) [7]. Clinically, patients with TED commonly experience exophthalmos and diplopia, significantly impacting their quality of life [2, 8]. In severe cases, irreversible visual impairment may occur due to exposure keratopathy or compressive optic nerve disorders in the context of dysthyroid optic neuropathy (DON) [9–11]. The pathological process of TED mainly comprises orbital inflammation and persistent fibrogenesis [12]. In the active phase, the disease is characterized by orbital inflammation, escalating oxidative stress, and activation of orbital fibroblasts (OFs), subsequently leading to increased adipogenesis, excessive production of hyaluronan, myofibroblast differentiation, and eventual tissue fibrosis [11, 13]. Orbital tissue fibrosis takes major responsibility for the intractable complications in the late stage of TED [8, 14]. The existing therapeutic approaches for TED mainly focus on alleviating orbital inflammation and oxidative stress in patients with TED; however, their efficacy in ameliorating orbital tissue fibrosis remains uncertain [2, 3, 15–21]. The clinical demand for effectively inhibiting fibrogenesis during TED is still unmet. Therefore, it is imperative to investigate the molecular mechanisms underlying TED orbital tissue fibrosis and identify potent anti-fibrotic agents.

So far, fibrogenesis during TED remains incompletely understood. Previous studies have suggested that OFs are crucial targets and effector cells in TED [22], and the myofibroblast transdifferentiation, proliferation and migration of OFs induced by transforming growth factor-beta 1 (TGF-β1) represent crucial processes in fibrogenesis during TED [8, 11, 23–25]. However, the TGF-β1 inductive pro-fibrotic mechanisms in TED have not been fully elucidated. Further studies of TGF-β1 signaling may help develop novel therapeutic strategies targeting fibrosis in TED. Calcium ions (Ca2+) are a versatile signaling intermediate essential for a wide range of cellular biological processes including contraction, secretion, metabolism, proliferation, and differentiation [26]. Recent work suggests that Ca2+ signaling is involved in the signal transduction of TGF-β1 and participates in fibrotic events occurring in several tissues including the heart, lung, liver, kidney and conjunctiva [27–31]. The latest study also uncovered that Ca2+ signaling may contribute to TED adipogenesis through its correlation with platelet-derived growth factor receptor [32]. Consequently, whether an alteration in Ca2+ signaling contributes to fibrogenesis during TED is worth exploring.

The L-type calcium channel (LTCC) is known to be critical in supplementing cytoplasmic Ca2+ as well as triggering downstream signaling pathways in excitable cells [33, 34]. Of interest, recent studies have revealed that the dominant subunit of LTCC is also expressed on some non-excitable cells and regulates vital activities [34–38]. Therefore, it is important to determine whether LTCC plays a role in the regulation of OFs function. Nimodipine, a highly selective inhibitor of LTCC, has been shown to distribute well in the ocular circulation with good tolerability [39–43]. Additionally, recent work suggests that nimodipine has immunoregulatory effects [44, 45], which is also validated by our preclinical study [46]. In this report, we investigate the potential role of Ca2+ signaling in fibrogenesis during TED and evaluate the therapeutic effects of nimodipine through a TGF-β1 induced in vitro TED model.

Methods

Participant enrollment and tissue collection

Orbital adipose connective tissues were consecutively obtained from 6 patients with TED who underwent decompression surgery at Zhongshan Ophthalmic Center and Sun Yat-sen Memorial Hospital. The diagnostic criteria for TED refer to those developed by Bartley and Gorman [47]. All patients with TED were inactive, kept euthyroid and discontinued glucocorticoid therapy for at least 3 months. Also, history of orbital irradiation was forbidden. Orbital adipose connective tissues were also collected as surgery wastes from 6 healthy control (HC) donors who underwent blepharoplasty (n = 4) or surgery for orbital trauma (n = 2) at Zhongshan Ophthalmic Center. All the HC donors were free of any thyroid disease and TED. All enrolled participants signed informed consent forms, and were devoid of other systemic autoimmune diseases, infectious diseases, other fibrotic disorders, and malignant diseases. Clinical characteristics of these participants were summarized in Table 1. This study was conducted according to the Helsinki Declaration and approved by the institutional ethics committees of Zhongshan Ophthalmic Center (2020KYPJ104) and Sun Yat-sen Memorial Hospital (2020-KY-122). Table 1 Baseline characteristics of patients with TED and HC donors

Characteristics	Patients with TED	HC donors	
Patients, n	6	6	
Sex, male/female	3/3	3/3	
Age, mean ± SD, years	50.83 ± 5.55	43.33 ± 13.61	
History of smoking, n	3	1	
Duration of illness, median (IQR), months	43.5 (39.75–51.25)	N/A	
History of thyroid disease, n	
 Graves’ disease	6	N/A	
 Autoimmune thyroiditis	0	N/A	
 Others	0	N/A	
Previous thyroid treatments, n	
 Drugs	6	N/A	
 Radioiodine	1	N/A	
 Thyroidectomy	1	N/A	
Clinical Activity Score (CAS)a, n	
 Inactive	6	N/A	
 Active	0	N/A	
Disease severityb, n	
 Mild	0	N/A	
 Moderate to severe	6	N/A	
 Sight-threatening	0	N/A	
TED = thyroid eye disease; HC = healthy control; SD = standard deviation; n = number; N/A = not applicable

aCAS was graded according to the 7-item Clinical Activity Score (CAS), CAS ≥ 3 indicates active and CAS < 3 indicates inactive

bDisease severity was determined according to the European Group on Graves’ orbitopathy (EUGOGO) classification, which defines the severity as mild, moderate-to-severe, or sight-threatening

All the specimens obtained from patients with TED and HC donors were utilized for paraffin-embedded sections. Due to the limited size of each specimen, the remaining specimens from 4 patients with TED (2 male, 2 female) and 4 HC donors (2 male, 2 female) were utilized for primary culture of OFs and subsequent experiments.

Primary cell culture and treatments

Primary culture of OFs were performed as previously described [48, 49]. Briefly, orbital tissues were cut into small pieces (less than 1 × 1 mm) after removal of blood vessels and placed in T25 flasks. A mixture of Dulbecco’s Modified Eagle Medium/Ham’s Nutrient Mixture F-12 (DMEM/F12; 1:1 ratio) supplemented with 20% fetal bovine serum (FBS) and 1% penicillin/streptomycin (all from Gibco Laboratories, New York, USA) was added, and flasks were incubated in a humidified incubator at 37 °C with 5% CO2. OFs were harvested when cells reached 80% confluence and then passaged using 0.25% trypsin/EDTA. Subsequently, OFs were cultured in DMEM/F12 supplemented with 10% FBS and antibiotics following standard cell culture protocols [48, 49]. OFs were used between the third and the eighth passages in following in vitro experiments. Nimodipine, KN-93 Phosphate (KN-93), fludarabine (all obtained from Selleck Chemicals, Houston, TX, USA) and TGF-β1 (PeproTech Inc., Rocky Hill, NJ, USA) were applied for cell treatments upon different conditions (relevant details are provided in the following methods section).

Cytotoxicity assay

OFs were seeded in 96-well plates and treated with 20–100 μmol/L nimodipine, 5–40 μmol/L KN-93, or 5–40 μmol/L fludarabine separately. The cytotoxicity assay was performed using a cell counting kit-8 (CCK-8) (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions. The results were expressed as percentages of untreated control values and presented as mean ± standard deviation (SD).

RNA sequencing and gene expression omnibus (GEO) dataset analysis

OFs were co-cultured with TGF-β1 for 24 h with or without 60 μmol/L nimodipine pretreatment (5 min). OFs without nimodipine pretreatment and TGF-β1 served as the control group (n = 3, each group). The total RNA was extracted using a Direct-zol RNA MicroPrep Kit (Zymo Research, Irvine, CA, USA). The Yale Center for Genome Analysis used a Ribo-Zero rRNA Removal Kit (Illumina Co. San Diego, CA, USA) to process the total RNA, construct libraries and perform standard Illumina HiSeq2000 sequencing, obtaining > 40 million reads per sample.

To perform gene ontology (GO) analysis, the up- or down-regulated genes were assigned with biological functions according to the Database for Annotation, Visualization, and Integrated Discovery (DAVID), as previously described [46]. The functional variation of GO analysis is displayed as lollipop charts using R package “ggplot2”.

To analyze differentially expressed genes (DEGs), the Gene Expression Omnibus (GEO) database was queried, and the RNA sequencing dataset for TED, GSE58331, was selected. The cells subsets were categorized according to the annotation in original data. The transcripts were analyzed by R (version 4.0.3) and DEGs were identified with a fold change greater than 0.5 and P value less than 0.05. The expression of crucial genes that encode LTCC subunits is displayed as a heatmap using the R package “pheatmap” [50].

To identify the transcriptional factor (TF) that was involved in the Ca2+ signaling pathway, the DEGs between the “TGF-β1 only” and “TGF-β1 + nimodipine pretreatment” groups were screened by AnimalTFDB (version 3.0) database. The DEGs underlain the TF were identified and are displayed in Heatmap using the R package “pheatmap”.

Flow cytometry (FCM)

For intracellular free Ca2+ level measurement, OFs were digested and resuspended in Hanks’ solution with 2 mM calcium, and then loaded with 4 μmol/L Indo-1/AM (Invitrogen, Life Technologies, Carlsbad, CA, USA) for 30 min before flowcytometric analysis on an Aurora system (Cytek Biosciences, Fremont, CA, USA). FCM was performed to detect changes in the kinetics of Indo-1, the emission of which shifted from about 475 nm without Ca2+ to about 400 nm with Ca2+, and the data were presented as Indo-1 ratios [51]. The OFs derived from patients with TED (TED-OFs) were divided into three groups: (1) Vehicle group (applied with 1 μL trehalose solution, a solvent of TGF-β1, served as negative control), (2) TGF-β1 group (applied with 10 ng/mL TGF-β1), (3) Nimodipine pretreatment group (OFs were pretreated with 60 μmol/L nimodipine for 5 min, with no subsequent wash, before applying with 10 ng/mL TGF-β1). After 60 ± 10 s baseline recording, different stimulus (vehicle solution or TGF-β1 10 ng/mL) was added to FCM samples and analysis on the Aurora system for above 250 s.

For FCM of phospho-signal transducer and activator of transcription 1 [p-STAT1(Ser727)], TED-OFs and OFs of HC donors (HC-OFs) were both digested and washed, fixed with 4% paraformaldehyde and permeabilized with methanol, followed by staining with phycoerythrin (PE) conjugated antibodies against p-STAT1(Ser727) (Biolegend, San Diego, CA, USA) and analyzed on a LSR Fortessa (BD Biosciences, New York, NJ, USA).

FCM data were processed using software FlowJo (version 10.4, FlowJo Co., OR, USA).

RNA isolation and real-time quantitative polymerase chain reaction (RT-qPCR)

Total RNA was isolated from OFs using an RNA-Quick Purification Kit (Yishan Biotechnology Co., Ltd, Shanghai, China). The total RNA was reverse-transcribed into cDNA using a HiScript II Q RT SuperMix for RT-qPCR (Vazyme, Nanjing, China). RT-qPCR was performed on a Roche Light-Cycler 480 system (Roche, Basel, Switzerland) using a ChamQ SYBR Color qPCR Master Mix (Vazyme). The relative expression levels of CACNA1C, CACNB2, CACNA2D1, α-SMA, Col1A1 and Col1A2 mRNA were analyzed by the 2–ΔΔCt method. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as the internal control. The gene-specific primer sequences for RT-qPCR (all obtained from Sangon Biotech, Shanghai, China) are listed in Table 2. Table 2 Primer sequences of real-time quantitative polymerase chain reaction (RT-qPCR)

Genes	Sequences (5ʹ-3ʹ)	
CACNA1C	F: TCCTCCGCTCTGCCTCACTAG	
R: CACTGCCAATGCCTGATGATGAAC	
CACNA2D1	F: ACTGCTGCTGCCTGGTCTATTC	
R: ATCCTCCATCTCAACTGCCTCAAG	
CACNB2	F: CGCTCCTATCCGTTCTGCTTCC	
R: TCCTGGGTTTCCGAGTCAAATGTC	
α-SMA	F: CTCTGGACGCACAACTGGCAC	
R: CACGCTCAGCAGTAGTAACGAAGG	
Col1A1	F: AAAGATGGACTCAACGGTCTC	
R: CATCGTGAGCCTTCTCTTGAG	
Col1A2	F: CTCCATGGTGAGTTTGGTCTC	
R: CTTCCAATAGGACCAGTAGGAC	
GAPDH	F: TTGCCATCAATGACCCCTT	
R: CGCCCCACTTGATTTTGGA	

5-ethynyl-2′-deoxyuridine (EdU) proliferation assay

OFs were seeded in 12-well plates at a density of 5 × 104 per well overnight, and then pretreated with nimodipine (20, 40, or 60 μmol/L) or KN-93 (10 μmol/L), with no subsequent wash, followed by 10 ng/mL TGF-β1 stimulation for 24 h. After treatments, the cells were labeled with a click reaction cocktail using an EdU assay kit (Beyotime Biotechnology, Shanghai, China) according to the manufacturer’s instructions. The images were captured using an inverted fluorescent microscope (Nikon, Tokyo, Japan). Percentages of EdU-positive OFs were counted. The results were averaged in each group (n = 4), and finally expressed as the ratio of “EdU + cells” to “Total number cells”. FCM analysis of EdU + OFs was also performed with a LSR Fortessa (BD Biosciences) and the data were processed using software FlowJo (version 10.4).

Wound healing assay

OFs were seeded in 6-well plates at a density of 1 × 105 per well overnight. The OFs were then pretreated with nimodipine at concentrations of 20, 40, or 60 μmol/L, or KN-93 at a concentration of 10 μmol/L only, with no subsequent wash. Confluent cell monolayers were wounded by a pipette tip and a straight scratch was made. Wound width was assessed at 0, 12 and 24 h. Wound closure images were captured with a microscope camera (Canon, Tokyo, Japan). The results were expressed as the wound width.

Western blot (WB) analysis

Proteins of OFs with different treatments and orbital adipose connective tissues from both patients with TED and HC donors were extracted in RIPA lysis buffer (KeyGEN Biotech, Jiangsu, China) and the concentrations were quantified using a BCA assay reagent kit (Beyotime) according to manufacturer’s instructions. WB was conducted as previously described [52]. After blocking, the polyvinylidene difluoride (PVDF) membranes were incubated with primary antibodies against Col1A1, phospho-CaMKII (p-CaMKII), β-tubulin, GAPDH (all obtained from Cell Signaling Technology, Boston, MA, USA), α-SMA, CaMKII, p-STAT1 (ser727), STAT1 (all obtained from Abcam, Cambridge, UK), and Flag (ProteinTech), followed by incubation with appropriate secondary antibodies (Cell Signaling Technology). WB were imaged and grayscale values were quantified by ImageJ (NIH, Bethesda, MD, USA), and normalized to GAPDH expression levels.

Immunohistochemistry (IHC)

Paraffin sections (4 μm) of orbit adipose connective tissues were made. All the specimens obtained from patients with TED and HC donors were utilized for IHC assay of p-CaMKII (Thr286/287) and CaMKII. Due to the limited size of each specimen, remaining paraffin sections from 5 patients with TED (2 male, 3 female) and 5 HC donors (2 male, 3 female) were utilized for probing the presence and expression of p-STAT1 (ser727) and STAT1 using IHC. After dewaxing, rehydration and antigen retrieval, the sections were incubated with p-CaMKII (Thr286/287), CaMKII, p-STAT1 (ser727) or STAT1 antibodies (all Abcam) overnight at 4 °C, followed by the appropriate secondary antibodies and diaminobenzidine (DAB) at room temperature. Photographs were captured using a microscope camera (Carl-ZEISS, Oberkochen, Germany). Images were subjected to IHC scoring as previously described [53] by two clinicians (QC and YWH) according to the following criteria: 0, no staining, 1, faint, cytoplasmic and nuclear staining, 2, moderate, smooth cytoplasmic and nuclear staining, 3, intense, granular cytoplasmic and nuclear staining.

Co-immunoprecipitation (Co-IP) assay

The plasmids of pcDNA 3.1-STAT1-FLAG and the corresponding empty vector were purchased from TranSheep Bio Co. Ltd (Shanghai, China) then verified by sequencing. OFs were transiently transfected with the plasmids using Lipofectamine 2000 (Invitrogen, Life Technologies, Carlsbad, CA, USA) according to the manufacturer’s instructions. After 48 h, cells were lysed, and the supernatant was collected after centrifugation. 10% of supernatant was preserved as the whole cell lysate (WCL), and the rest was subjected to Co-IP. Co-IP was conducted with mouse anti-Flag monoclonal antibody (PeproTech Inc., Rocky Hill, NJ, USA) on a rotary table overnight at 4 °C, followed by incubation with protein A agarose beads (Cell Signaling Technology, Boston, MA, USA) for 4 h. After 3 washes, the precipitate was collected by centrifugation and resuspended in RIPA lysis buffer. Denatured proteins were separated as previously described [52]. Primary rabbit antibodies against Flag (ProteinTech), CaMKII (Abcam) and GAPDH (Cell Signaling Technology) were incubated with the PVDF membrane, followed by incubation with the appropriate secondary antibody (Cell Signaling Technology). WB bands were imaged as previously described [52].

Statistical analysis

All experiments were performed consecutively from at least 3 and up to 6 different individuals. Data from independent experiments were displayed as mean ± SD. Statistical analyses of one-way ANOVA, two-way ANOVA, or Student’s t-tests were conducted using GraphPad Prism (version 9, GraphPad Software, Inc. San Diego, CA, USA) where appropriate. A P value of less than 0.05 was considered statistically significant.

Results

Pivotal genes encoding LTCC are expressed in OFs

Based on previous Ca2+ signaling studies [34–38], we conducted RNA sequencing to investigate the expression of genes encoding crucial LTCC subunits [54] in TED-OFs, including Cavα1 (corresponding genes were CACNA1S, CACNA1C, CACNA1D, and CACNA1F), Cavβ2 (corresponding gene: CACNB2) and Cavα2δ (corresponding genes: CACNA2D1-4). The results revealed a high abundance of gene expression of Cav1.2α1 (CACNA1C) and Cavα2δ-1 (CACNA2D1) in TED-OFs. A low abundance of gene expression of Cavβ2 (CACNB2) was also observed, while the expression levels of Cav1.3α1 (CACNA1D) and the remaining genes encoding Cavα2δ subunits (CACNA2D2-4) were extremely low. No gene expression was detected for Cav1.1α1 and Cav1.4α1 (corresponding to CACNA1S and CACNA1F, respectively) (Additional file 1: Table S1). These results provided evidence that essential genes that encode LTCC were expressed on TED-OFs.

We next conducted RT-qPCR to compare the expression levels of CACNA1C, CACNA2D1 and CACNB2 between TED-OFs and HC-OFs. In TED-OFs, there was an upregulation of CACNA1C, a core gene responsible for the majority of functions of LTCC, when compared with HC-OFs (Fig. 1a). However, the other two genes (CACNB2 and CACNA2D1) associated with auxiliary subunits of LTCC showed no significant difference in expression between the two groups (Fig. 1b, c). Additionally, RNA sequencing data from GSE58331 support our findings by illustrating that CACNA1C was up-regulated in patients with TED, yet other genes encoding LTCC subunits showed no significant difference between the two groups (Additional file 2: Fig. S1).Fig. 1 Pivotal genes encoding LTCC are expressed in OFs. LTCC mediates the intracellular Ca2+ response induced by TGF-β1. a–c The mRNA expression of CACNA1C, CACNB2 and CACNA2D1 in TED-OFs and HC-OFs in passage 3 were evaluated by RT-qPCR, n = 4. d–e The representative data and statistical analysis of the Indo-1 ratio in different groups detected by flow cytometry. After 60 ± 10 s baseline recording, different stimulus (trehalose solution, or TGF-β1 10 ng/mL) was added to flow cytometry samples (as indicated by the arrows). TGF-β1 induced a substantial elevation in the Indo-1 ratio and nimodipine (60 μmol/L) inhibited the TGF-β1 induced elevation in the Indo-1 ratio (n = 4, each group). The significance was determined using unpaired Student’s t-test (a–c), or one-way ANOVA (e). LTCC, L-type calcium channel; OF, orbital fibroblast; TGF-β1, transforming growth factor-beta 1; TED, thyroid eye disease; TED-OFs, OFs derived from patients with TED; HC, healthy control; HC-OFs, OFs derived from HC donors; RT-qPCR, real-time quantitative polymerase chain reaction; Nimo, nimodipine; *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant

Collectively, our findings suggest that pivotal genes encoding LTCC are expressed in OFs, and the up-regulated expression of CACNA1C may play a role in the pathogenesis of TED.

LTCC mediates TGF-β1 induced intracellular Ca2+response

To explore whether Ca2+ response participates in the pro-fibrotic effects of TGF-β1 in TED, Indo-1/AM (Indo-1) [51] was used to assess the changes of intracellular Ca2+ levels after TGF-β1 stimulation. The results showed that TGF-β1 induced a significant quick elevation of the Indo-1 ratio in TED-OFs (Fig. 1d, e), indicating a quick increase of intracellular free Ca2+ on TGF-β1 stimulation. Moreover, when pretreated with nimodipine, a highly selective inhibitor of LTCC, there was no noticeable elevation in the Indo-1 ratio following TGF-β1 stimulation in TED-OFs (Fig. 1d, e), suggesting that LTCC contributed to intracellular free Ca2+ increase induced by TGF-β1. The CCK-8 assay showed that concentrations of nimodipine below 100 μmol/L were safe for OFs (Additional file 3: Fig. S2).

Taken together, these results provide evidence that LTCC mediates TGF-β1 induced intracellular Ca2+ response.

Nimodipine attenuates pro-fibrotic gene expression levels in OFs

Since we found that the selective LTCC inhibitor nimodipine effectively reduced the intracellular Ca2+ response induced by TGF-β1 in TED-OFs, further studies were conducted to assess the potential anti-fibrotic effects of nimodipine in vitro. Firstly, we performed RNA sequencing to compare DEGs of TED-OFs co-culture with TGF-β1 with or without nimodipine pretreatment. Previous studies suggested that excessive synthesis of collagen I and expression of α-SMA are the key features of the myofibroblast transdifferentiation of OFs [8, 21], and enhanced cell migration further facilitate the progression of fibrosis in TED [55–57]. Consistent with previous work, bioinformatics results showed that TGF-β1 elicited a pathogenic fibrotic phenotype in TED-OFs, characterized by an up-regulation in collagen production and formation, and enhanced cell migration (Fig. 2a). When pretreated with nimodipine, the collagen-containing extracellular matrix (ECM) synthesis induced by TGF-β1 was significantly attenuated, and the structural constituent and organization of ECM were both notably decreased (Fig. 2b). A reduction in Ca2+ ion binding and diminished signaling transduction were also observed in the nimodipine pretreatment group.Fig. 2 Bioinformatics analysis results. a, b Lollipop plot showing the representative gene ontology terms enriched in fibrosis-associated functions based on functional enrichment analysis. a Up-regulated functionsin the transforming growth factor-beta 1 (TGF-β1) group (n = 3); b Down-regulated functions in the nimodipine pretreatment group (n = 3)

To further confirm the anti-fibrotic effects of nimodipine, we compared the gene expression of α-SMA and collagen I in cultured TED-OFs under different specified conditions. RT-qPCR results showed that TGF-β1 increased the pro-fibrotic gene expression levels of α-SMA, Col1A1 and Col1A2 in TED-OFs. Moreover, all the abovementioned pro-fibrotic genes were down-regulated in a dose-dependent manner upon pretreatment with nimodipine (Fig. 3a–c).Fig. 3 Nimodipine attenuates the expression of pro-fibrotic genes induced by TGF-β1 in OFs. a–c TED-OFs were pretreated with 0 (control), 20, 40 or 60 μmol/L nimodipine for 5 min with no subsequent wash, followed by 10 ng/mL TGF-β1 stimulation for 24 or 48 h. The mRNA expression of α-SMA, Col1A1, and Col1A2 were evaluated by RT-qPCR. Results were normalized with GAPDH levels, n = 4, one-way ANOVA. TGF-β1, transforming growth factor-beta 1; TED-OFs, OFs derived from patients with thyroid eye disease; α-SMA, alpha-smooth muscle actin; Col1A1, collagen type I alpha 1; Col1A2, collagen type I alpha 2; RT-qPCR, real-time quantitative polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Nimo nimodipine; *P < 0.05; **P < 0.01; ***P < 0.001; ****P < 0.0001; ns, not significant

These findings collectively suggest that nimodipine effectively attenuates the expression of pro-fibrotic genes induced by TGF-β1 in TED-OFs.

Nimodipine inhibits cell proliferation and migration of OFs

Enhanced proliferation and migration of OFs have been shown to play a crucial role in fibrogenesis during TED [11, 23, 55–58]. Subsequently, the effects of nimodipine on the proliferation and migration of TED-OFs were assessed. The EdU assay revealed that TGF-β1 significantly induced cell proliferation as evidenced by a notable increase in the number of EdU-positive OFs. When pretreated with nimodipine, the TGF-β1 induced cell proliferation was alleviated dose-dependently, suggesting that LTCC plays an important role in mediating cellular proliferation of TED-OFs (Fig. 4a, b and Additional file 4: Fig. S3). Considering the pro-proliferative effect of TGF-β1, OFs were not co-cultured with TGF-β1 during the wound healing assay. We noticed delayed wound closure with pretreatment of 40 μmol/L and 60 μmol/L nimodipine, suggesting that LTCC mediated cellular migration of TED-OFs (Fig. 5a, b).Fig. 4 Nimodipine alleviated TGF-β1 induced cell proliferation of OFs. a, b The representative images and statistical analysis of EdU-positive TED-OFs in different groups are shown. Before EdU assay, OFs were pretreated with 0 (control), 20, 40 or 60 μmol/L nimodipine for 5 min, followed by 10 ng/mL TGF-β1 stimulation for 24 h. One-way ANOVA, n = 4; *P < 0.05; **P < 0.01; ****P < 0.0001. TGF-β1, transforming growth factor-beta 1; OF, orbital fibroblast; TED-OFs, OFs derived from patients with thyroid eye disease; EdU, 5-ethynyl-2′-deoxyuridine; Nimo, nimodipine. Scale bar, 100 μm

Fig. 5 Nimodipine suppresses cell migration of OFs. a, b The representative wound healing images and statistical analysis of wound width in different groups of TED-OFs are shown. Before the wound healing assay, OFs were pretreated with 0 (control), 20, 40 or 60 μmol/L nimodipine for 5 min. One-way ANOVA, n = 4; *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant. OF, orbital fibroblast; TED-OFs, OFs derived from patients with thyroid eye disease; Nimo, nimodipine. Scale bar, 200 μm

Collectively, these findings implicate LTCC in mediating cellular proliferation and migration of TED-OFs, and nimodipine alleviates the enhanced cell proliferation induced by TGF-β1 and inhibited the cell migration of TED-OFs.

Aberrant CaMKII activation is involved in fibrogenesis during TED

Ca2+/calmodulin-dependent protein kinase II (CaMKII) serves as a key modulator in transducing Ca2+ signals [59, 60]. Phosphorylation at Thr286/287 is an active form of CaMKII [59]. Since our results have identified that TGF-β1 triggered a Ca2+ response in TED-OFs, we wondered whether CaMKII activation played a role in fibrogenesis during TED. As shown in Fig. 6a–d, IHC revealed an increase in CaMKII phosphorylation in TED orbital adipose connective tissues. While the difference of total CaMKII between the two groups was not statistically significant; this finding was further confirmed by WB (Fig. 6e, f). In TED-OFs, TGF-β1 stimulation also induced an up-regulated phosphorylation of CaMKII (Fig. 6g, h). All these results support that aberrant CaMKII activation participates in fibrogenesis during TED.Fig. 6 An aberrant CaMKII activation is involved in fibrogenesis during TED. a, b Representative IHC staining for p-CaMKII (Thr286/287) (a) and total CaMKII (b) were performed on paraffin-embedded biopsy sections obtained from orbital adipose connective tissues of patients with TED and HC donors. Scale bar, 100 μm. c, d Analysis of IHC scoring for p-CaMKII (Thr286/287) (c) and total CaMKII (d), n = 6. e, f WB showed up-regulated expression of p-CaMKII (Thr286/287) in the orbital adipose connective tissues of patients with TED compared to HC donors, n = 4. g, h WB showed up-regulated expression of p-CaMKII (Thr286/287) in response to TGF-β1 stimulation in TED-OFs, n = 3. The significance was determined by unpaired Student’s t-test (c, d, f) or one-way ANOVA (h). **P < 0.01; ***P < 0.001; ns, not significant. CaMKII, Ca2+/calmodulin-dependent protein kinase II; TED, thyroid eye disease; HC, healthy control; IHC, immunohistochemistry; WB, western blot analysis; TGF-β1, transforming growth factor-beta 1; TED-OFs, OFs derived from patients with TED; GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Targeting CaMKII signaling exerts anti-fibrotic effects

Based on the above, subsequent investigations were undertaken to clarify the involvement of CaMKII signaling in fibrogenesis during TED. As shown in Fig. 7a–d, a specific CaMKII inhibitor, KN-93, attenuated the TGF-β1 induced phosphorylation of CaMKII as well as the protein expression levels of α-SMA and Col1A1 in TED-OFs. Furthermore, KN-93 suppressed TGF-β1 induced cell proliferation (Fig. 7e, f) and inhibited cell migration (Fig. 7g, h) of TED-OFs. CCK-8 assays showed that concentrations of KN-93 below 20 μmol/L were safe for OFs (Additional file 5: Fig. S4). When pretreated with nimodipine, the TGF-β1 induced phosphorylation of CaMKII was inhibited and the protein expression of α-SMA and Col1A1 were reduced (Fig. 7i–l).Fig. 7 Targeting CaMKII signaling exerts anti-fibrotic effects. a–d WB showed that KN-93 phosphate pretreatment (10 μmol/L) for 1 h inhibited TGF-β1 induced p-CaMKII (Thr286/287) protein expression at 30 min and inhibited TGF-β1 induced α-SMA and Col1A1 protein expression at 48 h in TED-OFs, n = 3. e, f The representative data and statistical analysis of EdU-positive TED-OFs in different groups assessed by flow cytometry, n = 3. Before EdU assay, OFs were pretreated with 0 (control) or 10 μmol/L KN-93 phosphate for 1 h followed by 10 ng/mL TGF-β1 stimulation for 24 h. g, h The representative wound healing images and statistical analyses of wound width showed that KN-93 phosphate pretreatment (10 μmol/L) for 1 h delayed wound closure at 12 h in TED-OFs, n = 3. Scale bar, 200 μm. i–l WB showed that nimodipine pretreatment (60 μmol/L) suppressed TGF-β1 induced p-CaMKII (Thr286/287) protein expression at 30 min and inhibited TGF-β1 induced α-SMA and Col1A1 protein expression at 48 h in TED-OFs, n = 3. The significance was determined by unpaired Student’s t-test (b–d, h) or one-way ANOVA (f, j–l). *P < 0.05; **P < 0.01; ns, not significant. CaMKII, Ca2+/calmodulin-dependent protein kinase II; WB, western blot analysis; TGF-β1, transforming growth factor-beta 1; α-SMA, alpha-smooth muscle actin; Col1A1, collagen type I alpha 1; TED-OFs, OFs derived from patients with thyroid eye disease; OF, orbital fibroblast; EdU, 5-ethynyl-2′-deoxyuridine; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; Nimo, nimodipine

Collectively, these results suggest an essential role of CaMKII signaling in TGF-β1 induced myofibroblast transdifferentiation and proliferation of TED-OFs, and CaMKII signaling is also involved in cellular motility of TED-OFs. Nimodipine exerts anti-fibrotic effects by down-regulating CaMKII signaling.

Nimodipine suppresses the CaMKII/STAT1 signaling pathway to exert anti-fibrotic effects

Recent studies show that STAT1 signaling participates in tissue fibrosis [61–64]; CaMKII was also shown to modulate the activation of STAT1 [65, 66]. Interestingly, IHC identified an up-regulation in both the phosphorylation level and total expression of STAT1 in TED orbital adipose connective tissues, when compared to the HC group (Fig. 8a–d). FCM analysis further supported the IHC results by illustrating an elevated level of STAT1 phosphorylation in TED-OFs (Fig. 8e, f). Additionally, WB analysis revealed that TGF-β1 induced an up-regulation of STAT1 phosphorylation in TED-OFs (Fig. 8g, h). Taken together, these results demonstrate that the activation of STAT1 signaling is involved in fibrogenesis during TED.Fig. 8 An activation of STAT1 is involved in fibrogenesis during TED. a, b Representative IHC staining for p-STAT1 (Ser727) (a) and total STAT1 (b) were performed on paraffin-embedded biopsy sections. Scale bar, 100 μm. c, d Analysis of IHC scoring of p-STAT1 (Ser727) (c) and total STAT1 (d), n = 5. e, f The representative data and statistical analysis of p-STAT1 (Ser727) levels of TED-OFs and HC-OFs detected by flow cytometry, n = 4. g, h WB confirmed up-regulated expression of p-STAT1(Ser727) in response to TGF-β1 stimulation in TED-OFs, n = 3. **P < 0.01, ***P < 0.001, unpaired Student’s t-test. STAT1, signal transducer and activator of transcription 1; TED, thyroid eye disease; HC, healthy control; IHC, immunohistochemistry, TED-OFs, OFs derived from patients with TED; HC-OFs, OFs derived from HC donors; WB, western blot analysis; TGF-β1, transforming growth factor-beta 1; FMO, fluorescence minus one; GAPDH, glyceraldehyde-3-phosphate dehydrogenase

Next, Co-IP confirmed the interaction of CaMKII and STAT1 in TED-OFs (Fig. 9a). KN-93 inhibited TGF-β1 induced phosphorylation of STAT1, suggesting that STAT1 is a downstream protein of CaMKII (Fig. 9b–d), consistent with previous findings [65, 66]. We next evaluated the effect of fludarabine, a specific inhibitor for STAT1 activation, in the TGF-β1 induced in vitro TED model. The results showed that fludarabine reduced the protein expression levels of α-SMA and Col1A1 induced by TGF-β1 (Fig. 9e–h). CCK-8 assays confirmed that concentrations of fludarabine below 20 μmol/L were safe for OFs (Additional file 6: Fig. S5). All these findings demonstrate that the activation of the CaMKII/STAT1 signaling pathway play an essential role in TGF-β1 mediated pro-fibrotic mechanisms in TED-OFs.Fig. 9 Nimodipine exerts anti-fibrotic effects by suppressing CaMKII/STAT1 signaling pathway in OFs. a Co-IP identified an interaction between STAT1 and CaMKII in TED-OFs, n = 3. b–d WB showed KN-93 phosphate pretreatment (10 μmol/L) for 1 h inhibited TGF-β1 induced p-CaMKII (Thr286/287) protein expression at 30 min and TGF-β1 induced p-STAT1(Ser727) protein expression at 2 h, in TED-OFs, n = 3. e–h WB showed fludarabine pretreatment (10 μmol/L) for 1 h suppressed TGF-β1 induced p-STAT1(Ser727) protein expression at 2 h and TGF-β1 induced α-SMA and Col1A1 protein expression at 48 h, in TED-OFs, n = 3. i–l WB showed that nimodipine pretreatment dose-dependently suppressed TGF-β1 induced p-STAT1 (Ser727) protein expression at 2 h and TGF-β1 induced α-SMA, Col1A1 protein expression at 48 h, in TED-OFs, n = 3. The significance was determined by unpaired Student’s t-test (c, d, f–h) or one-way ANOVA (j–l). *P < 0.05; **P < 0.01; ***P < 0.001; ns, not significant. CaMKII, Ca2+/calmodulin-dependent protein kinase II; STAT1, signal transducer and activator of transcription 1; OF, orbital fibroblast; Co-IP, co-immunoprecipitation; TED-OFs, OFs derived from patients with TED; WB, western blot analysis; TGF-β1, transforming growth factor-beta 1; α-SMA, alpha-smooth muscle actin; Col1A1, collagen type I alpha 1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; WCL, whole cell lysate; Flu, fludarabine; Nimo, nimodipine

Additionally, analysis of transcriptional target genes based on RNA sequencing data unveiled an attenuation in STAT1 signaling subsequent to nimodipine pretreatment (Additional file 7: Fig. S6). Nimodipine pretreatment down-regulated TGF-β1 induced STAT1 phosphorylation level and reduced downstream α-SMA and Col1A1 protein expression levels in a dose-dependent manner (Fig. 9i–l). Taken together, these results provide evidence that nimodipine exerts anti-fibrotic effects by suppressing the CaMKII/STAT1 signaling pathway.

Discussion

This study firstly illustrated the role of LTCC in mediating TGF-β1 induced pro-fibrotic mechanisms in TED. Additionally, we demonstrated that a well-tolerated LTCC inhibitor nimodipine delivered potent anti-fibrotic effects by reducing TGF-β1 induced Ca2+ response and downstream expression of pro-fibrotic genes and proteins in TED-OFs, as well as alleviating the TGF-β1 induced cell proliferation and OFs migration. Importantly, our data provided evidence that activation of the CaMKII/STAT1 signaling pathway participates in fibrogenesis during TED. Mechanistically, nimodipine exerted anti-fibrotic effects by suppressing the CaMKII/STAT1 signaling pathway.

To date, the demand for inhibiting orbital tissue fibrosis in TED remains unfulfilled, and further investigations into the mechanisms underlying fibrosis in TED are warranted [11, 13, 22]. A substantial amount of evidence has illustrated that myofibroblast transdifferentiation, proliferation and migration of OFs induced by TGF-β1 is the primary pathophysiological process in fibrogenesis during TED [11, 23, 55–58]. Therefore, further exploration of the TGF-β1 signaling pathway may hold potential for addressing these issues. Recently, Hou et al. suggested that c-Jun N-terminal kinase (JNK) and p38 pathways were involved in fibrogenesis during TED, and administration of JNK and p38 inhibitors attenuated TGF-β1 induced fibrogenesis in OFs [67]. However, those inhibitors have not yet been used in clinical practice. Recent investigations also suggested that curcumin and gypenosides can alleviate TGF-β1 induced myofibroblast transdifferentiation in OFs [68, 69]. However, the safety data for these drugs are insufficient, and their long-term use may lead to potential side effects. The latest studies have revealed the crucial involvement of Ca2+ signaling in the regulation of fibroblast function, with its mechanism intricately linked to TGF-β1 signaling transduction [30, 31, 51, 70]. LTCC has been demonstrated to be distinct and essential in mediating Ca2+ signal transduction in excitable cells [33]. Of note, recent work has revealed the role of LTCC in mediating Ca2+ response and critical downstream signaling events in T and B cells as well as lung fibrocytes [28, 71, 72]. Moreover, the administration of LTCC blockers has exhibited pronounced anti-fibrotic effects in preclinical investigations encompassing cardiovascular, pulmonary, hepatic, and urological disorders [27, 28, 73, 74]. Hence, it is imperative to investigate whether LTCC plays a role in the modulation of OFs functions.

Previous studies have showed that the LTCC complex consists of three subunits: (1) The α1 subunit serves as the crucial component of the LTCC by constituting a selective pore that facilitates the passage of Ca2+ ions, and hosting the majority of binding sites for regulatory proteins and drugs, particularly dihydropyridines (DHPs); (2) The auxiliary subunits α2δ and β2 are involved in the anchoring, transportation, and regulation of the LTCC complex [54, 75]. Based on previous research, we conducted mRNA transcriptome sequencing analysis to investigate the expression of genes encoding crucial LTCC subunits in TED-OFs. The results firstly revealed a high abundance of gene expression of Cav1.2α1 (CACNA1C) in TED-OFs, and an extremely low abundance of gene expression of Cav1.3α1, with no gene expression of Cav1.1α1 and Cav1.4α1, supporting previous studies [34, 54]. However, there was no significant difference in the expression of two other genes (CACNA2D1 and CACNB2) associated with auxiliary subunits Cavα2δ and Cavβ2 of LTCC between the two groups, which have been reported to perform functions independent of the Ca2+ channel [75–81]. Importantly, the Cav1.2α1 subunits possess all the key features that define a LTCC [54]. However, there is currently no literature defining the role of LTCC and its subunits in TED. Our study provides evidence of an up-regulation in the expression level of CACNA1C, which encodes Cav1.2α1, in TED-OFs, compared to HC-OFs (Fig. 1a). The RNA sequencing data from GSE58331 also supports our findings by illustrating that CACNA1C was up-regulated in patients with TED. Moreover, our results suggested the presence of a functional LTCC that mediates differentiation, cellular proliferation and motility of TED-OFs and is involved in TGF-β1 induced pro-fibrotic mechanisms in TED. Hence, the application of LTCC blockers may be novel therapeutic strategies for fibrosis in TED.

CaMKII is a multifunctional serine/threonine kinase that is ubiquitously expressed throughout the body and known to be critical in regulating the Ca2+ signaling pathway [59]. When the intracellular Ca2+ concentration increases, the Ca2+/calmodulin complex binds to the corresponding CaMKII domain and activates the subunits of CaMKII by phosphorylation in the regulatory domain, which initiates the activation of CaMKII holoenzyme and serves as a vital modulator in downstream cascade [60, 82]. Since we had found that TGF-β1 induced Ca2+ response in TED-OFs, it is worthwhile to determine the role of CaMKII signaling in fibrogenesis during TED. In this study, we have demonstrated, for the first time, a significant increase in CaMKII phosphorylation in the orbital adipose connective tissues of patients with TED. Moreover, TGF-β1 induces the phosphorylation of CaMKII in TED-OFs, consistent with a previous finding in human pulmonary fibroblasts [83]. Furthermore, selective inhibition of CaMKII by a specific inhibitor, KN-93, attenuated the TGF-β1 induced pro-fibrotic functions of OFs, in line with previous studies investigating pulmonary fibrosis [83], ureteral scar formation [74], and adverse cardiac remodeling [84]. Our results offer evidence that the activation of CaMKII signaling plays a pivotal role in fibrogenesis during TED, and thus support the hypothesis that Ca2+ signaling actively contributes to the development of fibrosis in TED. These findings also suggest that CaMKII may be a promising therapeutic target for fibrosis in TED.

STAT1 is the first member of the STAT family and serves as a key modulator in a variety of cellular functions, including immune response, apoptosis, cell growth and differentiation [85]. Recent studies report that the activation of STAT1 signaling plays a crucial role in chronic liver fibrosis [86, 87] and can be induced by TGF-β1 in vitro [88]. Furthermore, α-SMA has been demonstrated to be a downstream protein of STAT1 [89], and inhibition of STAT1 signaling ameliorates tubulointerstitial fibrosis in diabetic kidney disease [63], attenuates pulmonary vascular fibrosis [62], and rescues the exacerbated remodeling in myocardial infarction [64]. Besides, STAT1 has been shown to be activated by CaMKII [65, 66]. Recent studies also revealed that statins protect against the development of TED and alleviate orbital fibrosis by their pleiotropic effects [90–92]. Interestingly, statins have been reported to inhibit LTCC activity and STAT1-mediated gene transcription [93–95]. Therefore, we assume that statins may deliver their therapeutic effects in TED by targeting LTCC and STAT1. Therefore, it is imperative to investigate the potential involvement of STAT1 in fibrogenesis during TED. Importantly, our study first revealed an increased STAT1 phosphorylation level both in the orbital adipose connective tissues of patients with TED and in TED-OFs. Furthermore, WB identified that TGF-β1 induced STAT1 phosphorylation in TED-OFs, and inhibition of the STAT1 signaling pathway by fludarabine abolished the TGF-β1 induced expression of fibrotic proteins, in line with previous findings [62, 63]. Additionally, Co-IP and WB verified that STAT1 was a downstream protein of CaMKII, consistent with previous reports [65, 66]. Collectively, we conclude that activation of the CaMKII/STAT1 signaling pathway participates in the fibrogenesis process during TED. STAT1 may be a potential therapeutic target for the management of fibrosis in TED as well.

Nimodipine, a highly selective dihydropyridine LTCC blocker, has received approval from the U.S. Food and Drug Administration (FDA) for the prevention and treatment of neurological deficits in patients suffering from aneurysmal subarachnoid hemorrhage (aSAH) [39]. In past decades, nimodipine was initially thought to deliver its effect by relaxing cerebral vascular smooth muscle and attenuating the ischemic consequences of angiographic vasospasm [96, 97]. However, pivotal studies have demonstrated contradictory results in that the administration of nimodipine did not yield a significant impact on angiographic vasospasm, yet the clinical outcomes were improved [98, 99]. From then on, the neuroprotection effects of nimodipine have been widely studied, and its intricate mechanisms in a myriad of cell types have been demonstrated [100–104]. Due to its excellent lipophilic property, it can easily penetrate the blood–brain barrier, so early studies focused on brain diseases [39]. Recent work in normal tension glaucoma (NTG) reported that oral administration of nimodipine not only distributed well in ocular circulation, but also improved the contrast sensitivity of color vision significantly [41, 42]. Preclinical studies in multiple sclerosis, autoimmune encephalomyelitis and autoimmune uveitis also suggested that nimodipine has potential immunomodulatory effects by inhibiting the release of inflammatory factors by microglia cells and maintaining the balance of effector T cells/regulatory T cells [44–46]. These advantages make it an excellent potential treatment candidate for fibrosis in TED, as the orbit is full filled with fat, and immune cells infiltrating in the orbit promotes the fibrosis progression of TED [5, 8]. Our study provides a theoretical basis for nimodipine as a potential alternative agent for fibrosis in TED. Due to the vast cost and long period in developing new drugs, conventional drugs with novel uses are greatly cost-effective. Additionally, the potential mild anti-hypertensive and neuroprotective effects of nimodipine may confer benefits on patients with TED who have comorbid cardiovascular and cerebrovascular conditions, particularly those experiencing post-glucocorticoid therapy hypertension. Based on the above, nimodipine may be a potential candidate for treating TED.

Our study has some limitations. We failed to evaluate the anti-fibrotic effects and optimal doses of nimodipine in vivo due to the current unavailability of applicable and stable animal models for TED. Furthermore, the therapeutic effects and mechanisms of nimodipine in TED are still worth exploring for potential clinical use, and the biological functions and subcellular localization of LTCC in OFs still require further investigations. Current research indicates a crucial role of CD4+ T cell subset Th17 cells in fibrogenesis during TED by actively interacting with OFs and promoting transdifferentiation of myofibroblasts induced by TGF-β1 while inhibiting adipogenesis in OFs through their secretion of cytokine IL-17A [11, 13, 22]. In this study, we mainly focused on the downstream effects of TGF-β1, the modulation of the production of TGF-β1 is also a focal point for our future research.

Conclusions

Our study demonstrates that TGF-β1 induces an LTCC-mediated Ca2+ response, followed by activation of the CaMKII/STAT1 signaling pathway, which is involved in fibrogenesis during TED. Nimodipine, a LTCC blocker, exerts potent anti-fibrotic effects in the TGF-β1 induced in vitro TED model by suppressing the CaMKII/STAT1 signaling pathway. Our results deepen the understanding of fibrogenesis during TED, provide novel therapeutic targets, and shed some light on future research directions for the management of fibrosis in TED.

Supplementary Information

Additional file 1: Table S1. Genes associated with vital subunits of LTCC in TED-OFs.

Additional file 2: Fig. S1. Heatmap showing the up-regulation of CACNA1C in patients with thyroid eye disease (TED).

Additional file 3: Fig. S2. Cytotoxicity test of nimodipine in OFs. TED-OFs were treated with 20–100 μmol/L nimodipine for 24 or 48 h. Cell viability was assessed using the CCK-8 assay, n = 3, two-way ANOVA. Every concentration at different time points showed no statistically significant difference when compared with the control. OF, orbital fibroblast; TED-OFs, OFs derived from patients with thyroid eye disease; CCK-8, cell counting kit-8.

Additional file 4: Fig. S3. Nimodipine attenuated TGF-β1 induced cell proliferation of OFs. a–b Representative images and statistical analyses of EdU-positive TED-OFs in different groups detected by flow cytometry. Before EdU assay, OFs were pretreated with 0 (control), 20, 40 or 60 μmol/L nimodipine for 5 min, followed by 10 ng/mL TGF-β1 stimulation for 24 h, n = 4. ****P < 0.0001, one-way ANOVA. TGF-β1, transforming growth factor-beta 1; OF, orbital fibroblast; EdU, 5-ethynyl-2′-deoxyuridine proliferation assay; TED-OFs, OFs derived from patients with thyroid eye disease; Nimo, nimodipine.

Additional file 5: Fig. S4. Cytotoxicity test of KN-93 in OFs. TED-OFs were treated with 5–40 μmol/L KN-93 for 24 or 48 h. Cell viability was assessed using the CCK-8 assay, n = 3. Only the 40 μmol/L KN-93 treatment decreased cell viability at 48 h (*P < 0.05, compared to the control group, two-way ANOVA). The other concentrations at different time points showed no significant differences when compared with the control. KN-93, KN-93 phosphate; OF, orbital fibroblast; TED-OFs, OFs derived from patients with thyroid eye disease; CCK-8, cell counting kit-8.

Additional file 6: Fig. S5. Cytotoxicity test of fludarabine in OFs. TED-OFs were treated with 5–40 μmol/L fludarabine for 24 or 48 h. Cell viability was assessed using the CCK-8 assay, n = 3. Only the 40 μmol/L fludarabine treatment decreased cell viability at 48 h (*P < 0.05, compared to the control group, two-way ANOVA). The other concentrations at different time points showed no significant differences when compared with the control. OF, orbital fibroblast; TED-OFs, OFs derived from patients with thyroid eye disease; CCK-8, cell counting kit-8.

Additional file 7: Fig. S6. Nimodipine exerts anti-fibrotic effects by suppressing the STAT1 signaling pathway. The potential transcriptional factor underlying the effect of nimodipine as well as the target genes were explored by the transcriptional target gene analysis. The heatmap exhibited a significant down-regulation of target genes associated with the STAT1 signaling pathway after nimodipine pretreatment (n = 3, each group). STAT1, signal transducer and activator of transcription 1; TGF-β1, transforming growth factor-beta 1; Nimo, nimodipine.

Abbreviations

α-SMA Alpha-smooth muscle actin

Col1A1 Collagen type I alpha 1

Col1A2 Collagen type I alpha 2

CaMKII Ca2+/calmodulin-dependent protein kinase II

Co-IP Co-immunoprecipitation assay

DMEM/F12 A mixture of Dulbecco’ Modified Eagle Medium/Ham’s Nutrient Mixture F-12 (1:1 ratio)

EdU 5-Ethynyl-2′-deoxyuridine proliferation assay

FBS Fetal bovine serum

FCM Flow cytometry

Flu Fludarabine

FMO Fluorescence minus one

HC Healthy control

HC-OFs OFs derived from HC donors

IHC Immunohistochemistry

KN-93 KN-93 phosphate

LTCC L-type calcium channel

Nimo Nimodipine

OF Orbital fibroblast

RT-qPCR Real-time quantitative polymerase chain reaction

STAT1 Signal transducer and activator of transcription 1

TED Thyroid eye disease

TGF-β1 Transforming growth factor-beta 1

TED-OFs OFs derived from patients with TED

WB Western blot analysis

WCL Whole cell lysate

Acknowledgements

The authors thank OE Biotech Co. Ltd (Shanghai, China) for performing RNA sequencing. We also appreciate all the participants in this study for their altruistic contribution of samples, which has been instrumental in facilitating the progress of this research.

Author contributions

QC, YP and YWH conceived the project and designed/performed the experiments, analyzed data, and drafted the manuscript. GYC, XQC, YYX, MZW collected sample tissues and assisted with primary cell culture. ZL, JH, YXS, HXH, TZ, MW, PZ, SW provided technical advice and assisted with experiments. RXC, YXZ, LXYZ, HSY and DL guided the clinical diagnosis and participated in data analysis. DL supervised all experiments and critically revised the paper for intellectual content. All authors read and approved the final manuscript.

Funding

This study was supported by the National Natural Science Foundation of China (Grant Nos. U22A20308 and 82301259); Guangzhou Science and Technology Plan Project (Grant Nos.202102010208 and SL2023A04J00243). The contents of this work were not influenced by sponsoring foundations.

Availability of data and materials

RNA sequencing data has been deposited at the Genome Sequence Archive under the access code HRA006469. Other data in this study are included in the article.

Declarations

Ethics approval and consent to participate

The human sample protocols were approved by the institutional ethics committees of Zhongshan Ophthalmic Center (2020KYPJ104) and Sun Yat-sen Memorial Hospital (2020-KY-122).

Consent for publication

Written informed consents were obtained from all participants in accordance with the ethical guidelines.

Competing interests

All authors declare no competing financial conflicts of interest.

Qian Chen, Yuan Pan, and Yunwei Hu contributed equally to this work.
==== Refs
References

1. Smith TJ Hegedüs L Graves’ disease N Engl J Med 2016 375 16 1552 1565 10.1056/NEJMra1510030 27797318
Smith TJ, Hegedüs L. Graves’ disease. N Engl J Med. 2016;375(16):1552–65.27797318 10.1056/NEJMra1510030
2. Bartalena L Kahaly G Baldeschi L Dayan C Eckstein A Marcocci C The 2021 European Group on Graves’ orbitopathy (EUGOGO) clinical practice guidelines for the medical management of Graves’ orbitopathy Eur J Endocrinol 2021 185 4 G43 67 10.1530/EJE-21-0479 34297684
Bartalena L, Kahaly G, Baldeschi L, Dayan C, Eckstein A, Marcocci C, et al. The 2021 European Group on Graves’ orbitopathy (EUGOGO) clinical practice guidelines for the medical management of Graves’ orbitopathy. Eur J Endocrinol. 2021;185(4):G43-67.34297684 10.1530/EJE-21-0479
3. Burch HB Perros P Bednarczuk T Cooper DS Dolman PJ Leung AM Management of thyroid eye disease: a consensus statement by the American Thyroid Association and the European Thyroid Association Thyroid 2022 32 12 1439 1470 10.1089/thy.2022.0251 36480280
Burch HB, Perros P, Bednarczuk T, Cooper DS, Dolman PJ, Leung AM, et al. Management of thyroid eye disease: a consensus statement by the American Thyroid Association and the European Thyroid Association. Thyroid. 2022;32(12):1439–70.36480280 10.1089/thy.2022.0251
4. Morshed SA Ma R Latif R Davies TF Mechanisms in Graves eye disease: apoptosis as the end point of insulin-like growth factor 1 receptor inhibition Thyroid 2022 32 4 429 439 10.1089/thy.2021.0176 34927457
Morshed SA, Ma R, Latif R, Davies TF. Mechanisms in Graves eye disease: apoptosis as the end point of insulin-like growth factor 1 receptor inhibition. Thyroid. 2022;32(4):429–39.34927457 10.1089/thy.2021.0176
5. Bartalena L Tanda ML Current concepts regarding Graves’ orbitopathy J Intern Med 2022 292 5 692 716 10.1111/joim.13524 35604323
Bartalena L, Tanda ML. Current concepts regarding Graves’ orbitopathy. J Intern Med. 2022;292(5):692–716.35604323 10.1111/joim.13524
6. Hoang TD Stocker DJ Chou EL Burch HB 2022 update on clinical management of graves disease and thyroid eye disease Endocrinol Metab Clin North Am 2022 51 2 287 304 10.1016/j.ecl.2021.12.004 35662442
Hoang TD, Stocker DJ, Chou EL, Burch HB. 2022 update on clinical management of graves disease and thyroid eye disease. Endocrinol Metab Clin North Am. 2022;51(2):287–304.35662442 10.1016/j.ecl.2021.12.004
7. Chin YH Ng CH Lee MH Koh JWH Kiew J Yang SP Prevalence of thyroid eye disease in Graves’ disease: a meta-analysis and systematic review Clin Endocrinol (Oxf) 2020 93 4 363 374 10.1111/cen.14296 32691849
Chin YH, Ng CH, Lee MH, Koh JWH, Kiew J, Yang SP, et al. Prevalence of thyroid eye disease in Graves’ disease: a meta-analysis and systematic review. Clin Endocrinol (Oxf). 2020;93(4):363–74.32691849 10.1111/cen.14296
8. Wang Y Smith TJ Current concepts in the molecular pathogenesis of thyroid-associated ophthalmopathy Invest Ophthalmol Vis Sci 2014 55 3 1735 1748 10.1167/iovs.14-14002 24651704
Wang Y, Smith TJ. Current concepts in the molecular pathogenesis of thyroid-associated ophthalmopathy. Invest Ophthalmol Vis Sci. 2014;55(3):1735–48.24651704 10.1167/iovs.14-14002
9. Rana K Garg D Yong LSS Macri C Tong JY Patel S Extraocular muscle enlargement in dysthyroid optic neuropathy Can J Ophthalmol 2023 S0008–4182 23 00374 375
Rana K, Garg D, Yong LSS, Macri C, Tong JY, Patel S, et al. Extraocular muscle enlargement in dysthyroid optic neuropathy. Can J Ophthalmol. 2023;S0008–4182(23)00374–5. 10.1016/j.jcjo.2023.11.015.
10. Potvin ARGG Pakdel F Saeed P Dysthyroid optic neuropathy Ophthal Plast Reconstr Surg 2023 39 6S S65 80 10.1097/IOP.0000000000002555 38054987
Potvin ARGG, Pakdel F, Saeed P. Dysthyroid optic neuropathy. Ophthal Plast Reconstr Surg. 2023;39(6S):S65-80.38054987 10.1097/IOP.0000000000002555
11. Gupta V Hammond CL Roztocil E Gonzalez MO Feldon SE Woeller CF Thinking inside the box: current insights into targeting orbital tissue remodeling and inflammation in thyroid eye disease Surv Ophthalmol 2022 67 3 858 874 10.1016/j.survophthal.2021.08.010 34487739
Gupta V, Hammond CL, Roztocil E, Gonzalez MO, Feldon SE, Woeller CF. Thinking inside the box: current insights into targeting orbital tissue remodeling and inflammation in thyroid eye disease. Surv Ophthalmol. 2022;67(3):858–74.34487739 10.1016/j.survophthal.2021.08.010
12. Perros P Krassas GE Graves orbitopathy: a perspective Nat Rev Endocrinol 2009 5 6 312 318 10.1038/nrendo.2009.61 19421243
Perros P, Krassas GE. Graves orbitopathy: a perspective. Nat Rev Endocrinol. 2009;5(6):312–8.19421243 10.1038/nrendo.2009.61
13. Buonfiglio F Ponto KA Pfeiffer N Kahaly GJ Gericke A Redox mechanisms in autoimmune thyroid eye disease Autoimmun Rev 2024 23 5 103534 10.1016/j.autrev.2024.103534 38527685
Buonfiglio F, Ponto KA, Pfeiffer N, Kahaly GJ, Gericke A. Redox mechanisms in autoimmune thyroid eye disease. Autoimmun Rev. 2024;23(5):103534.38527685 10.1016/j.autrev.2024.103534
14. Khong JJ McNab AA Ebeling PR Craig JE Selva D Pathogenesis of thyroid eye disease: review and update on molecular mechanisms Br J Ophthalmol 2016 100 1 142 150 10.1136/bjophthalmol-2015-307399 26567024
Khong JJ, McNab AA, Ebeling PR, Craig JE, Selva D. Pathogenesis of thyroid eye disease: review and update on molecular mechanisms. Br J Ophthalmol. 2016;100(1):142–50.26567024 10.1136/bjophthalmol-2015-307399
15. Perros P Hegedüs L Bartalena L Marcocci C Kahaly GJ Baldeschi L Graves' orbitopathy as a rare disease in Europe: a European Group on Graves' Orbitopathy (EUGOGO) position statement Orphanet J Rare Dis 2017 12 1 72 10.1186/s13023-017-0625-1 28427469
Perros P, Hegedüs L, Bartalena L, Marcocci C, Kahaly GJ, Baldeschi L, et al. Graves’ orbitopathy as a rare disease in Europe: a European Group on Graves’ Orbitopathy (EUGOGO) position statement. Orphanet J Rare Dis. 2017;12(1):72.28427469 10.1186/s13023-017-0625-1
16. Wakelkamp IM Baldeschi L Saeed P Mourits MP Prummel MF Wiersinga W Surgical or medical decompression as a first-line treatment of optic neuropathy in Graves' ophthalmopathy? A randomized controlled trial Clin Endocrinol (Oxf) 2005 63 3 323 328 10.1111/j.1365-2265.2005.02345.x 16117821
Wakelkamp IM, Baldeschi L, Saeed P, Mourits MP, Prummel MF, Wiersinga W. Surgical or medical decompression as a first-line treatment of optic neuropathy in Graves’ ophthalmopathy? A randomized controlled trial. Clin Endocrinol (Oxf). 2005;63(3):323–8.16117821 10.1111/j.1365-2265.2005.02345.x
17. Smith TJ Kahaly GJ Ezra DG Fleming JC Dailey RA Tang RA Teprotumumab for thyroid-associated ophthalmopathy N Engl J Med 2017 376 18 1748 1761 10.1056/NEJMoa1614949 28467880
Smith TJ, Kahaly GJ, Ezra DG, Fleming JC, Dailey RA, Tang RA, et al. Teprotumumab for thyroid-associated ophthalmopathy. N Engl J Med. 2017;376(18):1748–61.28467880 10.1056/NEJMoa1614949
18. Sánchez-Bilbao L Martínez-López D Revenga M López-Vázquez Á Valls-Pascual E Atienza-Mateo B Anti-IL-6 receptor tocilizumab in refractory Graves’orbitopathy: national multicenter observational study of 48 patients J Clin Med 2020 9 9 2816 10.3390/jcm9092816 32878150
Sánchez-Bilbao L, Martínez-López D, Revenga M, López-Vázquez Á, Valls-Pascual E, Atienza-Mateo B, et al. Anti-IL-6 receptor tocilizumab in refractory Graves’orbitopathy: national multicenter observational study of 48 patients. J Clin Med. 2020;9(9):2816.32878150 10.3390/jcm9092816
19. Ye X Bo X Hu X Cui H Lu B Shao J Efficacy and safety of mycophenolate mofetil in patients with active moderate-to-severe Graves’ orbitopathy Clin Endocrinol (Oxf) 2017 86 2 247 255 10.1111/cen.13170 27484048
Ye X, Bo X, Hu X, Cui H, Lu B, Shao J, et al. Efficacy and safety of mycophenolate mofetil in patients with active moderate-to-severe Graves’ orbitopathy. Clin Endocrinol (Oxf). 2017;86(2):247–55.27484048 10.1111/cen.13170
20. Kahaly GJ Riedl M König J Pitz S Ponto K Diana T Mycophenolate plus methylprednisolone versus methylprednisolone alone in active, moderate-to-severe Graves’ orbitopathy (MINGO): a randomised, observer-masked, multicentre trial Lancet Diabetes Endocrinol 2018 6 4 287 298 10.1016/S2213-8587(18)30020-2 29396246
Kahaly GJ, Riedl M, König J, Pitz S, Ponto K, Diana T, et al. Mycophenolate plus methylprednisolone versus methylprednisolone alone in active, moderate-to-severe Graves’ orbitopathy (MINGO): a randomised, observer-masked, multicentre trial. Lancet Diabetes Endocrinol. 2018;6(4):287–98.29396246 10.1016/S2213-8587(18)30020-2
21. Smith TJ Janssen JAMJL Insulin-like growth factor-I receptor and thyroid-associated ophthalmopathy Endocr Rev 2019 40 1 236 267 10.1210/er.2018-00066 30215690
Smith TJ, Janssen JAMJL. Insulin-like growth factor-I receptor and thyroid-associated ophthalmopathy. Endocr Rev. 2019;40(1):236–67.30215690 10.1210/er.2018-00066
22. Lee ACH Kahaly GJ Pathophysiology of thyroid-associated orbitopathy Best Pract Res Clin Endocrinol Metab 2023 37 2 101620 10.1016/j.beem.2022.101620 35181241
Lee ACH, Kahaly GJ. Pathophysiology of thyroid-associated orbitopathy. Best Pract Res Clin Endocrinol Metab. 2023;37(2): 101620.35181241 10.1016/j.beem.2022.101620
23. Kuriyan AE Woeller CF O'Loughlin CW Phipps RP Feldon SE Orbital fibroblasts from thyroid eye disease patients differ in proliferative and adipogenic responses depending on disease subtype Invest Ophthalmol Vis Sci 2013 54 12 7370 7377 10.1167/iovs.13-12741 24135759
Kuriyan AE, Woeller CF, O’Loughlin CW, Phipps RP, Feldon SE. Orbital fibroblasts from thyroid eye disease patients differ in proliferative and adipogenic responses depending on disease subtype. Invest Ophthalmol Vis Sci. 2013;54(12):7370–7.24135759 10.1167/iovs.13-12741
24. Smith TJ Potential roles of CD34+ fibrocytes masquerading as orbital fibroblasts in thyroid-associated ophthalmopathy J Clin Endocrinol Metab 2019 104 2 581 594 10.1210/jc.2018-01493 30445529
Smith TJ. Potential roles of CD34+ fibrocytes masquerading as orbital fibroblasts in thyroid-associated ophthalmopathy. J Clin Endocrinol Metab. 2019;104(2):581–94.30445529 10.1210/jc.2018-01493
25. Neag EJ Smith TJ 2021 update on thyroid-associated ophthalmopathy J Endocrinol Invest 2022 45 2 235 259 10.1007/s40618-021-01663-9 34417736
Neag EJ, Smith TJ. 2021 update on thyroid-associated ophthalmopathy. J Endocrinol Invest. 2022;45(2):235–59.34417736 10.1007/s40618-021-01663-9
26. Bootman MD Calcium signaling Cold Spring Harb Perspect Biol 2012 4 7 a011171 10.1101/cshperspect.a011171 22751152
Bootman MD. Calcium signaling. Cold Spring Harb Perspect Biol. 2012;4(7): a011171.22751152 10.1101/cshperspect.a011171
27. Tajiri K Guichard JB Qi X Xiong F Naud P Tardif JC An N-/L-type calcium channel blocker, cilnidipine, suppresses autonomic, electrical, and structural remodelling associated with atrial fibrillation Cardiovasc Res 2019 115 14 1975 1985 10.1093/cvr/cvz136 31119260
Tajiri K, Guichard JB, Qi X, Xiong F, Naud P, Tardif JC, et al. An N-/L-type calcium channel blocker, cilnidipine, suppresses autonomic, electrical, and structural remodelling associated with atrial fibrillation. Cardiovasc Res. 2019;115(14):1975–85.31119260 10.1093/cvr/cvz136
28. Mukherjee S Ayaub EA Murphy J Lu C Kolb M Ask K Disruption of calcium signaling in fibroblasts and attenuation of bleomycin-induced fibrosis by nifedipine Am J Respir Cell Mol Biol 2015 53 4 450 458 10.1165/rcmb.2015-0009OC 25664495
Mukherjee S, Ayaub EA, Murphy J, Lu C, Kolb M, Ask K, et al. Disruption of calcium signaling in fibroblasts and attenuation of bleomycin-induced fibrosis by nifedipine. Am J Respir Cell Mol Biol. 2015;53(4):450–8.25664495 10.1165/rcmb.2015-0009OC
29. Paka L Smith DE Jung D McCormack S Zhou P Duan B Anti-steatotic and anti-fibrotic effects of the KCa3.1 channel inhibitor, Senicapoc, in non-alcoholic liver disease World J Gastroenterol 2017 23 23 4181 4190 10.3748/wjg.v23.i23.4181 28694658
Paka L, Smith DE, Jung D, McCormack S, Zhou P, Duan B, et al. Anti-steatotic and anti-fibrotic effects of the KCa3.1 channel inhibitor, Senicapoc, in non-alcoholic liver disease. World J Gastroenterol. 2017;23(23):4181–90.28694658 10.3748/wjg.v23.i23.4181
30. Mishima K Maeshima A Miya M Sakurai N Ikeuchi H Hiromura K Involvement of N-type Ca(2+) channels in the fibrotic process of the kidney in rats Am J Physiol Renal Physiol 2013 304 6 F665 F673 10.1152/ajprenal.00561.2012 23324177
Mishima K, Maeshima A, Miya M, Sakurai N, Ikeuchi H, Hiromura K, et al. Involvement of N-type Ca(2+) channels in the fibrotic process of the kidney in rats. Am J Physiol Renal Physiol. 2013;304(6):F665–73.23324177 10.1152/ajprenal.00561.2012
31. Anumanthan G Wilson PJ Tripathi R Hesemann NP Mohan RR Blockade of KCa3.1: a novel target to treat TGF-β1 induced conjunctival fibrosis Exp Eye Res 2018 167 140 144 10.1016/j.exer.2017.12.003 29242028
Anumanthan G, Wilson PJ, Tripathi R, Hesemann NP, Mohan RR. Blockade of KCa3.1: a novel target to treat TGF-β1 induced conjunctival fibrosis. Exp Eye Res. 2018;167:140–4.29242028 10.1016/j.exer.2017.12.003
32. Wu L Zhou R Diao J Chen X Huang J Xu K Differentially expressed circular RNAs in orbital adipose/connective tissue from patients with thyroid-associated ophthalmopathy Exp Eye Res 2020 196 108036 10.1016/j.exer.2020.108036 32376473
Wu L, Zhou R, Diao J, Chen X, Huang J, Xu K, et al. Differentially expressed circular RNAs in orbital adipose/connective tissue from patients with thyroid-associated ophthalmopathy. Exp Eye Res. 2020;196:108036.32376473 10.1016/j.exer.2020.108036
33. Xu L Sun L Xie L Mou S Zhang D Zhu J Advances in L-type calcium channel structures, functions and molecular modeling Curr Med Chem 2021 28 3 514 524 10.2174/0929867327666200714154059 32664834
Xu L, Sun L, Xie L, Mou S, Zhang D, Zhu J, et al. Advances in L-type calcium channel structures, functions and molecular modeling. Curr Med Chem. 2021;28(3):514–24.32664834 10.2174/0929867327666200714154059
34. Pitt GS Matsui M Cao C Voltage-gated calcium channels in nonexcitable tissues Annu Rev Physiol 2021 83 183 203 10.1146/annurev-physiol-031620-091043 33106102
Pitt GS, Matsui M, Cao C. Voltage-gated calcium channels in nonexcitable tissues. Annu Rev Physiol. 2021;83:183–203.33106102 10.1146/annurev-physiol-031620-091043
35. Ramachandran KV Hennessey JA Barnett AS Yin X Stadt HA Foster E Calcium influx through L-type CaV1.2 Ca2+ channels regulates mandibular development J Clin Invest 2013 123 4 1638 1646 10.1172/JCI66903 23549079
Ramachandran KV, Hennessey JA, Barnett AS, Yin X, Stadt HA, Foster E, et al. Calcium influx through L-type CaV1.2 Ca2+ channels regulates mandibular development. J Clin Invest. 2013;123(4):1638–46.23549079 10.1172/JCI66903
36. Panagiotakos G Haveles C Arjun A Petrova R Rana A Portmann T Aberrant calcium channel splicing drives defects in cortical differentiation in Timothy syndrome Elife 2019 8 e51037 10.7554/eLife.51037 31868578
Panagiotakos G, Haveles C, Arjun A, Petrova R, Rana A, Portmann T, et al. Aberrant calcium channel splicing drives defects in cortical differentiation in Timothy syndrome. Elife. 2019;8:e51037.31868578 10.7554/eLife.51037
37. Das R Burke T Van Wagoner DR Plow EF L-type calcium channel blockers exert an antiinflammatory effect by suppressing expression of plasminogen receptors on macrophages Circ Res 2009 105 2 167 175 10.1161/CIRCRESAHA.109.200311 19520970
Das R, Burke T, Van Wagoner DR, Plow EF. L-type calcium channel blockers exert an antiinflammatory effect by suppressing expression of plasminogen receptors on macrophages. Circ Res. 2009;105(2):167–75.19520970 10.1161/CIRCRESAHA.109.200311
38. Cao C Ren Y Barnett AS Mirando AJ Rouse D Mun SH Increased Ca2+ signaling through CaV1.2 promotes bone formation and prevents estrogen deficiency-induced bone loss JCI Insight 2017 2 22 e95512 10.1172/jci.insight.95512 29202453
Cao C, Ren Y, Barnett AS, Mirando AJ, Rouse D, Mun SH, et al. Increased Ca2+ signaling through CaV1.2 promotes bone formation and prevents estrogen deficiency-induced bone loss. JCI Insight. 2017;2(22):e95512.29202453 10.1172/jci.insight.95512
39. Carlson AP Hänggi D Macdonald RL Shuttleworth CW Nimodipine reappraised: an old drug with a future Curr Neuropharmacol 2020 18 1 65 82 10.2174/1570159X17666190927113021 31560289
Carlson AP, Hänggi D, Macdonald RL, Shuttleworth CW. Nimodipine reappraised: an old drug with a future. Curr Neuropharmacol. 2020;18(1):65–82.31560289 10.2174/1570159X17666190927113021
40. Pantoni L del Ser T Soglian AG Amigoni S Spadari G Binelli D Efficacy and safety of nimodipine in subcortical vascular dementia: a randomized placebo-controlled trial Stroke 2005 36 3 619 624 10.1161/01.STR.0000155686.73908.3e 15692125
Pantoni L, del Ser T, Soglian AG, Amigoni S, Spadari G, Binelli D, et al. Efficacy and safety of nimodipine in subcortical vascular dementia: a randomized placebo-controlled trial. Stroke. 2005;36(3):619–24.15692125 10.1161/01.STR.0000155686.73908.3e
41. Michalk F Michelson G Harazny J Werner U Daniel WG Werner D Single-dose nimodipine normalizes impaired retinal circulation in normal tension glaucoma J Glaucoma 2004 13 2 158 162 10.1097/00061198-200404000-00013 15097263
Michalk F, Michelson G, Harazny J, Werner U, Daniel WG, Werner D. Single-dose nimodipine normalizes impaired retinal circulation in normal tension glaucoma. J Glaucoma. 2004;13(2):158–62.15097263 10.1097/00061198-200404000-00013
42. Luksch A Rainer G Koyuncu D Ehrlich P Maca T Gschwandtner ME Effect of nimodipine on ocular blood flow and colour contrast sensitivity in patients with normal tension glaucoma Br J Ophthalmol 2005 89 1 21 25 10.1136/bjo.2003.037671 15615740
Luksch A, Rainer G, Koyuncu D, Ehrlich P, Maca T, Gschwandtner ME, et al. Effect of nimodipine on ocular blood flow and colour contrast sensitivity in patients with normal tension glaucoma. Br J Ophthalmol. 2005;89(1):21–5.15615740 10.1136/bjo.2003.037671
43. Carlson AP Hänggi D Wong GK Etminan N Mayer SA Aldrich F Single-dose intraventricular nimodipine microparticles versus oral nimodipine for aneurysmal subarachnoid hemorrhage Stroke 2020 51 4 1142 1149 10.1161/STROKEAHA.119.027396 32138631
Carlson AP, Hänggi D, Wong GK, Etminan N, Mayer SA, Aldrich F, et al. Single-dose intraventricular nimodipine microparticles versus oral nimodipine for aneurysmal subarachnoid hemorrhage. Stroke. 2020;51(4):1142–9.32138631 10.1161/STROKEAHA.119.027396
44. Ingwersen J De Santi L Wingerath B Graf J Koop B Schneider R Nimodipine confers clinical improvement in two models of experimental autoimmune encephalomyelitis J Neurochem 2018 10.1111/jnc.14324 29473171
Ingwersen J, De Santi L, Wingerath B, Graf J, Koop B, Schneider R, et al. Nimodipine confers clinical improvement in two models of experimental autoimmune encephalomyelitis. J Neurochem. 2018. 10.1111/jnc.14324. 29473171 10.1111/jnc.14324
45. Desai RA Davies AL Del Rossi N Tachrount M Dyson A Gustavson B Nimodipine reduces dysfunction and demyelination in models of multiple sclerosis Ann Neurol 2020 88 1 123 136 10.1002/ana.25749 32293054
Desai RA, Davies AL, Del Rossi N, Tachrount M, Dyson A, Gustavson B, et al. Nimodipine reduces dysfunction and demyelination in models of multiple sclerosis. Ann Neurol. 2020;88(1):123–36.32293054 10.1002/ana.25749
46. Hu Y Chen G Huang J Li Z Li Z Xie Y The calcium channel inhibitor nimodipine shapes the uveitogenic T cells and protects mice from experimental autoimmune uveitis through the p38-MAPK signaling pathway J Immunol 2021 207 12 2933 2943 10.4049/jimmunol.2100568 34799427
Hu Y, Chen G, Huang J, Li Z, Li Z, Xie Y, et al. The calcium channel inhibitor nimodipine shapes the uveitogenic T cells and protects mice from experimental autoimmune uveitis through the p38-MAPK signaling pathway. J Immunol. 2021;207(12):2933–43.34799427 10.4049/jimmunol.2100568
47. Bartley GB Gorman CA Diagnostic criteria for Graves' ophthalmopathy Am J Ophthalmol 1995 119 6 792 795 10.1016/S0002-9394(14)72787-4 7785696
Bartley GB, Gorman CA. Diagnostic criteria for Graves’ ophthalmopathy. Am J Ophthalmol. 1995;119(6):792–5.7785696 10.1016/S0002-9394(14)72787-4
48. Wang X Yang S Ye H Chen J Shi L Feng L Disulfiram exerts antiadipogenic, anti-inflammatory, and antifibrotic therapeutic effects in an in vitro model of Graves' orbitopathy Thyroid 2022 32 3 294 305 10.1089/thy.2021.0246 34605662
Wang X, Yang S, Ye H, Chen J, Shi L, Feng L, et al. Disulfiram exerts antiadipogenic, anti-inflammatory, and antifibrotic therapeutic effects in an in vitro model of Graves’ orbitopathy. Thyroid. 2022;32(3):294–305.34605662 10.1089/thy.2021.0246
49. Xie Y Pan Y Chen Q Chen Y Chen G Wang M Selective BD2 inhibitor exerts anti-fibrotic effects via BRD4/FoxM1/Plk1 axis in orbital fibroblasts from patients with thyroid eye disease Invest Ophth Vis Sci 2023 64 7 9 10.1167/iovs.64.7.9
Xie Y, Pan Y, Chen Q, Chen Y, Chen G, Wang M, et al. Selective BD2 inhibitor exerts anti-fibrotic effects via BRD4/FoxM1/Plk1 axis in orbital fibroblasts from patients with thyroid eye disease. Invest Ophth Vis Sci. 2023;64(7):9.10.1167/iovs.64.7.9
50. Hu Y Li Z Chen G Li Z Huang J Huang H Hydroxychloroquine alleviates EAU by inhibiting uveitogenic T cells and ameliorating retinal vascular endothelial cells dysfunction Front Immunol 2022 13 859260 10.3389/fimmu.2022.859260 35401507
Hu Y, Li Z, Chen G, Li Z, Huang J, Huang H, et al. Hydroxychloroquine alleviates EAU by inhibiting uveitogenic T cells and ameliorating retinal vascular endothelial cells dysfunction. Front Immunol. 2022;13:859260.35401507 10.3389/fimmu.2022.859260
51. Shao Z Makinde TO Agrawal DK Calcium-activated potassium channel KCa3.1 in lung dendritic cell migration Am J Respir Cell Mol Biol 2011 45 5 962 968 10.1165/rcmb.2010-0514OC 21493782
Shao Z, Makinde TO, Agrawal DK. Calcium-activated potassium channel KCa3.1 in lung dendritic cell migration. Am J Respir Cell Mol Biol. 2011;45(5):962–8.21493782 10.1165/rcmb.2010-0514OC
52. Huang J Li Z Hu Y Li Z Xie Y Huang H Melatonin, an endogenous hormone, modulates Th17 cells via the reactive-oxygen species/TXNIP/HIF-1α axis to alleviate autoimmune uveitis J Neuroinflamm 2022 19 1 124 10.1186/s12974-022-02477-z
Huang J, Li Z, Hu Y, Li Z, Xie Y, Huang H, et al. Melatonin, an endogenous hormone, modulates Th17 cells via the reactive-oxygen species/TXNIP/HIF-1α axis to alleviate autoimmune uveitis. J Neuroinflamm. 2022;19(1):124.10.1186/s12974-022-02477-z
53. Yi ES Boland JM Maleszewski JJ Roden AC Oliveira AM Aubry M-C Correlation of IHC and FISH for ALK gene rearrangement in non-small cell lung carcinoma: IHC score algorithm for FISH J Thorac Oncol 2011 6 3 459 465 10.1097/JTO.0b013e318209edb9 21278610
Yi ES, Boland JM, Maleszewski JJ, Roden AC, Oliveira AM, Aubry MC, et al. Correlation of IHC and FISH for ALK gene rearrangement in non-small cell lung carcinoma: IHC score algorithm for FISH. J Thorac Oncol. 2011;6(3):459–65.21278610 10.1097/JTO.0b013e318209edb9
54. Hofmann F Flockerzi V Kahl S Wegener JW L-type CaV1.2 calcium channels: from in vitro findings to in vivo function Physiol Rev 2014 94 1 303 326 10.1152/physrev.00016.2013 24382889
Hofmann F, Flockerzi V, Kahl S, Wegener JW. L-type CaV1.2 calcium channels: from in vitro findings to in vivo function. Physiol Rev. 2014;94(1):303–26.24382889 10.1152/physrev.00016.2013
55. Dik WA Virakul S van Steensel L Current perspectives on the role of orbital fibroblasts in the pathogenesis of Graves' ophthalmopathy Exp Eye Res 2016 142 83 91 10.1016/j.exer.2015.02.007 26675405
Dik WA, Virakul S, van Steensel L. Current perspectives on the role of orbital fibroblasts in the pathogenesis of Graves’ ophthalmopathy. Exp Eye Res. 2016;142:83–91.26675405 10.1016/j.exer.2015.02.007
56. Zhou M Lin B Wu P Ke Y Huang S Zhang F SOX9 induces orbital fibroblast activation in thyroid eye disease via MAPK/ERK1/2 pathway Invest Ophthalmol Vis Sci 2024 65 2 25 10.1167/iovs.65.2.25 38345552
Zhou M, Lin B, Wu P, Ke Y, Huang S, Zhang F, et al. SOX9 induces orbital fibroblast activation in thyroid eye disease via MAPK/ERK1/2 pathway. Invest Ophthalmol Vis Sci. 2024;65(2):25.38345552 10.1167/iovs.65.2.25
57. Choi CJ Tao W Doddapaneni R Acosta-Torres Z Blessing NW Lee BW The effect of prostaglandin analogue bimatoprost on thyroid-associated orbitopathy Invest Ophthalmol Vis Sci 2018 59 15 5912 5923 10.1167/iovs.18-25134 30551199
Choi CJ, Tao W, Doddapaneni R, Acosta-Torres Z, Blessing NW, Lee BW, et al. The effect of prostaglandin analogue bimatoprost on thyroid-associated orbitopathy. Invest Ophthalmol Vis Sci. 2018;59(15):5912–23.30551199 10.1167/iovs.18-25134
58. Hammond CL Roztocil E Phipps RP Feldon SE Woeller CF Proton pump inhibitors attenuate myofibroblast formation associated with thyroid eye disease through the aryl hydrocarbon receptor PLoS One 2019 14 9 e0222779 10.1371/journal.pone.0222779 31536596
Hammond CL, Roztocil E, Phipps RP, Feldon SE, Woeller CF. Proton pump inhibitors attenuate myofibroblast formation associated with thyroid eye disease through the aryl hydrocarbon receptor. PLoS One. 2019;14(9):e0222779.31536596 10.1371/journal.pone.0222779
59. Zhang X Connelly J Levitan ES Sun D Wang JQ Calcium/calmodulin-dependent protein kinase II in cerebrovascular diseases Transl Stroke Res 2021 12 4 513 529 10.1007/s12975-021-00901-9 33713030
Zhang X, Connelly J, Levitan ES, Sun D, Wang JQ. Calcium/calmodulin-dependent protein kinase II in cerebrovascular diseases. Transl Stroke Res. 2021;12(4):513–29.33713030 10.1007/s12975-021-00901-9
60. Takemoto-Kimura S Suzuki K Horigane SI Kamijo S Inoue M Sakamoto M Calmodulin kinases: essential regulators in health and disease J Neurochem 2017 141 6 808 818 10.1111/jnc.14020 28295333
Takemoto-Kimura S, Suzuki K, Horigane SI, Kamijo S, Inoue M, Sakamoto M, et al. Calmodulin kinases: essential regulators in health and disease. J Neurochem. 2017;141(6):808–18.28295333 10.1111/jnc.14020
61. Prieto I Kavanagh M Jimenez-Castilla L Pardines M Lazaro I Herrero Del Real I A mutual regulatory loop between miR-155 and SOCS1 influences renal inflammation and diabetic kidney disease Mol Ther Nucleic Acids 2023 34 102041 10.1016/j.omtn.2023.102041 37842165
Prieto I, Kavanagh M, Jimenez-Castilla L, Pardines M, Lazaro I, Herrero Del Real I, et al. A mutual regulatory loop between miR-155 and SOCS1 influences renal inflammation and diabetic kidney disease. Mol Ther Nucleic Acids. 2023;34:102041.37842165 10.1016/j.omtn.2023.102041
62. Zhang M Xin W Yu Y Yang X Ma C Zhang H Programmed death-ligand 1 triggers PASMCs pyroptosis and pulmonary vascular fibrosis in pulmonary hypertension J Mol Cell Cardiol 2020 138 23 33 10.1016/j.yjmcc.2019.10.008 31733200
Zhang M, Xin W, Yu Y, Yang X, Ma C, Zhang H, et al. Programmed death-ligand 1 triggers PASMCs pyroptosis and pulmonary vascular fibrosis in pulmonary hypertension. J Mol Cell Cardiol. 2020;138:23–33.31733200 10.1016/j.yjmcc.2019.10.008
63. Huang F Wang Q Guo F Zhao Y Ji L An T FoxO1-mediated inhibition of STAT1 alleviates tubulointerstitial fibrosis and tubule apoptosis in diabetic kidney disease EBioMedicine 2019 48 491 504 10.1016/j.ebiom.2019.09.002 31629675
Huang F, Wang Q, Guo F, Zhao Y, Ji L, An T, et al. FoxO1-mediated inhibition of STAT1 alleviates tubulointerstitial fibrosis and tubule apoptosis in diabetic kidney disease. EBioMedicine. 2019;48:491–504.31629675 10.1016/j.ebiom.2019.09.002
64. Zhang J Xu Y Wei C Yin Z Pan W Zhao M Macrophage neogenin deficiency exacerbates myocardial remodeling and inflammation after acute myocardial infarction through JAK1-STAT1 signaling Cell Mol Life Sci 2023 80 11 324 10.1007/s00018-023-04974-7 37824022
Zhang J, Xu Y, Wei C, Yin Z, Pan W, Zhao M, et al. Macrophage neogenin deficiency exacerbates myocardial remodeling and inflammation after acute myocardial infarction through JAK1-STAT1 signaling. Cell Mol Life Sci. 2023;80(11):324.37824022 10.1007/s00018-023-04974-7
65. Wang L Tassiulas I Park-Min KH Reid AC Gil-Henn H Schlessinger J 'Tuning' of type I interferon-induced Jak-STAT1 signaling by calcium-dependent kinases in macrophages Nat Immunol 2008 9 2 186 193 10.1038/ni1548 18084294
Wang L, Tassiulas I, Park-Min KH, Reid AC, Gil-Henn H, Schlessinger J, et al. “Tuning” of type I interferon-induced Jak-STAT1 signaling by calcium-dependent kinases in macrophages. Nat Immunol. 2008;9(2):186–93.18084294 10.1038/ni1548
66. Nair JS DaFonseca CJ Tjernberg A Sun W Darnell JE Chait BT Requirement of Ca2+ and CaMKII for Stat1 Ser-727 phosphorylation in response to IFN-gamma P Natl Acad Sci USA 2002 99 9 5971 5976 10.1073/pnas.052159099
Nair JS, DaFonseca CJ, Tjernberg A, Sun W, Darnell JE, Chait BT, et al. Requirement of Ca2+ and CaMKII for Stat1 Ser-727 phosphorylation in response to IFN-gamma. P Natl Acad Sci USA. 2002;99(9):5971–6.10.1073/pnas.052159099
67. Hou TY Wu SB Kau HC Tsai CC JNK and p38 inhibitors prevent transforming growth factor-β1-induced myofibroblast transdifferentiation in human Graves' orbital fibroblasts Int J Mol Sci 2021 22 6 2952 10.3390/ijms22062952 33799469
Hou TY, Wu SB, Kau HC, Tsai CC. JNK and p38 inhibitors prevent transforming growth factor-β1-induced myofibroblast transdifferentiation in human Graves’ orbital fibroblasts. Int J Mol Sci. 2021;22(6):2952.33799469 10.3390/ijms22062952
68. Yu WK Hwang WL Wang YC Tsai CC Wei YH Curcumin suppresses TGF-β1-induced myofibroblast differentiation and attenuates angiogenic activity of orbital fibroblasts Int J Mol Sci 2021 22 13 6829 10.3390/ijms22136829 34202024
Yu WK, Hwang WL, Wang YC, Tsai CC, Wei YH. Curcumin suppresses TGF-β1-induced myofibroblast differentiation and attenuates angiogenic activity of orbital fibroblasts. Int J Mol Sci. 2021;22(13):6829.34202024 10.3390/ijms22136829
69. Li H Ma C Liu W He J Li K Gypenosides protect orbital fibroblasts in Graves ophthalmopathy via anti-inflammation and anti-fibrosis effects Invest Ophthalmol Vis Sci 2020 61 5 64 10.1167/iovs.61.5.64 32462203
Li H, Ma C, Liu W, He J, Li K. Gypenosides protect orbital fibroblasts in Graves ophthalmopathy via anti-inflammation and anti-fibrosis effects. Invest Ophthalmol Vis Sci. 2020;61(5):64.32462203 10.1167/iovs.61.5.64
70. Xie H Lu J Zhu Y Meng X Wang R The KCa3.1 blocker TRAM-34 inhibits proliferation of fibroblasts in paraquat-induced pulmonary fibrosis Toxicol Lett 2018 295 408 415 10.1016/j.toxlet.2018.07.020 30036685
Xie H, Lu J, Zhu Y, Meng X, Wang R. The KCa3.1 blocker TRAM-34 inhibits proliferation of fibroblasts in paraquat-induced pulmonary fibrosis. Toxicol Lett. 2018;295:408–15.30036685 10.1016/j.toxlet.2018.07.020
71. Stokes L Gordon J Grafton G Non-voltage-gated L-type Ca2+ channels in human T cells: pharmacology and molecular characterization of the major alpha pore-forming and auxiliary beta-subunits J Biol Chem 2004 279 19 19566 19573 10.1074/jbc.M401481200 14981074
Stokes L, Gordon J, Grafton G. Non-voltage-gated L-type Ca2+ channels in human T cells: pharmacology and molecular characterization of the major alpha pore-forming and auxiliary beta-subunits. J Biol Chem. 2004;279(19):19566–73.14981074 10.1074/jbc.M401481200
72. Grafton G Stokes L Toellner KM Gordon J A non-voltage-gated calcium channel with L-type characteristics activated by B cell receptor ligation Biochem Pharmacol 2003 66 10 2001 2009 10.1016/j.bcp.2003.07.005 14599558
Grafton G, Stokes L, Toellner KM, Gordon J. A non-voltage-gated calcium channel with L-type characteristics activated by B cell receptor ligation. Biochem Pharmacol. 2003;66(10):2001–9.14599558 10.1016/j.bcp.2003.07.005
73. Ohyama T Sato K Kishimoto K Yamazaki Y Horiguchi N Ichikawa T Azelnidipine is a calcium blocker that attenuates liver fibrosis and may increase antioxidant defence Br J Pharmacol 2012 165 4b 1173 1187 10.1111/j.1476-5381.2011.01599.x 21790536
Ohyama T, Sato K, Kishimoto K, Yamazaki Y, Horiguchi N, Ichikawa T, et al. Azelnidipine is a calcium blocker that attenuates liver fibrosis and may increase antioxidant defence. Br J Pharmacol. 2012;165(4b):1173–87.21790536 10.1111/j.1476-5381.2011.01599.x
74. Zeng MQ Xiao W Yang K Gao ZY Wang JS Lu Q Verapamil inhibits ureteral scar formation by regulating CaMK II-mediated Smad pathway Chem Biol Interact 2021 346 109570 10.1016/j.cbi.2021.109570 34217686
Zeng MQ, Xiao W, Yang K, Gao ZY, Wang JS, Lu Q, et al. Verapamil inhibits ureteral scar formation by regulating CaMK II-mediated Smad pathway. Chem Biol Interact. 2021;346:109570.34217686 10.1016/j.cbi.2021.109570
75. Buraei Z Yang J The ß subunit of voltage-gated Ca2+ channels Physiol Rev 2010 90 4 1461 1506 10.1152/physrev.00057.2009 20959621
Buraei Z, Yang J. The ß subunit of voltage-gated Ca2+ channels. Physiol Rev. 2010;90(4):1461–506.20959621 10.1152/physrev.00057.2009
76. Vergnol A Traoré M Pietri-Rouxel F Falcone S New insights in CaVβ subunits: role in the regulation of gene expression and cellular homeostasis Front Cell Dev Biol 2022 10 880441 10.3389/fcell.2022.880441 35465309
Vergnol A, Traoré M, Pietri-Rouxel F, Falcone S. New insights in CaVβ subunits: role in the regulation of gene expression and cellular homeostasis. Front Cell Dev Biol. 2022;10:880441.35465309 10.3389/fcell.2022.880441
77. Meissner M Weissgerber P Londoño JE Prenen J Link S Ruppenthal S Moderate calcium channel dysfunction in adult mice with inducible cardiomyocyte-specific excision of the cacnb2 gene J Biol Chem 2011 286 18 15875 15882 10.1074/jbc.M111.227819 21357697
Meissner M, Weissgerber P, Londoño JE, Prenen J, Link S, Ruppenthal S, et al. Moderate calcium channel dysfunction in adult mice with inducible cardiomyocyte-specific excision of the cacnb2 gene. J Biol Chem. 2011;286(18):15875–82.21357697 10.1074/jbc.M111.227819
78. Yang L Katchman A Kushner J Kushnir A Zakharov SI Chen BX Cardiac CaV1.2 channels require β subunits for β-adrenergic-mediated modulation but not trafficking J Clin Invest 2019 129 2 647 658 10.1172/JCI123878 30422117
Yang L, Katchman A, Kushner J, Kushnir A, Zakharov SI, Chen BX, et al. Cardiac CaV1.2 channels require β subunits for β-adrenergic-mediated modulation but not trafficking. J Clin Invest. 2019;129(2):647–58.30422117 10.1172/JCI123878
79. Eroglu C Allen NJ Susman MW O'Rourke NA Park CY Ozkan E Gabapentin receptor alpha2delta-1 is a neuronal thrombospondin receptor responsible for excitatory CNS synaptogenesis Cell 2009 139 2 380 392 10.1016/j.cell.2009.09.025 19818485
Eroglu C, Allen NJ, Susman MW, O’Rourke NA, Park CY, Ozkan E, et al. Gabapentin receptor alpha2delta-1 is a neuronal thrombospondin receptor responsible for excitatory CNS synaptogenesis. Cell. 2009;139(2):380–92.19818485 10.1016/j.cell.2009.09.025
80. Taylor CP Mechanisms of analgesia by gabapentin and pregabalin–calcium channel alpha2-delta [Cavalpha2-delta] ligands Pain 2009 142 1–2 13 16 10.1016/j.pain.2008.11.019 19128880
Taylor CP. Mechanisms of analgesia by gabapentin and pregabalin–calcium channel alpha2-delta [Cavalpha2-delta] ligands. Pain. 2009;142(1–2):13–6.19128880 10.1016/j.pain.2008.11.019
81. Chen Z Mondal A Minor DL Jr Structural basis for CaVα2δ:gabapentin binding Nat Struct Mol Biol 2023 30 6 735 739 10.1038/s41594-023-00951-7 36973510
Chen Z, Mondal A, Minor DL Jr. Structural basis for CaVα2δ:gabapentin binding. Nat Struct Mol Biol. 2023;30(6):735–9.36973510 10.1038/s41594-023-00951-7
82. Bhattacharyya M Karandur D Kuriyan J Structural insights into the regulation of Ca2+/calmodulin-dependent protein kinase II (CaMKII) Cold Spring Harb Perspect Biol 2020 12 6 a035147 10.1101/cshperspect.a035147 31653643
Bhattacharyya M, Karandur D, Kuriyan J. Structural insights into the regulation of Ca2+/calmodulin-dependent protein kinase II (CaMKII). Cold Spring Harb Perspect Biol. 2020;12(6):a035147.31653643 10.1101/cshperspect.a035147
83. Mukherjee S Sheng W Sun R Janssen LJ Ca2+/calmodulin-dependent protein kinase IIβ and IIδ mediate TGFβ-induced transduction of fibronectin and collagen in human pulmonary fibroblasts Am J Physiol Lung Cell Mol Physiol 2017 312 4 L510 L519 10.1152/ajplung.00084.2016 28130256
Mukherjee S, Sheng W, Sun R, Janssen LJ. Ca2+/calmodulin-dependent protein kinase IIβ and IIδ mediate TGFβ-induced transduction of fibronectin and collagen in human pulmonary fibroblasts. Am J Physiol Lung Cell Mol Physiol. 2017;312(4):L510–9.28130256 10.1152/ajplung.00084.2016
84. Suetomi T Willeford A Brand CS Cho Y Ross RS Miyamoto S Inflammation and NLRP3 inflammasome activation initiated in response to pressure overload by Ca2+/calmodulin-dependent protein kinase II δ signaling in cardiomyocytes are essential for adverse cardiac remodeling Circulation 2018 138 22 2530 2544 10.1161/CIRCULATIONAHA.118.034621 30571348
Suetomi T, Willeford A, Brand CS, Cho Y, Ross RS, Miyamoto S, et al. Inflammation and NLRP3 inflammasome activation initiated in response to pressure overload by Ca2+/calmodulin-dependent protein kinase II δ signaling in cardiomyocytes are essential for adverse cardiac remodeling. Circulation. 2018;138(22):2530–44.30571348 10.1161/CIRCULATIONAHA.118.034621
85. Krämer OH Heinzel T Phosphorylation-acetylation switch in the regulation of STAT1 signaling Mol Cell Endocrinol 2010 315 1–2 40 48 10.1016/j.mce.2009.10.007 19879327
Krämer OH, Heinzel T. Phosphorylation-acetylation switch in the regulation of STAT1 signaling. Mol Cell Endocrinol. 2010;315(1–2):40–8.19879327 10.1016/j.mce.2009.10.007
86. Zhang H Chen F Fan X Lin C Hao Y Wei H Quantitative proteomic analysis on activated hepatic stellate cells reversion reveal STAT1 as a key regulator between Liver Fibrosis and recovery Sci Rep 2017 7 44910 10.1038/srep44910 28322315
Zhang H, Chen F, Fan X, Lin C, Hao Y, Wei H, et al. Quantitative proteomic analysis on activated hepatic stellate cells reversion reveal STAT1 as a key regulator between liver fibrosis and recovery. Sci Rep. 2017;7:44910.28322315 10.1038/srep44910
87. Gao B Wang H Lafdil F Feng D STAT proteins—key regulators of anti-viral responses, inflammation, and tumorigenesis in the liver J Hepatol 2012 57 2 430 441 10.1016/j.jhep.2012.01.029 22504331
Gao B, Wang H, Lafdil F, Feng D. STAT proteins—key regulators of anti-viral responses, inflammation, and tumorigenesis in the liver. J Hepatol. 2012;57(2):430–41.22504331 10.1016/j.jhep.2012.01.029
88. Tian X Guan W Zhang L Sun W Zhou D Lin Q Physical interaction of STAT1 isoforms with TGF-β receptors leads to functional crosstalk between two signaling pathways in epithelial ovarian cancer J Exp Clin Cancer Res 2018 37 1 103 10.1186/s13046-018-0773-8 29751820
Tian X, Guan W, Zhang L, Sun W, Zhou D, Lin Q, et al. Physical interaction of STAT1 isoforms with TGF-β receptors leads to functional crosstalk between two signaling pathways in epithelial ovarian cancer. J Exp Clin Cancer Res. 2018;37(1):103.29751820 10.1186/s13046-018-0773-8
89. Jeon M You D Bae SY Kim SW Nam SJ Kim HH Dimerization of EGFR and HER2 induces breast cancer cell motility through STAT1-dependent ACTA2 induction Oncotarget 2017 8 31 50570 50581 10.18632/oncotarget.10843 28881584
Jeon M, You D, Bae SY, Kim SW, Nam SJ, Kim HH, et al. Dimerization of EGFR and HER2 induces breast cancer cell motility through STAT1-dependent ACTA2 induction. Oncotarget. 2017;8(31):50570–81.28881584 10.18632/oncotarget.10843
90. Nilsson A Tsoumani K Planck T Statins decrease the risk of orbitopathy in newly diagnosed patients with Graves disease J Clin Endocrinol Metab 2021 106 5 1325 1332 10.1210/clinem/dgab070 33560351
Nilsson A, Tsoumani K, Planck T. Statins decrease the risk of orbitopathy in newly diagnosed patients with Graves disease. J Clin Endocrinol Metab. 2021;106(5):1325–32.33560351 10.1210/clinem/dgab070
91. Malboosbaf R Maghsoomi Z Emami Z Khamseh ME Azizi F Statins and thyroid eye disease (TED): a systematic review Endocrine 2024 85 1 11 17 10.1007/s12020-023-03680-5 38194219
Malboosbaf R, Maghsoomi Z, Emami Z, Khamseh ME, Azizi F. Statins and thyroid eye disease (TED): a systematic review. Endocrine. 2024;85(1):11–7.38194219 10.1007/s12020-023-03680-5
92. Hsu GC Shih SR Chang FY Liao SL Wei YH An appraisal of the preventive effect of statins on the development of Graves' ophthalmopathy: a hospital-based cohort study Ophthalmol Ther 2024 13 6 1499 1511 10.1007/s40123-024-00930-1 38581604
Hsu GC, Shih SR, Chang FY, Liao SL, Wei YH. An appraisal of the preventive effect of statins on the development of Graves’ ophthalmopathy: a hospital-based cohort study. Ophthalmol Ther. 2024;13(6):1499–511.38581604 10.1007/s40123-024-00930-1
93. Ma Y Kong L Qi S Wang D Atorvastatin blocks increased L-type Ca2+ current and cell injury elicited by angiotensin II via inhibiting oxide stress Acta Biochim Biophys Sin (Shanghai) 2016 48 4 378 384 10.1093/abbs/gmw009 26940997
Ma Y, Kong L, Qi S, Wang D. Atorvastatin blocks increased L-type Ca2+ current and cell injury elicited by angiotensin II via inhibiting oxide stress. Acta Biochim Biophys Sin (Shanghai). 2016;48(4):378–84.26940997 10.1093/abbs/gmw009
94. Curry L Almukhtar H Alahmed J Roberts R Smith PA Simvastatin inhibits L-type Ca2+-channel activity through impairment of mitochondrial function Toxicol Sci 2019 169 2 543 552 10.1093/toxsci/kfz068 30859212
Curry L, Almukhtar H, Alahmed J, Roberts R, Smith PA. Simvastatin inhibits L-type Ca2+-channel activity through impairment of mitochondrial function. Toxicol Sci. 2019;169(2):543–52.30859212 10.1093/toxsci/kfz068
95. Li N Salter RC Ramji DP Molecular mechanisms underlying the inhibition of IFN-γ-induced, STAT1-mediated gene transcription in human macrophages by simvastatin and agonists of PPARs and LXRs J Cell Biochem 2011 112 2 675 683 10.1002/jcb.22976 21268089
Li N, Salter RC, Ramji DP. Molecular mechanisms underlying the inhibition of IFN-γ-induced, STAT1-mediated gene transcription in human macrophages by simvastatin and agonists of PPARs and LXRs. J Cell Biochem. 2011;112(2):675–83.21268089 10.1002/jcb.22976
96. Langley MS Sorkin EM Nimodipine. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic potential in cerebrovascular disease Drugs 1989 37 5 669 699 10.2165/00003495-198937050-00004 2663415
Langley MS, Sorkin EM. Nimodipine. A review of its pharmacodynamic and pharmacokinetic properties, and therapeutic potential in cerebrovascular disease. Drugs. 1989;37(5):669–99.2663415 10.2165/00003495-198937050-00004
97. Hänggi D Turowski B Beseoglu K Yong M Steiger HJ Intra-arterial nimodipine for severe cerebral vasospasm after aneurysmal subarachnoid hemorrhage: influence on clinical course and cerebral perfusion AJNR Am J Neuroradiol 2008 29 6 1053 1060 10.3174/ajnr.A1005 18372422
Hänggi D, Turowski B, Beseoglu K, Yong M, Steiger HJ. Intra-arterial nimodipine for severe cerebral vasospasm after aneurysmal subarachnoid hemorrhage: influence on clinical course and cerebral perfusion. AJNR Am J Neuroradiol. 2008;29(6):1053–60.18372422 10.3174/ajnr.A1005
98. Feigin VL Rinkel GJ Algra A Vermeulen M van Gijn J Calcium antagonists in patients with aneurysmal subarachnoid hemorrhage: a systematic review Neurology 1998 50 4 876 883 10.1212/WNL.50.4.876 9566366
Feigin VL, Rinkel GJ, Algra A, Vermeulen M, van Gijn J. Calcium antagonists in patients with aneurysmal subarachnoid hemorrhage: a systematic review. Neurology. 1998;50(4):876–83.9566366 10.1212/WNL.50.4.876
99. Macdonald RL Hänggi D Ko NU Darsaut TE Carlson AP Wong GK NEWTON-2 cisternal (nimodipine microparticles to enhance recovery while reducing toxicity after subarachnoid hemorrhage): a phase 2, multicenter, randomized, open-label safety study of intracisternal EG-1962 in aneurysmal subarachnoid hemorrhage Neurosurgery 2020 88 1 E13 E26 10.1093/neuros/nyaa430 32985652
Macdonald RL, Hänggi D, Ko NU, Darsaut TE, Carlson AP, Wong GK, et al. NEWTON-2 cisternal (nimodipine microparticles to enhance recovery while reducing toxicity after subarachnoid hemorrhage): a phase 2, multicenter, randomized, open-label safety study of intracisternal EG-1962 in aneurysmal subarachnoid hemorrhage. Neurosurgery. 2020;88(1):E13–26.32985652 10.1093/neuros/nyaa430
100. Hashioka S Klegeris A McGeer PL Inhibition of human astrocyte and microglia neurotoxicity by calcium channel blockers Neuropharmacology 2012 63 4 685 691 10.1016/j.neuropharm.2012.05.033 22659089
Hashioka S, Klegeris A, McGeer PL. Inhibition of human astrocyte and microglia neurotoxicity by calcium channel blockers. Neuropharmacology. 2012;63(4):685–91.22659089 10.1016/j.neuropharm.2012.05.033
101. Cheli VT Santiago González DA Smith J Spreuer V Murphy GG Paez PM L-type voltage-operated calcium channels contribute to astrocyte activation in vitro Glia 2016 64 8 1396 1415 10.1002/glia.23013 27247164
Cheli VT, Santiago González DA, Smith J, Spreuer V, Murphy GG, Paez PM. L-type voltage-operated calcium channels contribute to astrocyte activation in vitro. Glia. 2016;64(8):1396–415.27247164 10.1002/glia.23013
102. Hopp SC D'Angelo HM Royer SE Kaercher RM Crockett AM Adzovic L Calcium dysregulation via L-type voltage-dependent calcium channels and ryanodine receptors underlies memory deficits and synaptic dysfunction during chronic neuroinflammation J Neuroinflamm 2015 12 56 10.1186/s12974-015-0262-3
Hopp SC, D’Angelo HM, Royer SE, Kaercher RM, Crockett AM, Adzovic L, et al. Calcium dysregulation via L-type voltage-dependent calcium channels and ryanodine receptors underlies memory deficits and synaptic dysfunction during chronic neuroinflammation. J Neuroinflamm. 2015;12:56.10.1186/s12974-015-0262-3
103. Sanchez AB Medders KE Maung R Sánchez-Pavón P Ojeda-Juárez D Kaul M CXCL12-induced neurotoxicity critically depends on NMDA receptor-gated and L-type Ca2+ channels upstream of p38 MAPK J Neuroinflamm 2016 13 1 252 10.1186/s12974-016-0724-2
Sanchez AB, Medders KE, Maung R, Sánchez-Pavón P, Ojeda-Juárez D, Kaul M. CXCL12-induced neurotoxicity critically depends on NMDA receptor-gated and L-type Ca2+ channels upstream of p38 MAPK. J Neuroinflamm. 2016;13(1):252.10.1186/s12974-016-0724-2
104. Marcantoni M Fuchs A Löw P Bartsch D Kiehn O Bellardita C Early delivery and prolonged treatment with nimodipine prevents the development of spasticity after spinal cord injury in mice Sci Transl Med 2020 12 539 eaay0167 10.1126/scitranslmed.aay0167 32295897
Marcantoni M, Fuchs A, Löw P, Bartsch D, Kiehn O, Bellardita C. Early delivery and prolonged treatment with nimodipine prevents the development of spasticity after spinal cord injury in mice. Sci Transl Med. 2020;12(539):eaay0167.32295897 10.1126/scitranslmed.aay0167
