
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4194
10.1186/s12917-024-04194-6
Research
Impact of transportation in freshwater and brackish water on Nile tilapia (Oreochromis niloticus) resistance
Abd El-Galil Mohamed Abd El Aziz Ahmed mohamed.abdelaziz@vet.sohag.edu.eg

1
Abd-Elaal Hassan Hala Ali Alsagheer 1
Abd Alhamed Ahmed Fatma Elzahraa 2
Abd Allah Mousa Mohamed 3
Emam Arafah M. 4
Osman Ahmed Elsayed 5
1 https://ror.org/02wgx3e98 grid.412659.d 0000 0004 0621 726X Fish Diseases and Management Department, Faculty of Veterinary Medicine, Sohag University, Sohag, 82524 Egypt
2 https://ror.org/02wgx3e98 grid.412659.d 0000 0004 0621 726X Zoology Department, Faculty of Sciences, Sohag University, Sohag, Egypt
3 https://ror.org/02wgx3e98 grid.412659.d 0000 0004 0621 726X Nutrition and Clinical Nutrition Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt
4 https://ror.org/052cjbe24 grid.419615.e 0000 0004 0404 7762 National Institute of Oceanography and Fisheries, NIOF, Cairo, Egypt
5 https://ror.org/02wgx3e98 grid.412659.d 0000 0004 0621 726X Biochemistry Department, Faculty of Veterinary Medicine, Sohag University, Sohag, Egypt
6 9 2024
6 9 2024
2024
20 39616 3 2024
15 7 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

Oreochromis niloticus has great economic value and potential for farming and development. Transportation of fish was done for breeding or trading purpose and it is a challenging aspect of aquaculture. This study aimed to investigate the effect of transportation in freshwater and brackish water on the resistance of O. niloticus as well as transportation stress mitigation effect of NaCl. Four equal groups were used; each of 50 fish, the 1st group served as the control (P 1), while the 2nd group (PT 2) was transported in water without salt, the 3rd (PT 3) and 4th (PT 4) groups were transported in water containing 5 gL− 1 and 10 gL− 1 salt respectively. PT 2, PT 3 and PT 4 were transported for 5 h without any rest or sedative drugs.

Results

The serum cortisol of O. niloticus significantly increased at 0 h and then decreased at 12 and 24 h post transportation in the PT 2 group and non-significantly increased at all point times in the PT 3 and PT 4 groups comparing to P 1 group. Mucin2 gene (MUC2) expression was non-significantly up regulated in the PT 2 group and down regulated in the PT 3 and PT 4 groups at 0 h comparing with P 1 group, but at 12 and 24 h it was significantly up regulated in the PT 2, PT 3 and PT 4 groups. The β Defensin-1 (β D1) and 2 (β D2) genes expression was non-significantly down-regulated in the PT 2 group and significantly up regulated in the PT 3 and PT 4 groups at 0 h., while at 12 and 24 h was significantly down regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups, it significantly down regulated in the PT 2 and PT 3 group and non-significantly down regulated in the PT 4 group at 24 h. Non-significant up regulation in interleukin − 1β (IL-1β) gene expression was reported in the PT 2 group and non-significant down regulation in the PT 3 and PT 4 groups at 0 h. However, significant up regulation was recorded in the PT 2, PT 3 and PT 4 groups at 12 and 24 h. The Tumor necrosis factor-alpha (TNF–α) gene expression was non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h. However, it was significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h.

Conclusion

The results of this study confirmed the stressful effect of transportation on O. niloticus as well as the transportation stress mitigation effect of NaCl.

Keywords

O. Niloticus
Nile tilapia
Transportation
Stress
NaCl
Cortisol
Mucin
Β D
TNF
IL-1β
Sohag UniversityOpen access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

The Nile tilapia was initially introduced in developing countries to meet protein demands [1] and it has great economic value and potential for farming and development [2]. Nile tilapia is resistant to environmental conditions and diseases, grows rapidly and adapts to various aquaculture methods, it has relatively low production cost [1]. Improving fish welfare is directly linked to the advancement of fish aquaculture industry. This is because better fish growth is associated to low-stress conditions through lives. Live fish transportation is a common work in aquaculture facilities, but it can activate the stress responses that compromise fish welfare. The impact of transportation stress is influenced by many factors including time, temperature, fish size and health, stocking density, stress level, and packing method [3–5]. Unfortunately, transportation stress also affects water quality as well as fish productivity and survival [6].

Transport stress is one of the factors that raise cortisol level, which activate gluconeogenesis, this process increases glucose levels to provide the energy needed to handle the stress [7]. Increased production of cutaneous mucosal secretions in response to stress has been observed many fish species [8]. Mucin genes were found to be significantly up-regulated in fish after transportation [9, 10]. β-defensins have various activities including antibacterial, antiviral, chemotactic, immune-modulatory, and reproductive regulation. Interleukin-1 (IL-1) is a pro-inflammatory cytokine that plays an important role in fish immunity by activating lymphocytes and phagocytic cells. The tumor necrosis factor-α family is involved in regulating leukocyte homing, proliferation and migration.

Reducing stress during transportation is an essential factor for supporting fish growth and survival rates [11, 12]. Several studies had been conducted on the topic of reducing stress during transportation through using supplementary diet such as probiotics [13, 14], turmeric [15], glycine [16], anesthetics [17, 18] and in the addition of salt to transport water [9, 10, 19]. Adding NaCl to transport water is a common practice in freshwater fish farms to mitigate the adverse effect of transport [20]. Salt is cheap and easy to use in fish farms and it helps alleviate osmoregulation troubles during transport [21–23]. This study aims to investigate the effect of 5 h transportation in freshwater and water containing 5gL− 1 and 10gL− 1 NaCl on O. niloticus resistance as well as the stress mitigation effect of NaCl.

Materials and methods

Ethics approval

The protocols of this study were following the ethical consideration of experimental animals and approved by the Veterinary Medical Ethics Research Committee-Faculty of Veterinary Medicine at Sohag University, Egypt, approval number Soh.un.vet/00016 M2.

Fish

Nile tilapia (O. niloticus) (average body weight was 53 ± 3 g) were obtained from Wadi Samhod Tilapia Private Farm in the New Vally Governorate, Egypt.

Transportation experiment

Nile tilapia was divided into 4 groups, 50 fish for each, the 1st group served as the control group (P1), the 2nd fish group was transported in water without salt (PT2) and the 3rd fish group was transported in water containing 5gL-1 Nacl (PT3) and the 4th fish group was transported in water containing 10gL-1 Nacl (PT4). The transportation water was obtained directly from the farm pond. The fish were transported for 5 h at stocking density of 26.5gL-1 and with continuous aeration; they were transported without sedation or rest. Each fish group was transported in a separate tank with 180 L capacity, containing 100 L of water. Once the fish reached to the Wet Lab. of Fish Diseases and Management Dept., Faculty of Veterinary Medicine, Sohag University, the fish were removed from the transport water to clean freshwater and each group was kept in a separate tank during the sampling time.

Sampling

Blood and skin samples were collected from the control group (P 1) only pre-transportation, and from the PT 2, PT 3 and PT 4 groups at 0 h, 12 h and 24 h. post transportation, 5 fish from each experimental group were sampled at each determined time point. The fish were anesthetized with MS-222 (150 mgL-1) [24] before blood and skin sampling, the blood samples were left to clot at room temperature for sera collection, which was stored at -80 °C until analysis. Skin samples were collected and preserved in Ribonuclic acid later (RNA later) and stored at -80 °C for gene expression studies [25].

Cortisol level

The quantity of serum cortisol was determined using ELISA method from a commercial kit (DRG Cortisol ELISA EIA‒1887, Germany). Absorbance readings were taken using a spectrophotometer with a wavelength of 500 nm (HITACHI, U‒2001).

Gene expression studies

Total RNA was extracted from the skin of O. niloticus from control, PT 2, PT 3 and PT 4 using Trizol. 1 µg of total RNA was denatured at 65 °C for 5 min in the presence of 1 µl of oligo-dT17, 1 µl of dNTP (deoxynucleoside triphosphate mix 10 mM (Promega) and RNA/DNA free water (Sigma) in a volume of 13 µl to synthesize cDNA,. The synthesis was carried out using 1 µl of Superscript III reverse transcriptase enzyme (Invitrogen), 5 µl of 5x first strand buffer, 1 µl 0.1 M DTT and water to reach final volume of 25 µl. The mixture was then incubated at 55 °C for 1 h. The resulting cyclic Deoxyribonucleic acid (cDNA) was stored at − 20 °C. The expression of the mucin2 gene (MUC2), antimicrobial peptides (βD1 and 2) and cytokines (IL-1β and TNF-α) was examined before and after transport using RT-qPCR with specific primers (Table 1). For the qPCR, 3 µl of a diluted cDNA template was used following the procedures described by [26]. The relative expression levels of the genes were determined using the Pfaffl method [27] as previously explained [26].

Table 1 Showed Oligonucleotide primers were used in SYBR Green real time PCR

Gene	Primer sequence (5’-3’)	Reference	
EF-1α	CCTTCAACGCTCAGGTCATC	Gröner et al., 2015 [28]	
TGTGGGCAGTGTGGCAATC	
MUC2	CAACTGTTTTTGAGACAACTTCAGA	Midhun et al., 2019 [29]	
CTGAAGTGACCGTGGAAGG	
βD-1	TTCGCATTGTGTCCTCTGCTCCGTTCGAC	Dong et al., 2015 [30]	
TGAAACAGACAGATCCACATCAAACCCTGA	
βD-2	GCTGACAGCAGTGCAAGCTGATGACAC	Taccki et al., 2015 [31]	
GCAAAGCACAGCATCTTAATCTGC	
TNF alpha	CCAGAAGCACTAAAGGCGAAGA	Standen et al., 2016 [32]	
CCTTGGCTTTGCTGCTGATC	
IL-1ß	AGAGCAGCAATTCAGAGC	Ming et al., 2013 [33]	
GTGCTGATGTACCGT	

Analysis of the SYBR green Rt-PCR results

Amplification curves and CT values were determined by the stratagene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each sample was compared with that of the control group according to the “ΔΔCt” method [34].

Statistical analysis

Results are expressed as the mean ± standard error (SE). Data analysis was performed in GraphPad Prism version 5.0 including normality tests. All data were normally distributed. Statistically significant differences were considered when p < 0.05. The qPCR measurements were analyzed by T-test to identify statistically significant differences between groups. One-way ANOVA and Tukey post-hoc analysis test were performed to identify statistically significant differences among groups.

Results

Cortisol level

The serum cortisol level of the control O. niloticus group (P 1) was 11.07 ± 1.0 µgdl− 1. It significantly increased in the PT 2 group at 0 h, decreased greatly but still significantly higher than P 1 group at 12 h and comes back to the basal level without significant difference at 24 h post transportation compared to the control group. However It remains around the basal level and non-significantly increases in the PT 3 and PT 4 groups comparing with the P 1 group at all point times and significantly decreases in the PT 3 and PT 4 groups comparing with PT 2 group at all point times, (Table 2 and Figs. 1 and 2)

Table 2 Showed Cortisol values in all experimental groups at the point times and the significant differences compared to the control group

Fish group	Time	Cortisol level (µg/dl) (Mean ± SE)	
PT1 (Control group)	Pre-transport	11.02 ± 1.0	
PT2 (without Nacl)	0 h post transport	21.27 ± 0.51***	
PT3 (5 gL− 1 Nacl)	11.70 ± .31ns	
PT4 (10 gL− 1 Nacl)	12.21 ± 0.71ns	
PT2	12 h post transport	14.03 ± 0.60*	
PT3	11.33 ± 0.27ns	
PT4	12.07 ± 0.72ns	
PT2	24 h post transport	12.20 ± 0.55ns	
PT3	11.10 ± 0.46ns	
PT4	11.96 ± 1.55ns	
*p ≤ 0.05, **p ≤ 0.01, ***p ≤ 0.001 and ns = non significant

Fig. 1 Showed cortisol values in all experimental groups at the sampling times and the significant differences compared to the control group

Fig. 2 Showed cortisol values in all experimental groups at sampling times as well as the interaction between group-time factors and the significant differences compared to PT2 group

Gene’s expression

MUC2 gene expression

The expression of MUC2 gene in O. niloticus non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation comparing with the P 1 group. It significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h post transportation comparing with the P 1 group. However comparing with PT 2 group, it non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation and significantly up regulated in the PT 3 and PT 4 groups at 12 and 24 h. Additionally there was a non-significant up regulation in PT 3 group compared to the PT 4 fish group at 0, 12 and 24 h. (Table 3 and Fig. 3).

Table 3 Showed MUC2 gene expression in all experimental groups at the point times and the significant differences compared to the control group

Fish group	Time	EF1α	Muc-2	
CT	CT	Fold change (Mean ± SE)	
P1 (Control group)	Pre-transport	19.36	23.29	-	
PT2 (without Nacl)	0 h post transport	19.34	22.62	1.61 ± 0.26ns	
PT3 (5gL− 1 Nacl)	20.87	25.10	0.82 ± 0.04ns	
PT4 (10gL− 1 Nacl)	19.63	24.01	0.74 ± 0.06ns	
PT2	12 h post transport	19.47	19.63	13.69 ± 0.78***	
PT3	20.24	21.67	5.68 ± 0.66***	
PT4	20.13	22.09	3.93 ± 0.15***	
PT2	24 h post transport	20.08	19.74	19.31 ± 0.94***	
PT3	20.66	21.91	6.43 ± 0.68***	
PT4	20.72	22.38	4.870.54***	
* p ≤ 0.05, ** p ≤ 0.01 *** p ≤ 0.001 and ns = non-significant

Fig. 3 Showed MUC2 gene expression in all experimental groups at the sampling times and the interaction between group-time factors and the significant differences vs. PT2 group

Antimicrobial peptides (β Defensin– 1 and β defensin − 2)

The expression of the antimicrobial peptides βD-1 and 2 genes at 0 h post transportation non-significantly down-regulated in the PT 2 group and dramatically and significantly up regulated in the PT 3 and PT 4 groups comparing with the P 1 control group. At 12 h, they significantly down regulated in the PT 2 group and non-significant down regulation in the PT 3 and PT 4 groups matching with P 1 control group. At 24 h post transportation they significantly down regulated in the PT 2 and PT 3 groups and non-significant down regulation in the PT 4 group comparing with the P 1 group. Matching with the PT 2 group; the βD-1 and 2 significantly up regulated in the PT 3 and PT 4 groups at 0 h post transportation, and they non significantly up regulated in the PT 3 and PT 4 groups at 12 and 24 h post transportation. (Table 4; Fig. 4).

Table 4 Showed βD-1 and βD-2 genes expression in all experimental groups at point times and the significant differences compared to the control group

Fish group	Time	EF1α	βD-1	βD-2	
CT	CT	Fold change (Mean ± SE)	CT	Fold change (Mean ± SE)	
P1 - Control group	Pre transport	19.36	21.86	-	20.75	-	
PT2 (without Nacl)	0 h post transport	19.34	21.97	0.90 ± 0.03ns	21.05	0.82 ± 0.04ns	
PT3 (5 gL− 1 Nac)l	20.87	20.86	5.70 ± 0.34***	20.59	3.22 ± 0.55***	
PT4 (10 gL− 1 Nacl)	19.63	19.38	6.75 ± 0.29***	18.46	5.91 ± 0.38***	
PT2	12 h post transport	19.47	22.91	0.53 ± 0.08*	22.63	0.30 ± 0.04*	
PT3	20.24	23.23	0.71 ± 0.02ns	22.27	0.64 ± 0.06ns	
PT4	20.13	22.80	0.90 ± 0.07ns	22.00	0.72 ± 0.05ns	
PT2	24 h post transport	20.08	25.18	0.17 ± 0.05***	25.43	0.06 ± 0.02***	
PT3	20.66	24.46	0.41 ± 0.03**	23.60	0.34 ± 0.05*	
PT4	20.72	23.90	0.63 ± 0.05ns	23.02	0.53 ± 0.05ns	
* p ≤ 0.05, ** p ≤ 0.01 *** p ≤ 0.001 and ns = non-significant

Fig. 4 Showed βD-1 and βD-2 genes expression in all experimental groups at the sampling times, the interaction between group-time factors and the significant differences vs. PT2 group

Tumor necrosis factor (TNF) gene expression

The expression of the TNF-alpha gene in O. niloticus was non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups compared to the control group at 0 h post transportation. However at 12 and 24 h post transportation; there was a significant up regulation in gene expression in the PT 2, PT 3 and PT 4 groups. Matching with PT 2 group, TNF non significantly down regulated in the PT 3 group and significantly down regulated in the PT 4 group at 0 h post transportation, however at 12 and 24 h post transportation it significantly down regulated in the PY 3 and PT 4 groups. (Table 5; Fig. 5).

Table 5 Showed TNF gene expression in all experimental groups at the point times and the significant differences vs. the control group

Fish group	Time	EF1α	TNF alpha	
CT	CT	Fold change (Mean ± SE)	
P1 (Control group)	Pre-transport	19.36	22.15	-	
PT2 (without Nacl)	0 h post transport	19.34	21.35	1.73 ± 0.05 ns	
PT3 (5gL− 1 Nacl)	20.87	23.97	0.81 ± 0.10 ns	
PT4 (10gL− 1 Nacl)	19.63	23.13	0.61 ± 0.05 ns	
PT2	12 h post transport	19.47	18.84	10.71 ± 0.59 ***	
PT3	20.24	21.47	2.95 ± 0.20 ***	
PT4	20.13	21.90	2.04 ± 0.20 *	
PT2	24 h post transport	20.08	18.75	17.40 ± 0.85 ***	
PT3	20.66	21.07	5.23 ± 0.61***	
PT4	20.72	21.76	3.38 ± 0.09***	
* p ≤ 0.05, ***p ≤ 0.001 and ns = non-significant

Fig. 5 Showed TNF-α measurement in all experimental groups at different times and the interaction between group-time factors and the significant differences vs. PT2 group

Interleukin − 1β (IL-1β) gene expression

The results showed that the expression of IL-1β gene in O. niloticus was non significantly up-regulated in the PT 2 group and also not significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation. However, at 12 and 24 h post transportation there was significant up regulated of IL-1β in the PT 2 and PT 4 fish groups group and non-significant up regulation in the PT 3 group comparing with the P 1 group. The IL-1β gene expression significantly up regulated in the PT 2, PT 3 and PT 4 fish groups compared to P 1 fish group at 24 h post transportation. Matching with the PT 2 group; the IL-1β gene expression non significantly down regulated at 0 h post transportation and significantly up regulated at 12 and 24 h post transportation in the PT 3 and PT 4 fish groups (Table 6; Fig. 6).

Table 6 Showed IL-1β gene expression in all experimental groups at the sampling times, the interaction between group-time factors and the significant differences vs. the control group

Fish group	Time	EF1α	IL-1β	
CT	CT	Fold change (Mean ± SE)	
P1 (Control group)	Pre-transport	19.36	21.44	-	
PT2 (without Nacl)	0 h post transport	19.34	21.06	1.20 ± 0.14 ns	
PT3 (5gL− 1 Nacl)	20.87	23.32	0.78 ± 0.05 ns	
PT4 (10gL− 1 Nacl)	19.63	22.62	0.54 ± 0.07 ns	
PT2	12 h post transport	19.47	18.41	8.84 ± 0.74***	
PT3	20.24	21.28	2.05 ± 0.13*	
PT4	20.13	21.66	1.47 ± 0.18ns	
PT2	24 h post transport	20.08	18.17	15.89 ± 1.30***	
PT3	20.66	20.74	4.01 ± 0.46***	
PT4	20.72	21.70	2.15 ± 0.04*	
* p ≤ 0.05, ***p ≤ 0.001, ****p ≤ 0.0001 and ns = non-significant

Fig. 6 Showed IL-1β gene expression measurements in all experimental groups and the interaction between group-time factors and the significant differences vs. the PT2 group

Discussion

Many aquaculture operations involve the transportation of live fish from one facility to another or during restocking practices. It has been clarified that the immune response in stressed fish is suppressed [35, 36]. Previous studies on the fish immune response to stress have primarily focused on systemic parameters such as blood cell counts and serum innate immune factors, while neglecting the role of skin immunity. In this study, we investigated the resistance of O. niloticus particularly the skin to live transport as well as the stress mitigation effect of salt.

Regarding the serum cortisol, it was significantly increased at 0 h post transport in PT 2 group transported in water without salt compared to both P 1 control group and PT 3 and PT 4 fish groups transported in water containing salt. This elevation may be attributed to the stressful effect of transportation and the importance of cortisol during stress conditions as it elevates blood glucose and stimulate the central nervous system to restore fish body homeostasis [36]. These results are supported by [9] who mentioned that stressed trout had higher cortisol levels than the control group and [10] who recorded that serum cortisol levels in O. niloticus significantly increased after 5 h transportation in water without salt. A significant decrease in cortisol level was reported in the PT 3 and PT 4 fish groups compare to with PT 2 group at different sampling times, and similar findings were reported in common carp [12], matrinx˜a, Brycon amazonicus [37] and ruho carp, Labeo rohita [23]. This may be indicate that salt minimizes the stressful effect of transportation and enhances fish hydro-mineral balance by reducing the osmolality differences between the transporting water and fish body [38, 39]. Cortisol level significantly decreased and recovered to the basal level at 12 and 24 h post transportation in PT 2 fish groups. This result came in line with [40, 41] who found that the cortisol elevation syndrome recovered after 24 h post stress in juvenile tambaqui colossoma macropomum and Nile tilapia.

The expression of MUC2 gene in O. niloticus non-significantly up regulated in the PT 2 group and non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation comparing with the P 1 group. It significantly up regulated in the PT 2, PT 3 and PT 4 groups at 12 and 24 h post transportation comparing with the P 1 group. However comparing with PT 2 group, it non-significantly down regulated in the PT 3 and PT 4 groups at 0 h post transportation and at 12 and 24 h, it significantly up regulated in the PT 3 and PT 4 groups. Additionally there was a non-significant up regulation in PT 3 group compared to the PT 4 fish group at 0, 12 and 24.

Mucins are important high molecular weight glycoproteins for the physical barrier, mucous viscosity and trapping pathogens in fish [42]. The expression of MUC2 gene in the O. niloticus of the PT 2 group was non significantly up-regulated at 0 h and significantly up-regulated at 12 and 24 h post transportation comparing with P 1 group, this up regulation may be attributed the stressful condition of transportation such as confinement, high ammonia level and shacking. This result is consistent with previous studies [9] who reported a significant up-regulation of mucin gene in trout fish post transportation and [10] who stated that the expression of mucin2 gene was significantly up regulated in O. niloticus after transportation. MUC2 gene expression of PT 3 and PT 4 groups transported in water containing salt was non significantly down regulated compared with P 1 group at 0 h post transportation. This down regulation may be attributed to the sodium chloride mitigates the transportation stress by decreasing the salinity difference between the fish body and the transporting water as well as controlling mucous secretion on the skin [43]. These results are consistent with [10] who recorded significant down regulated of the MUC2 gene expression in O. niloticus transported in water containing 5 gL-1 compared with the fish group transported in water without salt. Additionally [8] and [9] reported an increased cutaneous mucosal secretions and significant up-regulation of mucin genes in response to transport stress.

Antimicrobial peptides are a component of the innate immune system of fish and found on the surface layer of epithelial tissues. They act as the first line of defense against various pathogenic invasions. The significant down-regulation of β D-1 and 2 genes expression in the skin of O. niloticus transported in water without salt (PT 2 group) at 0, 12 and 24 h post transportation may be attributed to the immune suppressive effect of transportation on skin immunity. Similar down regulation of βD-1 and 2 has been reported in rainbow trout [9] and O. niloticus [10] who found that the transportation lead to a significant down regulation of βD -1 and 2 genes expression. The β D -1 and 2 gene expression was up-regulated in the PT 3 and PT 4 groups at 0 h post transportation compared to the PT 2 group, and this may be attributed to the salt mitigated the stress mitigation effect and alleviated the immune suppressive effect of transportation [44]. Moving O. niloticus from transporting water containing salt to freshwater down regulated the expression of β D-1 and 2 genes and subsequently suppressed fish immunity at 12 and 24 h post transportation. These results were supported by [12] who found that the addition of 3 gL− 1 salt to transportation water for common carp mitigated immunosuppression. The results of our work demonstrate that the expression of β defensin 1 and 2 genes could be used as early response marker to acute transportation stress.

The TNF-α and IL-1β cytokines in teleost fish are powerful pro-inflammatory cytokines released by several immune cells during infection or tissue damage [45]. Overall, transportation stress increases the pro-inflammatory cytokines TNF-α, and IL-1β. The results of this study showed a significant up regulation in IL-1β gene expression of the PT 2 group transported in water without salt at 12 and 24 h post transport and non-significant up regulation at 0 h. This result agrees with the results of [10] who reported up regulation of IL-1β gene expression in O. niloticus transported for 5 h in water without salt. The significant up regulation of IL-1β in the PT 2 group indicates that the transported O. niloticus in water without salt may be exposed to stressful condition which stimulates IL-1β production along the 24 h investigation time post transportation because the IL-1β acts as an immune and inflammatory response mediator in fish [46]. The IL-1β gene expression in the PT 3 and PT 4 groups down regulated at 0 h post transportation, that may be attributed to the up regulation of β D-1 and 2 in these groups, which have a fascinating ability to suppress the inflammatory response [47]. The IL-1β gene expression up regulated in the PT 3 and PT 4 group at 12 and 24 h post transportation, that may be attributed to the elevated cortisol level [48] and the down regulation of antimicrobial peptides β D-1 and 2 as a result of moving fish from water containing salt to freshwater.

Fish TNF-α acts as regulator and amplifier for acute and chronic inflammation, it is one of the early immune genes that is expressed at the early stage of infection [49]. It has overlapping functions with IL-1β and able to activate macrophages and enhance their microbial killing activity [46, 50, 51]. TNF α gene expression of O. niloticus in the PT 2 fish group was significantly up regulated at 12 and 24 h post transport and non-significantly up regulated at 0 h compared with the P 1 group, that indicates the transportation increased the skin inflammatory reaction up to 24 h post transportation [52]. In contrast, TNF-α gene expression was down regulated in the PT 3 and PT 4 O. niloticus groups at 0 h post transportation then up regulated at 12 and 24 h post transportation. This may explain the stress mitigation effect of salt during transportation which may extend up to 24 h post transportation.

Conclusion

The O. niloticus group transported in water without salt appeared higher transportation stress effects as evidenced by increased cortisol level and up regulation of Muc2, IL-1B and TNF genes as well as down regulation of β D-1 and 2. However, the addition of sodium chloride to the transportation water had a stress mitigation effect on O. niloticus. This was observed through improvements of fish physiology and mucosal health as well as enhanced skin mucous barrier and immunity; these improvements were more evident in the 5 gL− 1 group than 10 gL− 1 group. Therefore, it is recommended to use 5gL-1 salt during O. niloticus transportation as it is more beneficial and effective in reducing transportation stress. Further research is required to enhance the well-being of O. niloticus during the transportation process.

Acknowledgements

The authors would like to express their gratitude to the Faculty of Veterinary Medicine at Sohag University, Egypt for providing the research labs and experimental platform. Thanks a lot to STDF and EKB for their providing an open access funding.

Author contributions

M.A.A.A., H.A.A.A.H. and A.E.O. contributed to experimental design, sampling, methodology design, serum analysis and gene expression and wrote the draft of the manuscript. H.A.A.A.H., F.E.A.A., M.A.M., A.M.E. and A.E.O. contributed to the analysis of serum biochemical parameters and genes expression, prepared the tables and figures as well as contribute in the manuscript draft writing. All authors had read, revised and approved the final manuscript.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). The Science, Technology and Innovation Funding Authority (STDF) in cooperation with the Egyptian Knowledge Bank (EKB) have provided open access funding. This research was supported by the Faculty of Veterinary Medicine, Sohag University, Egypt.

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

the original data of analysis tests and examination provided within the manuscript are available through the corresponding authar.

Declarations

Ethics approval and consent to participate

The experiment was approved by the Veterinary Medical Ethics Research Committee, Faculty of Veterinary Medicine, Sohag University, Egypt (Code no. Soh.un.vet/00016 M2) and carried out in accordance with the guidelines and regulations issued by the Veterinary Ethics Research Committee, Faculty of Veterinary Medicine. This study follows the ARRIVE guidelines (https://arriveguidelines.org). The informed consent was obtained from all owners.

Consent for publication

This article is not applicable.

Competing of interest

I declare that the authors have no competing interests as defined by BMC, or other interests that might be perceived to influence the results and/or discussion reported in this paper.

Abbreviations

CT Cycle Threshold

DNA Deoxyribonucleic acid

IL-1β Interleukin-1 β

MS-222 Tricaine methanesulfonate

MUC2 Mucin2

O. niloticus Oreochromis niloticus

RNA Ribonucleic acid

TNF Tumor Necrosis Factor

βD-1 β Definsin-1

βD-2 β Definsin-2

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. FAO Cultured. Aquatic Species Information Program, Rome, Italy, 2022.
2. Suprayudi MA Faisal B Setiawati M The growth of red tilapia fed on organic–selenium supplemented diet J Akuakultur Indonesia 2013 12 48 53 10.19027/jai.12.48-53
Suprayudi MA, Faisal B, Setiawati M. The growth of red tilapia fed on organic–selenium supplemented diet. J Akuakultur Indonesia. 2013;12:48–53.10.19027/jai.12.48-53
3. Iverson M Finstad B Mckinley RS Eliassen RA Carlsen KT Evjen T Stress responses in Atlantic salmon Salmo salar L. smolts during commercial well boat transports and effects on survival after transfer to sea Aquaculture 2005 243 373 82 10.1016/j.aquaculture.2004.10.019
Iverson M, Finstad B, Mckinley RS, Eliassen RA, Carlsen KT, Evjen T. Stress responses in Atlantic salmon Salmo salar L. smolts during commercial well boat transports and effects on survival after transfer to sea. Aquaculture. 2005;243:373–82.10.1016/j.aquaculture.2004.10.019
4. Ashley PJ Fish welfare current issues in aquaculture Appl Anim Behav Sci 2007 104 199 235 10.1016/j.applanim.2006.09.001
Ashley PJ. Fish welfare current issues in aquaculture. Appl Anim Behav Sci. 2007;104:199–235.10.1016/j.applanim.2006.09.001
5. Tang S Thorarensen H Brauner CJ Wood CM Farrell AP Modeling the accumulation of CO2 during high density re-circulating transport of adult Atlantic salmon, Salmo salar, from observations aboard a sea–going commercial live–haul vessel Aquaculture 2009 296 102 9 10.1016/j.aquaculture.2009.07.020
Tang S, Thorarensen H, Brauner CJ, Wood CM, Farrell AP. Modeling the accumulation of CO2 during high density re-circulating transport of adult Atlantic salmon, Salmo salar, from observations aboard a sea–going commercial live–haul vessel. Aquaculture. 2009;296:102–9.10.1016/j.aquaculture.2009.07.020
6. Emmanuel BE Fayinka DO Aladetohun NF Transportation and the effects of stocking density on the survival and growth of Nile tilapia Oreochromis Niloticus (Linnaeus) World J Agricultural Sci 2013 1 001 7
Emmanuel BE, Fayinka DO, Aladetohun NF. Transportation and the effects of stocking density on the survival and growth of Nile tilapia Oreochromis Niloticus (Linnaeus). World J Agricultural Sci. 2013;1:001–7.
7. Faught E Vijayan MM Mechanisms of cortisol action in fish hepatocytes Comp Biochem Physiol B Biochem Mol Biol 2016 199 136 45 10.1016/j.cbpb.2016.06.012 27445122
Faught E, Vijayan MM. Mechanisms of cortisol action in fish hepatocytes. Comp Biochem Physiol B Biochem Mol Biol. 2016;199:136–45.27445122 10.1016/j.cbpb.2016.06.012
8. Ángeles EM. An overview of the immunological defenses in fish skin. International Scholarly Research Notices; 2012.
9. Tacchi L, Lowrey L, Musharrafieh R, Crossey K, Larragoite ET, Salinas I. Effects of transportation stress and addition of salt to transport water on the skin mucosal homeostasis of rainbow trout (Oncorhynchus mykiss). Aquaculture 2015; January 1; 435: 120–7.
10. Hanna Heba NS. Effect of transportation on skin immunity of Oreochromis niloticus. PhD, Fish diseases and Management, Faculty of Veterinary Medicine. Sohag University; 2023.
11. Navarro RD França RP Paludo GR Bizarro YWS Silva RF Navarro FKSP Physiological and hematological responses of Nile tilapia Oreochromis Niloticus to different anesthetics during simulated transport conditions Actascitechnol 2016 38 301 6
Navarro RD, França RP, Paludo GR, Bizarro YWS, Silva RF, Navarro FKSP. Physiological and hematological responses of Nile tilapia Oreochromis Niloticus to different anesthetics during simulated transport conditions. Actascitechnol. 2016;38:301–6.
12. Taheri Mirghaed A Ghelichpour M Effects of anesthesia and salt treatment on stress responses, and immunological and hydromineral characteristics of common carp (Cyprinus carpio, Linnaeus, 1758) subjected to transportation Aquaculture 2019 501 1 6 10.1016/j.aquaculture.2018.11.008
Taheri Mirghaed A, Ghelichpour M. Effects of anesthesia and salt treatment on stress responses, and immunological and hydromineral characteristics of common carp (Cyprinus carpio, Linnaeus, 1758) subjected to transportation. Aquaculture. 2019;501:1–6.10.1016/j.aquaculture.2018.11.008
13. Gomes LC Brinn RP Marcon JL Dantas LA Brand˜ao FR De Abreu JS Lemos PEM McComb DM Baldisserotto B benefits of using the probiotic Efinol®L during transportation of cardinal tetra, Paracheirodon axelrodi (Schultz), in the Amazon Aquaculture Res 2009 40 157 65 10.1111/j.1365-2109.2008.02077.x
Gomes LC, Brinn RP, Marcon JL, Dantas LA, Brand˜ao FR, De Abreu JS, Lemos PEM, McComb DM. Baldisserotto B benefits of using the probiotic Efinol®L during transportation of cardinal tetra, Paracheirodon axelrodi (Schultz), in the Amazon. Aquaculture Res. 2009;40:157–65.10.1111/j.1365-2109.2008.02077.x
14. da Silva E de Moraes AV Pereira MDO Bittencourt M Weber RA Jatob´a a Autochthonous and allochthonous dietary probiotics mitigate acute stress in Astyanax bimaculatus during transport Aquac Res 2022 53 3253 6 10.1111/are.15822
da Silva E, de Moraes AV, Pereira MDO, Bittencourt M, Weber RA. Jatob´a a Autochthonous and allochthonous dietary probiotics mitigate acute stress in Astyanax bimaculatus during transport. Aquac Res. 2022;53:3253–6.10.1111/are.15822
15. Hoseini SM Gupta SK Yousefi M Kulikov EV Drukovsky SG Petrov AK Taheri Mirghaed A Hoseinifar SH Van Doan H mitigation of transportation stress in common carp, Cyprinus carpio, by dietary administration of turmeric Aquaculture 2022 546 737380 10.1016/j.aquaculture.2021.737380
Hoseini SM, Gupta SK, Yousefi M, Kulikov EV, Drukovsky SG, Petrov AK, Taheri Mirghaed A, Hoseinifar SH, Van Doan. H mitigation of transportation stress in common carp, Cyprinus carpio, by dietary administration of turmeric. Aquaculture. 2022b;546:737380.10.1016/j.aquaculture.2021.737380
16. Hoseini SM Majidiyan N Mirghaed AT Hoseinifar SH Van Doan H Dietary glycine supplementation alleviates transportation-induced stress in common carp, Cyprinus carpio Aquaculture 2022 551 737959 10.1016/j.aquaculture.2022.737959
Hoseini SM, Majidiyan N, Mirghaed AT, Hoseinifar SH, Van Doan H. Dietary glycine supplementation alleviates transportation-induced stress in common carp, Cyprinus carpio. Aquaculture. 2022a;551:737959.10.1016/j.aquaculture.2022.737959
17. Santos ELR Rezende FP Moron SE Stress-related physiological and histological responses of tambaqui (Colossoma macropomum) to transportation in water with tea tree and clove essential oil anesthetics Aquaculture 2020 523 735164 10.1016/j.aquaculture.2020.735164
Santos ELR, Rezende FP, Moron SE. Stress-related physiological and histological responses of tambaqui (Colossoma macropomum) to transportation in water with tea tree and clove essential oil anesthetics. Aquaculture. 2020;523:735164.10.1016/j.aquaculture.2020.735164
18. Ferreira AL Favero GC Boaventura TP de Freitas Souza C Ferreira NS Descovi SN Baldisserotto B Heinzmann BM Luz RK essential oil of Ocimum gratissimum (Linnaeus, 1753): efficacy for anesthesia and transport of Oreochromis niloticus Fish Physiol Biochem 2021 47 135 52 10.1007/s10695-020-00900-x 33196935
Ferreira AL, Favero GC, Boaventura TP, de Freitas Souza C, Ferreira NS, Descovi SN, Baldisserotto B, Heinzmann BM. Luz RK essential oil of Ocimum gratissimum (Linnaeus, 1753): efficacy for anesthesia and transport of Oreochromis niloticus. Fish Physiol Biochem. 2021;47:135–52.33196935 10.1007/s10695-020-00900-x
19. Boaventura TP Pedras PPC Júlio GSC dos Santos FAC Ferreira AL de Souza Silva W Luz RK Use of eugenol, benzocaine or salt during the transport of panga, Pangasianodon hypophthalmus (Sauvage, 1878): effects on water quality, haematology and blood biochemistry Aquacultre Res 2022 53 1395 403 10.1111/are.15672
Boaventura TP, Pedras PPC, Júlio GSC, dos Santos FAC, Ferreira AL, de Souza Silva W, Luz RK. Use of eugenol, benzocaine or salt during the transport of panga, Pangasianodon hypophthalmus (Sauvage, 1878): effects on water quality, haematology and blood biochemistry. Aquacultre Res. 2022;53:1395–403.10.1111/are.15672
20. Takata R Luz RK Tavares-Dias M Mariano WS Aquicultura no Brasil: novas perspectivas, techniques for aquatic animals 2015 São Carlos Editora Pedro & João 523 43
Takata R, Luz RK. In: Tavares-Dias M, Mariano WS, editors. Aquicultura no Brasil: novas perspectivas, techniques for aquatic animals. São Carlos: Editora Pedro & João; 2015. pp. 523–43.
21. Crosby TC Hill JE Watson CA Yanong RP Strange R Effects of tricaine methane sulfonate, Hypno, metomidate, quinaldine, and salt on plasma cortisol levels following acute stress in three spot gourami Trichogaster trichopterus J Aquat Anim Health 2006 18 58 63 10.1577/H05-026.1
Crosby TC, Hill JE, Watson CA, Yanong RP, Strange R. Effects of tricaine methane sulfonate, Hypno, metomidate, quinaldine, and salt on plasma cortisol levels following acute stress in three spot gourami Trichogaster trichopterus. J Aquat Anim Health. 2006;18:58–63.10.1577/H05-026.1
22. Oyoo-Okoth E Cherop L Ngugi CC Survival and physiological response of Labeo victorianus (Pisces: Cyprinidae, Boulenger 1901) juveniles to transport stress under a salinity gradient Aquaculture 2011 319 226 31 10.1016/j.aquaculture.2011.06.052
Oyoo-Okoth E, Cherop L, Ngugi CC. Survival and physiological response of Labeo victorianus (Pisces: Cyprinidae, Boulenger 1901) juveniles to transport stress under a salinity gradient. Aquaculture. 2011;319:226–31.10.1016/j.aquaculture.2011.06.052
23. Biswal A Srivastava PP Pal P Gupta S Varghese T Jayant M A multi-biomarker approach to evaluate the effect of sodium chloride in alleviating the long-term transportation stress of Labeo rohita fingerlings Aquaculture 2021 531 735979 10.1016/j.aquaculture.2020.735979
Biswal A, Srivastava PP, Pal P, Gupta S, Varghese T. Jayant M A multi-biomarker approach to evaluate the effect of sodium chloride in alleviating the long-term transportation stress of Labeo rohita fingerlings. Aquaculture. 2021;531:735979.10.1016/j.aquaculture.2020.735979
24. Neiffer DL Stamper MA Fish sedation, anesthesia, analgesia, and euthanasia: considerations, methods, and types of drugs ILAR J 2009 50 343 60 10.1093/ilar.50.4.343 19949251
Neiffer DL, Stamper MA. Fish sedation, anesthesia, analgesia, and euthanasia: considerations, methods, and types of drugs. ILAR J. 2009;50:343–60.19949251 10.1093/ilar.50.4.343
25. Tacchi L Larragoite E Salinas I Discovery of J Chain in African Lungfish Protopterus dolloi, Sarcopterygii) using high throughput transcriptome sequencing: implications in mucosal immunity PLoS ONE 2013 8 e70650 10.1371/journal.pone.0070650 23967082
Tacchi L, Larragoite E, Salinas I. Discovery of J Chain in African Lungfish Protopterus dolloi, Sarcopterygii) using high throughput transcriptome sequencing: implications in mucosal immunity. PLoS ONE. 2013;8:e70650. [PubMed: 23967082].23967082 10.1371/journal.pone.0070650
26. Hoseini SM Yousefi M Hoseinifar SH Van Doan H Cytokines’ gene expression, humoral immune and biochemical responses of common carp (Cyprinus carpio, Linnaeus, 1758) to transportation density and recovery in brackish water Aquaculture 2019 504 13 21 10.1016/j.aquaculture.2019.01.049
Hoseini SM, Yousefi M, Hoseinifar SH, Van Doan H. Cytokines’ gene expression, humoral immune and biochemical responses of common carp (Cyprinus carpio, Linnaeus, 1758) to transportation density and recovery in brackish water. Aquaculture. 2019;504:13–21.10.1016/j.aquaculture.2019.01.049
27. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001; 29. [PubMed: 11125041].
28. Gröner F, Zikova A, Kloās W. Effect of the pharmaceutical diclofenac and metoprolol on gene expression levels of enzymes of biotransformation excretion pathways and estrogenicity in primary hepatocytes of Nile tilapia (Oreochromis niloticus). Comparative Biochemistry and Physiology Part C; Toxicology and Pharmacology, 167, 51–7.
29. Midhun SJ Neethu S Arun D Vysakh A Divya L Radhakrishnan EK Jyothis M Dietary supplementation of Bacillus lisheniformis hga8b improves growth parameters, enzymatic profile and gene expression of Oreochromis niloticus Aquaculture 2019 505 289 96 10.1016/j.aquaculture.2019.02.064
Midhun SJ, Neethu S, Arun D, Vysakh A, Divya L, Radhakrishnan EK, Jyothis M. Dietary supplementation of Bacillus lisheniformis hga8b improves growth parameters, enzymatic profile and gene expression of Oreochromis niloticus. Aquaculture. 2019;505:289–96.10.1016/j.aquaculture.2019.02.064
30. Dong JJ Wu F Ye X Sun CF Tian YY Lu MX Zhang R Chen ZH Beta-defensin in Nile tilapia (Oreochromis niloticus): sequence, tissue expression, and anti-bacterial activity of synthetic peptides Gene 2015 566 1 23 31 10.1016/j.gene.2015.04.025 25871516
Dong JJ, Wu F, Ye X, Sun CF, Tian YY, Lu MX, Zhang R, Chen ZH. Beta-defensin in Nile tilapia (Oreochromis niloticus): sequence, tissue expression, and anti-bacterial activity of synthetic peptides. Gene. 2015;566(1):23–31.25871516 10.1016/j.gene.2015.04.025
31. Standen BT Peggs DL Rawling MD Foey A Davies SJ Santos GA Merrifield DL Dietary administration of a commercial mixed –species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus Fish Shellfish Immunol 2016 49 427 35 10.1016/j.fsi.2015.11.037 26672904
Standen BT, Peggs DL, Rawling MD, Foey A, Davies SJ, Santos GA, Merrifield DL. Dietary administration of a commercial mixed –species probiotic improves growth performance and modulates the intestinal immunity of tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2016;49:427–35.26672904 10.1016/j.fsi.2015.11.037
32. Ming C Rui W Liping L Huang T Weiyi H Jain L Sequence and evolution differences of Oreochromis niloticus CXC contribute to the diversification of cellular immune response in tilapias with treatment of streptococcus iniae J Amin Vet Adv 2013 12 3 303 11
Ming C, Rui W, Liping L, Huang T, Weiyi H, Jain L, et al. Sequence and evolution differences of Oreochromis niloticus CXC contribute to the diversification of cellular immune response in tilapias with treatment of streptococcus iniae. J Amin Vet Adv. 2013;12(3):303–11.
33. Yuan JS Reed A Chen F Stewart CN Statistical analysis of real-time PCR data BMC Bioinformatics 2006 7 85 10.1186/1471-2105-7-85 16504059
Yuan JS, Reed A, Chen F, Stewart CN. Statistical analysis of real-time PCR data. BMC Bioinformatics. 2006;7:85.16504059 10.1186/1471-2105-7-85
34. Tort L Stress and immune modulation in fish Dev Comp Immunol 2011 35 12 1366 75 10.1016/j.dci.2011.07.002 21782845
Tort L. Stress and immune modulation in fish. Dev Comp Immunol. 2011;35(12):1366–75.21782845 10.1016/j.dci.2011.07.002
35. Van Kemenade B, Chadzinska M. The impact of stress on immune regulation. Wszechswiat. 2009.
36. Skomal GB Mandelman JW The physiological response to anthropogenic stressors in marine elasmobranch fishes: a review with a focus on the secondary response Comp Biochem Physiol 2012 162A 146 55 10.1016/j.cbpa.2011.10.002
Skomal GB, Mandelman JW. The physiological response to anthropogenic stressors in marine elasmobranch fishes: a review with a focus on the secondary response. Comp Biochem Physiol. 2012;162A:146–55.10.1016/j.cbpa.2011.10.002
37. McDonald G Milligan L Ionic, osmotic and acid-base regulation in stress in fish stress and health in aquaculture 1997 Cambridge Cambridge University Press
McDonald G, Milligan L. Ionic, osmotic and acid-base regulation in stress in fish stress and health in aquaculture. Cambridge: Cambridge University Press; 1997.
38. Sumpter JP The endocrinology of stress Fish stress and health inAquaculture, soc. Exp. Biol. Seminar 1997 Cambridge Cambridge University Press 95 118
Sumpter JP. The endocrinology of stress. Fish stress and health inAquaculture, soc. Exp. Biol. Seminar. Cambridge: Cambridge University Press; 1997. pp. 95–118.
39. Gomes LC Araujo-Lima CARM Roubach AR Chippari-Gomes NP Lopes Urbinati EC Effect of fish density during transportation on stress and mortality of juvenile tambaqui colossoma macropomum J World Aquaculture Soc 2003 34 1 76 84 10.1111/j.1749-7345.2003.tb00041.x
Gomes LC, Araujo-Lima CARM, Roubach AR, Chippari-Gomes NP, Lopes. Urbinati EC Effect of fish density during transportation on stress and mortality of juvenile tambaqui colossoma macropomum. J World Aquaculture Soc. 2003;34(1):76–84.10.1111/j.1749-7345.2003.tb00041.x
40. Sherif AH, Eldessouki EA, Sabry NM, Ali NG. The protective role of iodine and MS-222 against stress response and bacterial infections during Nile tilapia (Oreochromis niloticus) transportation. Aquactic International In; 2022.
41. Johansson ME Hansson GC Immunological aspects of intestinal mucus and mucins Nat Rev Immunol 2016 16 10 639 49 10.1038/nri.2016.88 27498766
Johansson ME, Hansson GC. Immunological aspects of intestinal mucus and mucins. Nat Rev Immunol. 2016;16(10):639–49.27498766 10.1038/nri.2016.88
42. Hoseinifar SH, Mirvaghefi A, Amoozegar MA, Sharifian M, Esteban MA. Modulation of Innate Immune Response, Mucosal Parameters and Disease Resistance, 2015.
43. Noga EJ Ullal AJ Corrales J Fernandes JM Application of antimicrobial polypeptide host defenses to aquaculture: Exploitation of down regulation and up regulation responses Comp Biochem Physiol Part D: Genomics Proteom 2011 6 1 44 54
Noga EJ, Ullal AJ, Corrales J, Fernandes JM. Application of antimicrobial polypeptide host defenses to aquaculture: Exploitation of down regulation and up regulation responses. Comp Biochem Physiol Part D: Genomics Proteom. 2011;6(1):44–54.
44. Hong S Peddie S Campos-Pérez JJ Zou J Secombes CJ The effect of intraperitoneally administered Ce in Rainbow Trout (Oncorhynchus Mykiss) upon synbiotic feeding Fish Shellfish Immun 2003 45 27 32
Hong S, Peddie S, Campos-Pérez JJ, Zou J, Secombes CJ. The effect of intraperitoneally administered Ce in Rainbow Trout (Oncorhynchus Mykiss) upon synbiotic feeding. Fish Shellfish Immun. 2003;45:27–32.
45. Zhulling R, Wang S, Yan C, Yue W, Liangjin T, Jingqui L, Shaoqun W, Liu J, Weiliang G, Yangcan ZG. Effects of dietary mannan oligosaccharide supplementation on growth performance, antioxidant capacity, non-specific immunity and immune-related gene expression of juvenile hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus. March, July 2020;OI 529:735642. 10.1016/j.aquaculture.2020735642
46. Fiona S Julia RD β-Defensins Multifunctional modulators of infection, inflammation and more J Innate Immun 2012 4 4 337 48 10.1159/000336619 22441423
Fiona S, Julia RD, β-Defensins. Multifunctional modulators of infection, inflammation and more. J Innate Immun. 2012;4(4):337–48.22441423 10.1159/000336619
47. Claire H, Holland, John D Lambris The complement system in teleosts Fish Shellfish Immunol. 2002; May; 12 (5): 399–420. 10.1006/fsim.2001.0408
48. Li J Sultan Y Sun Y Zhang S Liu Y Li X Expression analysis of Hsp90α and cytokines in zebrafish caudal fin regeneration Dev Comp Immunol 2021 116 103922 10.1016/j.dci.2020.103922 33186559
Li J, Sultan Y, Sun Y, Zhang S, Liu Y, Li X. Expression analysis of Hsp90α and cytokines in zebrafish caudal fin regeneration. Dev Comp Immunol. 2021;116:103922.33186559 10.1016/j.dci.2020.103922
49. Zhang A Chen D Wei H Du L Zhao T Wang X Zhou H Functional characterization of TNF-α in grass carp head kidney leukocytes: induction and involvement in the regulation of NF-κB signaling Fish Shellfish Immunol 2012 33 1123 32 10.1016/j.fsi.2012.08.029 22981915
Zhang A, Chen D, Wei H, Du L, Zhao T, Wang X, Zhou H. Functional characterization of TNF-α in grass carp head kidney leukocytes: induction and involvement in the regulation of NF-κB signaling. Fish Shellfish Immunol. 2012;33:1123–32.22981915 10.1016/j.fsi.2012.08.029
50. Garcia-Castillo J Chaves-Pozo E Olivares P Pelegrin P Meseguer J Mulero V The tumor necrosis factor alpha of the bony fish seabream exhibits the in vivo proinflammatory and proliferative activities of its mammalian counterparts, yet it functions in a species-specific manner Cell Mol Life Sci 2004 61 1331 40 10.1007/s00018-004-4068-1 15170511
Garcia-Castillo J, Chaves-Pozo E, Olivares P, Pelegrin P, Meseguer J, Mulero V. The tumor necrosis factor alpha of the bony fish seabream exhibits the in vivo proinflammatory and proliferative activities of its mammalian counterparts, yet it functions in a species-specific manner. Cell Mol Life Sci. 2004;61:1331–40.15170511 10.1007/s00018-004-4068-1
51. Zou J Secombes CJ Long S Miller N Clem LW Chinchar VG Molecular identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus punctatus) Dev Comp Immunol 2003 27 845 58 10.1016/S0145-305X(03)00085-5 12880635
Zou J, Secombes CJ, Long S, Miller N, Clem LW, Chinchar VG. Molecular identification and expression analysis of tumor necrosis factor in channel catfish (Ictalurus punctatus). Dev Comp Immunol. 2003;27:845–58.12880635 10.1016/S0145-305X(03)00085-5
52. Gabriel Olmos. Jerònia Lladó Tumor necrosis factor alpha: a link between Neuroinflammation and Excitotoxicity. Hindawi Publishing Corporation, 2014; Mediators of inflammation, Article ID 861231.
