
==== Front
EMBO J
EMBO J
The EMBO Journal
0261-4189
1460-2075
Nature Publishing Group UK London

39039289
158
10.1038/s44318-024-00158-6
Article
T4 DNA polymerase prevents deleterious on-target DNA damage and enhances precise CRISPR editing
http://orcid.org/0000-0002-2353-6399
Yang Qiaoyan 1
Abebe Jonathan S 1
Mai Michelle 1
http://orcid.org/0000-0002-2515-2567
Rudy Gabriella 1
Kim Sang Y 2
http://orcid.org/0000-0003-0044-4632
Devinsky Orrin 3
http://orcid.org/0000-0002-6236-7444
Long Chengzu Chengzu.Long@nyulangone.org

1
1 https://ror.org/005dvqh91 grid.240324.3 0000 0001 2109 4251 NYU Cardiovascular Research Center, Leon H. Charney Division of Cardiology, Department of Medicine, NYU Langone Health, New York, NY USA
2 https://ror.org/005dvqh91 grid.240324.3 0000 0001 2109 4251 Department of Pathology, NYU Langone Health, New York, NY USA
3 grid.240324.3 0000 0001 2109 4251 New York University Langone Comprehensive Epilepsy Center, NYU Langone Health, New York, NY USA
22 7 2024
22 7 2024
9 2024
43 17 37333751
2 7 2023
31 5 2024
13 6 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. Creative Commons Public Domain Dedication waiver http://creativecommons.org/publicdomain/zero/1.0/ applies to the data associated with this article, unless otherwise stated in a credit line to the data, but does not extend to the graphical or creative elements of illustrations, charts, or figures. This waiver removes legal barriers to the re-use and mining of research data. According to standard scholarly practice, it is recommended to provide appropriate citation and attribution whenever technically possible.
Unintended on-target chromosomal alterations induced by CRISPR/Cas9 in mammalian cells are common, particularly large deletions and chromosomal translocations, and present a safety challenge for genome editing. Thus, there is still an unmet need to develop safer and more efficient editing tools. We screened diverse DNA polymerases of distinct origins and identified a T4 DNA polymerase derived from phage T4 that strongly prevents undesired on-target damage while increasing the proportion of precise 1- to 2-base-pair insertions generated during CRISPR/Cas9 editing (termed CasPlus). CasPlus induced substantially fewer on-target large deletions while increasing the efficiency of correcting common frameshift mutations in DMD and restored higher level of dystrophin expression than Cas9-alone in human cardiomyocytes. Moreover, CasPlus greatly reduced the frequency of on-target large deletions during mouse germline editing. In multiplexed guide RNAs mediating gene editing, CasPlus repressed chromosomal translocations while maintaining gene disruption efficiency that was higher or comparable to Cas9 in primary human T cells. Therefore, CasPlus offers a safer and more efficient gene editing strategy to treat pathogenic variants or to introduce genetic modifications in human applications.

Synopsis

While off-target mutations have been carefully addressed, CRISPR/Cas9 mediated genome editing often causes harmful on-target chromosomal alterations. CasPlus combines Cas9 genome editing with an engineered phage T4 DNA polymerase and reduces the incidence of large deletions and chromosomal translocations. CasPlus can be applied to correct disease-causing mutations such as in Duchenne muscular dystrophy (DMD), but also for generating engineered T cells for cell therapy.

CasPlus editing inhibits undesired on-target large deletions while increasing the proportion of precise 1- to 2-base-pair insertions generated during CRISPR/Cas9 editing.

CasPlus efficiently corrects the frameshift mutations in DMD (exon 52 deletions) with fewer on-target DNA damage.

CasPlus greatly reduces the frequency of on-target large deletions in mouse germline editing.

CasPlus represses chromosomal translocation while maintaining gene disruption efficiency that is higher or comparable to Cas9 in multiplex gene-edited human primary T cells.

CasPlus combines Cas9 genome editing with an engineered phage T4 DNA polymerase and reduces the incidence of large deletions and chromosomal translocations.

Keywords

DNA Polymerase
CRISPR/Cas9
On-target Damage
DMD
T Cell
Subject terms

Biotechnology & Synthetic Biology
NYU Langone HealthDepartmental Start-Up Grant Kids Connect Charitable Fundissue-copyright-statement© European Molecular Biology Organization 2024
==== Body
pmcIntroduction

The engineered clustered regularly interspaced short palindromic repeats/CRISPR-associated protein 9 (CRISPR/Cas9)-mediated genome editing has revolutionized genetics (Cong et al, 2013; Jinek et al, 2012; Jinek et al, 2013; Mali et al, 2013). However, Cas9 can generate undesired on-target large deletions (Kosicki et al, 2018; Nahmad et al, 2022b), chromosomal translocations (Stadtmauer et al, 2020), chromothripsis (Leibowitz et al, 2021), and other complex chromosomal rearrangements (Boutin et al, 2022), as well as off-target effect. Although numerous strategies have been developed to minimize CRISPR/Cas9-mediated off-target effects (Uddin et al, 2020), few approaches can mitigate collateral on-target DNA damage (Bothmer et al, 2020; Xin et al, 2022; Yin et al, 2022; Yoo et al, 2022). Base editing and prime editing are CRISPR/Cas-based gene editing technologies which can efficiently and precisely edit genes, but both have limitations. Base editing is not designed to mediate indels and has off-target effects on DNA and RNA. Prime editing has lower editing efficiency than Cas9 when targeting identical genome sites (Anzalone et al, 2020; Anzalone et al, 2019; Gaudelli et al, 2017; Kim et al, 2021; Komor et al, 2016). Prime editing efficiency and fidelity are inhibited by DNA mismatch repair (MMR), which is a highly conserved DNA repair pathway and maintains genomic stability (Ferreira da Silva et al, 2022). Clinical trials with CRISPR/Cas9 therapies are underway (2024), but new tools to efficiently introduce precise edits with minimal byproducts and on-target damage would further advance the genome editing field.

Cas9 cleaves target DNA producing double-strand breaks (DSBs) with blunt ends or staggered ends with 5′ overhangs (Shi et al, 2019). Repairing these ends without exogenous templates usually occurs via non-homologous end joining (cNHEJ) or microhomology-mediated end joining (MMEJ) (Chang et al, 2017). The specific repair pathway determines Cas9 editing outcomes. MMEJ repair requires an end resection and microhomology sequences, and often results in deletions. MMEJ is associated with Cas9-induced on-target large deletions, chromosome translocations and rearrangement (Kosicki et al, 2022; Owens et al, 2019; Sfeir and Symington, 2015). cNHEJ repair directly joins two compatible ends without or with minor end resection, leading to small insertions or deletions (indels) (Mao et al, 2008; Sfeir and Symington, 2015). Comprehensive analyses on Cas9 on-target edits reveal small insertions produced by exogenous template-free Cas9 editing are precise and predictable (Allen et al, 2018; Leenay et al, 2019; Shen et al, 2018). The frequency and pattern of Cas9-generated small insertions depend on the local sequences surrounding the Cas9 cut site (templated insertions) (Shi et al, 2019). Current tools cannot fully control the outcomes of 1- to 2-base-pair (bp) insertions, which can be used to reframe or knockout genes (Bermudez-Cabrera et al, 2021). In budding yeast, Cas9-induced 1–3-bp insertions are attributed to DNA polymerase 4 (Pol 4) (Lemos et al, 2018). Thus, systematic screening gap-filling DNA polymerases may identify enzymes that favor cNHEJ-mediated small insertions during Cas9 editing in mammalian cells. The competition between fill-in and end resection processes in DSB with staggered ends (Cejka and Symington, 2021; Kosicki et al, 2022) suggests that gap-filling DNA polymerases may also inhibit MMEJ-mediated on-target large deletions and chromosome translocations.

Duchenne muscular dystrophy (DMD) is characterized by the degeneration of cardiac and skeletal muscles (O’Brien and Kunkel, 2001) and results from mutations in the X-linked dystrophin gene (DMD) (Muntoni et al, 2003). Deletion of one or more exons is the most common mutation type (Duan et al, 2021). Dilated cardiomyopathy (DCM) is a common and lethal feature (Adorisio et al, 2020). We used CRISPR/Cas9 to correct or bypass the DMD mutations in cultured human cells and mdx mice (Amoasii et al, 2017; Long et al, 2016; Long et al, 2018; Long et al, 2014; Olson, 2021; Zhang et al, 2020; Zhang et al, 2022). However, complex rearrangements can arise during DMD editing due to the repetitive elements, stem-loop structures, and preexisting mutations in this unstable genomic region (Nelson et al, 2019; Oshima et al, 2009). Undesired on-target DNA damage at edited DMD sites, a safety concern in human therapy, were not addressed. CRISPR/Cas9-engineered Chimeric antigen receptor (CAR) T-cell therapy may overcome conventional CAR-T therapy problems, like Graft-versus-host disease (GvHD), CAR-T-cell exhaustion and limited patient T-cell numbers (Depil et al, 2020; Khan and Sarkar, 2022; Labanieh and Mackall, 2023; Sheridan, 2022a). However, unintended chromosomal abnormalities, such as translocations, pose a safety risk with multiplex gene-edited patient T cells (Bothmer et al, 2020; Poirot et al, 2015; Stadtmauer et al, 2020).

Here, we identified a phage DNA polymerase that markedly reduces the on-target large deletions and chromosomal translocations associated with regular Cas9 editing while maintaining an equal or higher editing efficiency of desired products. Our results demonstrate that our Cas9 and DNA Polymerase, termed CasPlus, can more safely and efficiently correct DMD mutation in cardiomyocytes and repress chromosomal translocations in human T cells.

Results

T4 and RB69 DNA polymerases favor small insertions over deletions during Cas9 editing

First, we aimed to identify DNA polymerases that can enhance the fill-in step, leading to a ligation process favoring small insertions over deletions during Cas9 editing in mammalian cells (Fig. 1A). We established a stable HEK293T reporter cell line expressing a mutant tdTomato gene with a 1-bp deletion of adenine (A) at position 151 (tdTomato-del151A) (Fig. 1B). Next, we investigated the effects of DNA polymerases on Cas9 editing. We constructed MCP (MS2 bacteriophage coat protein)-tagged vectors expressing human codon-optimized DNA polymerases which can fill in 5’ overhang, including (1) X-family polymerases Pol λ, Pol μ, and Pol β of human origin, (2) Pol 4 from yeast (Lemos et al, 2018; Ramsden and Asagoshi, 2012), (3) family A polymerases Pol I and Klenow fragment (KF) (Bebenek et al, 1990) from bacteria, and (4) B-family polymerases T4 DNA pol from bacteriophage T4 (Liu et al, 2015) (Fig. 1C).Figure 1 T4 and RB69 DNA polymerases favor small insertions over deletions during Cas9 editing.

(A) Schematic showing the filling-in of Cas9-induced staggered ends by exogenous DNA polymerase. (B) Schematic of the lentiviral vector containing tdTomato-d151A (top) and the gRNA used to target it (bottom). Arrowheads, cut sites; red dash, missing nucleotide; LTR, long terminal repeat. (C) Architecture of vectors expressing distinct DNA polymerases (see “Methods”). L linker, NLS nuclear localization signal. (D) Workflow of the DNA polymerase selection process in tdTomato-d151A reporter cells. tdTomato-d151A reporter cells were transfected with a vector expressing Cas9/BFP/tdTomato-sgRNA and a second vector expressing DNA polymerase/GFP. Three days post-transfection, BFP+GFP+ cells were sorted using FACS. DNA was subsequently extracted, and the targeted region was amplified for deep sequencing. (E, F) Frequencies of Cas9-induced indels in BFP+GFP+ populations with or without co-expression of a distinct DNA polymerase. Each dot represents one biological replicate. (G) Patterns of 2-bp insertions in (E, F). Each dot represents one biological replicate. Source data are available online for this figure.

Initially, we delivered MCP-tagged DNA polymerase in trans along with Cas9 and regular guide RNA (System A). We developed a dual fluorescent assay. tdTomato-d151A reporter cells were transfected with a vector containing Cas9/blue fluorescent protein (BFP)/tdTomato-targeted single guide RNA (tdTomato-sgRNA) alone or combined with a second vector expressing DNA polymerases/green fluorescent protein (GFP). We analyzed the reporter gene editing using fluorescence-activated cell sorting (FACS). To ensure an unbiased evaluation of the indel profile alterations, we assessed the indel profiles in all cells expressing both Cas9 and DNA polymerases (BFP+/GFP+) (Fig. 1D). Sequencing of BFP+/GFP+ populations demonstrated that the co-expression of T4 polymerase with Cas9 resulted in ~38% 2-bp insertions, whereas co-expression of Pol I or KF and Cas9 led to ~6–11% 2-bp insertions (Fig. 1E). No indel profile change was observed in other DNA polymerases with Cas9 comparing Cas9-only control (CTR). Similar results were obtained in BFP+/GFP+ populations when RB69 DNA polymerase (Hogg et al, 2006), a B-family DNA polymerase with 61% amino acid homology to T4 DNA polymerase, was co-expressed, but not when the A-family T7 DNA polymerase was used (Hori et al, 1979) (Fig. 1F). The ratio of templated 2-bp insertions to all the 2-bp insertions is up to 89% in T4 or RB69 treated cells (Fig. 1G), suggesting that T4 and RB69 DNA polymerase enables the fill-in of staggered ends created by Cas9 at tdTomato-d151A site.

To reduce the complexity of samples prior to sequencing analysis, we further sorted transfected BFP+GFP+ cells into two subpopulations: one expressing BFP, GFP, and tdTomato (BFP+GFP+tdTomato+) and the other expressing BFP and GFP but not tdTomato (BFP+GFP+tdTomato–) (Appendix Fig. S1A,1B). We utilized targeted deep sequencing to assess the editing profiles in each population. The ratio of BFP+GFP+tdTomato+ to BFP+GFP+ was comparable between cells transfected with the Cas9-only control (CTR) and those co-transfected with Cas9 and distinct DNA polymerases (Appendix Table S1). Sequencing of targeted region revealed that majority of edits observed in BFP+GFP+tdTomato+ populations were 1-bp insertions (Appendix Fig. S1C). Very few 3n + 2 indels were also detected in BFP+GFP+tdTomato+ populations, indicating that the tdTomato-d151A reporter cell line might contain multiple copies of reporter gene. Targeted sequencing for the BFP+GFP+tdTomato– populations showed co-expression of T4 DNA polymerase with Cas9 substantially increased the frequency of 2-bp insertions, primarily at the expense of deletions whereas no other DNA polymerase tested obviously altered indel profiles compared to CTR (Appendix Fig. S1C). Similar results were obtained in BFP+GFP+tdTomato– populations when RB69 DNA polymerase but not in T7 DNA polymerase was co-expressed. (Appendix Fig. S1D). We observed same trends of indel profile alterations in GFP+tdTomato– populations sorted from tdTomato-d151A reporter cell line, which were transfected either with a vector containing Cas9/GFP/tdTomato-sgRNA alone or in combination with a second vector containing DNA polymerases/GFP (Appendix Fig. S1E–1H). Western blot analysis confirmed expression of DNA polymerases in HEK293T cells (Appendix Fig. S1I). A previous report showed that Pol I and KF combined with Cas9 can increase the frequencies of 1-bp deletions and decrease >1 bp deletions (Yoo et al, 2022). We then further analyzed the proportion of 1-bp deletions to all deletions. At tdTomato-d151A site, we did not detect obvious alterations in 1-bp deletions in Pol I- and KF-treated cells compared to those in CTR (Appendix Fig. S1J), indicating this effect may be guide RNA context-dependent. Subsequent experiments focused on T4 DNA polymerase because it was among the top two most efficient enzymes that favor small insertions in the tested target sites.

We next assessed whether tethering of T4 DNA polymerase to Cas9-induced DSBs using MS2-modifed guide RNA (System B) could further improve small insertions. We engineered tdTomato MS2-sgRNA by incorporating MS2 stem-loops into the classical sgRNA scaffold region (Konermann et al, 2015). We compared the editing profiles at the tdTomato-d151A site produced by co-expression of MCP-tagged T4 DNA polymerase in trans along with Cas9/tdTomato-sgRNA to that with Cas9/tdTomato MS2-sgRNA. We confirmed that the untethered (System A) and MS2-tethered T4 DNA polymerase (System B) was comparable in favoring 2-bp insertions at the tdTomato-d151A site (Appendix Fig. S1K), potentially because of the saturated expression of T4 DNA polymerase when delivered as vectors in vitro, especially after cell sorting. These results indicate MCP-tag is dispensable for T4 DNA polymerase function when delivered in trans with Cas9 in vitro. Therefore, all subsequent in vitro experiments, unless otherwise noted, utilized the untethered system, consisting of MCP-tagged T4 DNA polymerase delivered in trans with Cas9 and guide RNAs in a classical scaffold.

Our next investigation focused on the impact of T4 DNA polymerase on Cas9 editing when fused to the N-terminus or C-terminus of Cas9 via a flexible linker (System C). Unlike co-expression of Cas9 and T4 DNA polymerase in System A and B, Cas9 fused T4 DNA polymerase proteins (T4-L-SpCas9 and Cas9-L-T4) strongly induced deletions at the protospacer-adjacent motif (PAM) distal region at tdTomato-d151A site (Appendix Fig. S1L–1N). An obvious increase of deletions at PAM distal region were also detected at CLCN5 site in T4-L-SpCas9 or Cas9-L-T4 edited cells (Appendix Fig. S1O,1P), which differs from previous observation that Cas9 and DNA Pol I/KF fusion protein can enhance 1-bp deletions at the expense of >1 bp deletions at CLCN5 site with the same guide RNA tested (Yoo et al, 2022). T4 DNA polymerase possesses a polymerase activity that extends the polynucleotide chain, and a 3′-to-5′ proofreading exonuclease activity that excises erroneously incorporated nucleotides (Capson et al, 1992). The 3’-to-5’ exonuclease activity of T4 DNA polymerase is much higher than that of DNA polymerase I or KF (Kucera and Nichols, 2008). Structure studies on the Cas9/guide RNA and targeted DNA complex reveal that the non-complementary 3’ single-strand DNA (ssDNA) are displaced upon formation of RNA-DNA R-loop (Jore et al, 2011). Hence, we hypothesized that, when T4 DNA polymerase fused to Cas9, its robust exonuclease domain might degrade the displaced 3’ ssDNA at the PAM distal region, leading to relatively large deletions at PAM distal (Appendix Fig. S1Q). Hence, we deactivated the exonuclease domain of T4 DNA polymerase in T4-L-SpCas9 and Cas9-L-T4 by changing Asp-219 reside to Ala (T4-D219A) or inactivated the T4 DNA polymerase domain in T4-L-SpCas9 and Cas9-L-T4 by substituting the Asn-214 reside to Ser (T4-D214S) (Abdus Sattar et al, 1996). High-throughput sequencing (HTS) results demonstrated that the mutation of T4-D219A, but not T4-D214S, eliminated the increased frequency of deletions at the PAM distal region at tdTomato-d151A site induced by T4-L-SpCas9 and Cas9-L-T4 relative to Cas9-only (Appendix Fig. S1R,1S). T4-D219A mutant also abolished the improved deletions induced by T4-L-SpCas9 or SpCas9-L-T4 at CLCN5 site (Appendix Fig. S1T), further confirming this hypothesis.

We next assessed the impact of T4 DNA polymerase on Cas9 editing on the endogenous loci. We designed 26 guide RNAs (gRNAs) targeting multiple pathogenic genes with different chromosomal locations (TS1–TS26; Appendix Fig. S1U). Compared to the Cas9-only treatment control (CTR), T4 DNA polymerase selectively increased 1–2-bp insertions over deletions (≥1-bp) or increased 1–2-bp deletions over ≥3-bp deletions, depending on the gRNA context (Appendix Fig. S1V–1Z); Among the 16 guide RNAs that favored 1-bp insertions with Cas9 and T4 DNA polymerase, 11 (68.8%) contained an adenine (A) or thymine (T) while 5 (31.2%) contained an guanine (G) or cytosine (C) at position −4 (counting the NGG PAM sequences as nucleotides 0–2). Among the ten guide RNAs that biased for 1-bp deletions, six (60%) had an identical nucleotide at positions −4 and −3 while 4 (40%) had a repeating nucleotide at positions −5 and −4. All four guide RNAs that contained a repeating nucleotide at positions −4 and −2 or −5 and −3 led to deletions of the repeating nucleotide and intervening nucleotide (Appendix Fig. S1Z). Collectively, these results reveal that T4 DNA polymerase favors small insertions over deletions, or small deletions (1–2-bp) over ≥3-bp deletions depending on the cleavage site sequences. We refer to this novel gene editing platform—phage T4 DNA polymerase associated with Cas9—as CasPlus editing.

Improved CasPlus editing efficiency via engineered T4 DNA polymerase

We hypothesized that site-directed mutagenesis on the exonuclease or T4 DNA polymerase domains might affect the fill-in step and change the CasPlus editing efficiency (Fig. 2A). We constructed seven T4 DNA polymerase mutants with a decreased or increased DNA mutation frequency relative to wild-type T4 DNA polymerase (T4-WT), and one N-terminal truncation mutant lacking the exonuclease domain (Δ1–377) (Abdus Sattar et al, 1996; Reha-Krantz, 1988; Reha-Krantz, 1998; Reha-Krantz et al, 1991) (Fig. 2B). Compared to T4-WT, Asp-219 residue to Ala mutant (T4-D219A), had 2.4-fold more 1-bp insertions, at the expense of deletions at TS11 (Fig. 2C). T4-WT and the T4 DNA polymerase mutants exhibited similar 1-bp insertion patterns at TS11 (Appendix Fig. S2A). T4-D219A led to up to sixfold increases in 1-bp insertions at the expense of deletions across 17 genomic sites tested (Appendix Fig. S2B–2D). Mutations changing the Asp-222 residue to Ala in RB69 DNA polymerase (RB69-D222A) (Hogg et al, 2006) also resulted in a twofold to fourfold higher frequency of 1-bp insertions at the TS2, TS11, and TS12 than RB69-WT (Appendix Fig. S2E). Together, these results support that CasPlus editing enhances precise 1-bp insertions, with T4-D219A outperforming T4-WT and RB69-D222A outperforming RB69-WT.Figure 2 Engineered T4 DNA polymerase mutants and Cas9 variants improve CasPlus editing efficiency.

(A) Cas9-induced staggered ends can be processed for either end resection that generates deletions, or fill-in that produces insertions. T4 DNA polymerase mutants can enhance the fill-in process, thereby increasing 1–2-bp insertions. (B) Schematic showing the amino acid alterations introduced into T4 DNA polymerase; the corresponding relative mutation frequencies are below. NA non-available. (C) Frequency of Cas9-induced indels at TS11 with or without T4 DNA polymerase mutants. Each dot represents one biological replicate. (D) At target sites where Cas9-WT often generates blunt ends, leading to deletions (left), engineered Cas9 variants can preferentially generate staggered ends with 1-bp overhangs, enabling T4 DNA polymerase to produce 1-bp insertions (right). (E) Amino acid alterations introduced within Cas9. (F, G) Frequency of Cas9-induced indels at TS11 in cells transfected with Cas9-WT or distinct Cas9 variants individually (F) or along with T4-WT (G). Each dot represents one biological replicate. (H) Four distinct versions of the T4 DNA polymerase-mediated CasPlus system. Source data are available online for this figure.

We compared CasPlus and prime editing (PE) in generation of 1-bp insertions at position −4 of TS5 and TS10 (Appendix Fig. S2F). For each target site, we screened four prime editing guide RNAs (pegRNAs) varying in sizes of reverse transcriptase templates (RTT) and prime binding sequences (PBS) and selected the most efficient pegRNA for comparison (Appendix Table S2). PE3 resulted in ~16.1% 1-bp insertions without undesired indels at TS5 and ~8.2% 1-bp insertions without undesired indels at TS10 while Cas9 combined with T4-D219A induced ~72.3% 1-bp insertions and ~4.8% undesired indels at TS5 and ~48.8% 1-bp insertions and ~4.4% undesired indels at TS10 (Appendix Fig. S2G). These results indicated that, at certain defined genome sites, CasPlus editing could be a more efficient approach in introducing precise 1-bp insertions than prime editing.

To further investigate the capabilities of T4 DNA polymerase in favoring small insertions with other Cas proteins, we tested Cas12a, an RNA-guided endonuclease that creates 5′ staggered ends with 5–8-bp overhangs(Zetsche et al, 2015). We reasoned that T4 DNA polymerase could fill in those overhangs, creating 5–8 nucleotides insertions. Because the Cas12a cleaves the target DNA at the distal end of PAM (18–25 bp away), Cas12a can recut the allele until an indel produced upstream of the insertions to prevent recutting (Appendix Fig. S2H). Thus, we co-expressed T4 DNA polymerase along with Cas12a and guide RNA-Lb1 into cells and analyzed the proportion of alleles containing 5–8 nucleotides insertions. As expected, T4-WT and T4-D219A substantially increased the frequency of alleles carrying 5–8 nucleotide insertions compared to Cas12a-only treatment (Appendix Fig. S2I,2J). Hence, with Cas12a, T4 DNA polymerase was also capable of filling in the 5′ staggered ends with 5–8-bp overhangs, which is consistent with our results in Cas9-mediated editing.

Combining Cas9 variants with T4 DNA polymerase expands the target range for CasPlus editing

CasPlus editing requires Cas9 to generate DNA ends with 5′ overhangs. Certain Cas9 variants preferentially produce staggered ends with 1-bp overhangs, while wild-type Cas9 (Cas9-WT) mainly generates blunt ends at cleavage sites (Jiang et al, 2016; Shou et al, 2018). We hypothesized that combining these Cas9 variants with T4 DNA polymerase would favor 1-bp insertions at target sites (Fig. 2D,2E). At TS11, the Cas9 variants F916P, F916del, R919P, and Q920P produced an average of 15% 1-bp insertions, whereas Cas9-WT produced <5% 1-bp insertions (Fig. 2F). Combining these Cas9 variants with T4-WT resulted in an average of ~50% 1-bp insertions and ~4.5% deletions whereas combining Cas9-WT and T4-WT yielded ~15% 1-bp insertions and ~59% deletions (Fig. 2G). We tested five target sites that rarely induced 1-bp insertions by Cas9-WT with or without T4-WT. Cas9-F916P led to an average 4.3-fold and Cas9-F916del led to an average 5.1-fold increase in 1-bp insertions at the expense of deletions across the five target sites with T4-D219A compared to Cas9-WT or Cas9 variants alone (Appendix Fig. S2K). Our strategy expanded targetable sites for CasPlus editing for precise insertions. We predicted that Cas9 variants with T4 DNA polymerase could produce longer insertions (2–4-bp) at target sites where Cas9-WT and T4-WT only produce 1–3-bp insertions (Appendix Fig. S2L). With T4-WT, Cas9 variants F916P, F916del, or Q920P substantially increased 3-bp insertions at tdTomato-d151A site where Cas9-WT produced 2-bp insertions (Appendix Fig. S2M,2N). With T4-WT or T4-D219A, Cas9-F916P and Cas9-F916del promoted 2-bp insertions at TS5, 3-bp insertions at TS17, and 4-bp insertions at TS18 whereas Cas9-WT produced 1-bp insertions at TS5, 2-bp insertions at TS17 and 3-bp insertions at TS18 (Appendix Fig. S2O).

The four versions of the CasPlus system (Fig. 2H) generate distinct editing outcomes. At target sites where CasPlus-V1 predominantly favors 1–3-bp insertions, CasPlus-V2 offers even higher efficiency. CasPlus-V3 and -V4 can increase insertion length by 1 bp. At target sites where CasPlus-V1 mainly generates 1- or 2-bp deletions, CasPlus-V2, -V3, and -V4 favor 1-bp insertions (Appendix Fig. S2P).

CasPlus enhanced the efficiency of DMD (exon 52 deletion) correction

CasPlus editing enhances 1–2-bp insertions, which can efficiently correct diverse disease-causing frameshift mutations, such as those found in DMD mutations with deleted exons. Precise insertion of 1 bp at the 3′ end of exon 51 or the 5′ end of exon 53 could reframe mutated DMD with exon 52 deleted (Fig. 3A). We generated all gRNAs targeted exon 51 or exon 53 which can potentially reframe DMD del exon 52 and determined their editing efficiencies in HEK293T cells (Fig. 3B). The gRNAs G10 and Ex51-G2 targeting exon 51 and G9 and Ex53-G3 targeting exon 53 had higher editing efficiencies compared to other gRNAs (Fig. 3C). Consistent with gRNA G10 and G9 (Appendix Fig. S2B), Ex51-G2 and Ex53-G3, when used with CasPlus-V1 or -V2, resulted in a 1.6-to-2-fold increase in correction efficiency compared to Cas9-only samples, primarily due to the increased 1-bp insertions (Appendix Fig. S3A). Compared to Cas9, CasPlus editing is more flexible and efficient in correcting DMD mutations. Using CasPlus-V1 and -V2, gRNA G10 led to a 4.3-to-6.5-fold increased correction efficiency in exon 51, and gRNA G9 increased correction efficiency by 2.1-to-2.5-fold in exon 53 versus using Cas9-only in a human induced pluripotent stem cell (iPSC) line with DMD exon 52 deletion (DMD-del52). (Fig. 3D; Appendix Fig. S3B). We differentiated the pool of edited iPSCs and a single clone (SC) with 1-bp insertion into cardiomyocytes (iCMs). Compared to Cas9 editing, frequencies of in-frame mRNAs (3n + 1) in iCMs resulting from CasPlus-V1 and -V2 editing were ~2.5-fold higher in exon 51 and ~1.5-fold higher in exon 53 (Fig. 3E). Western blot analysis confirmed that CasPlus-V1 and -V2 editing produced 1.5-to-3-fold higher dystrophin expression than Cas9-only editing (Fig. 3F).Figure 3 CasPlus enhanced efficiency of DMD (exon 52 deletion) correction.

(A) Deletion of DMD exon 52 creates a premature stop codon in exon 53, preventing dystrophin expression. Two CasPlus editing strategies can restore dystrophin expression by generating 1-bp insertions. (B) All potential gRNA sequences with an NGG PAM on DMD exons 51 and 53 available for restoring the DMD exon 52 deletion mutation. Red, premature stop codon. (C) Frequencies of in-frame (3n + 1) and out-of-frame (3n or 3n + 2) indels induced by Cas9 with gRNAs described in (B) in HEK293T cells. Frequencies were calculated based on ICE analysis on Sanger sequencing files. Each dot represents one biological replicate. (D) Frequencies of in-frame (3n + 1) and out-of-frame (3n or 3n + 2) indels induced by Cas9, CasPlus-V1, and CasPlus-V2 with gRNA G10 or G9 in DMD-del52 iPSCs. Each dot represents one biological replicate. (E) Edited DMD-del52 iPSCs described in (D) were differentiated into iCMs and then in-frame (3n + 1) and out-of-frame (3n or 3n + 2) indels on the mRNA levels were analyzed by HTS. Each dot represents one biological replicate. (F) Western blot analysis of the expression of dystrophin and vinculin in DMD-WT iCMs, untreated DMD-del52 iCMs, DMD-del52 iCMs differentiated from iPSCs with edits at DMD exon 51 (left) or 53 (right), or DMD-del52 single clone containing 1-bp insertions. The normalized dystrophin quantitation is shown below the gel image. Source data are available online for this figure.

To investigate whether co-expression of T4 DNA polymerase and Cas9 increases genome-wide off-target effects, we performed whole-genome sequencing (WGS) in HEK293T cells with or without Cas9 or CasPlus editing using gRNA G10 (Appendix Table S3). We observed no apparent differences in insertion/deletion (indel) or single-nucleotide polymorphism (SNP) profiles when comparing CasPlus to Cas9 editing (Appendix Fig. S3C–3F; Appendix Table S4). We did not detect gene editing in Cas9- or CasPlus-edited cells at off-target sites predicted by Cas-OFFinder (Bae et al, 2014) (Appendix Fig. S3G,3H; Appendix Table S5). Phage T4 DNA polymerase is essential for replication of phage genome (De Waard et al, 1965). To assess the impact of transient co-expression of engineered T4 DNA polymerase and Cas9 on cell cycle progression, we stained the transfected HEK293T cells using propidium iodide (PI) and measured the distribution of cells in three major phases of the cycle (G1, S, and G2/M) via flow cytometry. A slight but not significant increase of cells in S phase was observed in cells with CasPlus-V1 but not CasPlus-V2 editing verse Cas9 editing. Collectively, these results indicate that CasPlus potentially did not raise additional safety concerns compared to Cas9 editing (Appendix Fig. S3I).

Repression of on-target large deletions by CasPlus editing in iPSCs

Unexpected on-target large deletions can arise from the long-range end resection that occurs during Cas9 editing (Yoo et al, 2022) (Fig. 4A). In our corrected DMD-del52 iCMs, at the mRNA level, we detected the unexpected skipping of the whole exon 51 using gRNA G10 and exon 53 using gRNA G9 in Cas9-only editing (Appendix Fig. S4A,4B). We speculated that these exons loss resulted from unexpected on-target large deletions which eliminate exon 51 or exon 53. To investigate this, we PCR-amplified a ~ 2-kilobase (kb) region in pools of edited cells (Appendix Fig. S4C). We observed several lower bands representing deletions of ~0.5 kb distal to gRNA G10 and ~1.2 kb distal to gRNA G9 in Cas9-only but not CasPlus-edited iPSCs and iCMs (Fig. 4B; Appendix Fig. S4D–4G). We amplified a ~5-kb region around the DMD exon 51 and 53 target sites from pools of edited iPSCs and sequenced the PCR amplicons using PacBio sequencing technology. Up to 23.0% of the PacBio reads contained deletions of 200–3000 bp around the exon 51 cleavage site in Cas9-edited cells (Fig. 4C; Appendix Fig. S4H; Appendix Table S6). This on-target effect was not observed in untreated cells or cells edited with CasPlus-V1 or -V2. In untreated cells, we detected ~3-kb deletions around DMD exon 53 in 13.2% of the PacBio reads. This result likely resulted from an artifact due to PCR amplification process, as 3-kb deletions of similar scale were observed in all tested cells [Cas9 (11.1%); CasPlus-V1 (9.4%); CasPlus-V2 (14.8%)]. On DMD exon 53, reads with deletions of 200–3,500 bp around the cut site were 2.8- to 5.1-fold less frequent in cells edited with CasPlus-V1 (9.5%) and -V2 (17.4%) versus Cas9 (48.9%) (Fig. 4D; Appendix Fig. S4H; Appendix Table S6). We genotyped single clones sorted from edited iPSC pools to confirm our results. Three of 33 clones (9.1%) using Cas9 with gRNA G10 and three of 13 clones (23.1%) using Cas9 with gRNA G9 contained deletions of 300 bp to 10 kb. No clones from CasPlus-V1- or CasPlus-V2-edited cells had deletions >150 bp (Fig. 4E; Appendix Fig. S4I–4K). To investigate whether CasPlus editing could inhibit on-target large deletions on other genomic loci, we used a flow cytometric assay (Kosicki et al, 2022; Kosicki et al, 2018) to detect and isolate cells containing large deletions and more complex rearrangements on the X-linked PIGA gene. We transfected male iPSCs with a gRNA targeted the intron 1 and observed a significant decrease in the frequency of PIGA− populations in cells treated with CasPlus verse Cas9 (Appendix Fig. S4L). Genotyping of single clones from PIGA− populations confirmed that all clones contained large deletions (>265 bp) resulting in partial or entire deletion of exon 2 (Appendix Fig. S4M). Thus, CasPlus efficiently represses on-target large deletions in mammalian cells.Figure 4 Repression of on-target large deletions by CasPlus editing in iPSCs.

(A) CasPlus editing represses the generation of large deletions by counteracting the long-term end-resection process. (B) Representative gel images showing the PCR products amplified from DMD-WT iPSCs, untreated DMD-del52 iPSCs or DMD-del52 iPSCs with edits at DMD exon 51 (left) or 53 (right). Lower bands (red arrowheads) were purified and sequenced. (C, D) Depth of PacBio reads at DMD exon 51 (C) or 53 (D) in untreated, Cas9-, CasPlus-V1-, and CasPlus-V2-edited DMD-del52 iPSCs. (E) Table summarizing the number of unedited single clones and single clones containing 1-bp insertions or deletions with different sizes. Single clones were isolated from Cas9-, CasPlus-V1-, and CasPlus-V2-edited DMD-del52 iPSCs. Source data are available online for this figure.

Repression of on-target large deletions by CasPlus editing in mouse germline

On-targe large deletions frequently occur during CRISPR/Cas9-mediated mouse embryo editing (Adikusuma et al, 2018; Papathanasiou et al, 2021). To evaluate the capacity of CasPlus editing in inhibiting on-target large deletions for mouse embryo editing, we microinjected Cas9 mRNA and gRNA against Mybpc3 alone (Cas9) or combined with T4-WT (CasPlus-V1) or T4-D219A (CasPlus-V2) mRNA into fertilized mouse zygotes. Four days later, we harvested the embryo for future analysis (Fig. 5A). The editing efficiency of each embryo varied between 80 and 100% in both Cas9- and CasPlus-edited group (Appendix Fig. S5A). To assess the presence of large deletions, we performed multiple PCRs to amplify the proximal, distant, or both side of the PAM. Full-length and lower molecular mass PCR bands were analyzed by Sanger sequencing (Fig. 5B; Appendix Fig. S5B). The sequencing results showed that 8/10 embryos (80%) treated with Cas9, and 3/10 embryos (30%) treated with CasPlus-V1 or V2 harbored >500 bp large deletions (Fig. 5C,5D; Appendix Fig. S5C,5D). Collectively, these results indicated that CasPlus-V1- and -V2 editing efficiently repressed Cas9-mediated on-target large deletions in mouse germline editing.Figure 5 Repression of on-target large deletions by CasPlus editing in mouse germline.

(A) At day 0, Fertilized mouse zygotes were microinjected with Cas9 mRNA and a sgRNA alone or combined with T4 DNA polymerase mRNA. At day 4, all embryos were collected for analysis. (B) Top schematic illustrating the sizes and locations of the three PCR amplicons used to detect large deletions. Gel images showing the PCR result for PCR3. Small molecular mass products (red arrowheads) were sequenced. Asterisk, non-specific bands. (C) The sequencing results for the small molecular mass products observed in (B). (D) Table summarizing the total number of embryos tested, the number of tested embryos containing small deletions (<500 bp) and the number of tested embryos containing large deletions (>500 bp) in Cas9, CasPlus-V1- or -V2 edited group. Source data are available online for this figure.

Repression of on-target chromosomal translocations during multiplex gene editing by CasPlus editing in primary T cells

Chromosomal translocations can occur when two simultaneous DSBs are present on two chromosomes during Cas9-mediated single-gene editing or multiple gene editing (Amit et al, 2021). To investigate whether CasPlus editing can reduce chromosomal translocations, we recapitulated translocation events between the genes CD74 (chromosome 5) and ROS1 (chromosome 6) in HEK293T cells (Choi and Meyerson, 2014) (Appendix Fig. S6A). We PCR-amplified the breakpoint junction regions on the fused chromosomes and assessed translocation efficiencies. The translocation frequencies between CD74 and ROS1 were ~fivefold lower with CasPlus-V1 and ~2-fold lower with CasPlus-V2 versus Cas9 editing (Appendix Fig. S6B,6C). The frequencies of insertions at ROS1 and CD74 individual sites were higher with CasPlus-V1 and -V2 editing compared to Cas9 (Appendix Fig. S6D). We observed similar trends of repression of chromosomal translocations in iPSCs (Appendix Fig. S6E–6G). Genotyping revealed that three of 95 clones (3.2%) from the Cas9-edited iPSC pool but no clones from the CasPlus-edited iPSC pools contained ROS1-CD74 and CD74-ROS1 translocations (Appendix Fig. S6H–6K).

In a clinical trial (NCT03399448), chromosomal translocations were frequently observed between targeted chromosomes in Cas9-engineered T cells when delivered with three gRNAs targeting PDCD1, TRBC1/2, and TRAC genes on different chromosomes (Stadtmauer et al, 2020). We compared the same three gRNAs with Cas9 or CasPlus to assess translocations in these three chromosomes in HEK293T cells (Fig. 6A; Appendix Fig. S6L). PCR demonstrated that CasPlus-V1 led to a 2.5-to-4.5-fold decrease in all translocation types in the three chromosomes (Fig. 6B,6C; Appendix Fig. S6M,6N). TaqMan assays revealed that CasPlus-V1 decreased an average 5.8-fold, and CasPlus-V2 decreased an average 3.9-fold translocations compared to Cas9 editing (Fig. 6D). CasPlus-V1 editing induced similar gene disruption efficiency to Cas9 editing for four genes (Fig. 6E). CasPlus-V2 induced a similar gene disruption efficiency but was less effective in repressing chromosomal translocations compared to CasPlus-V1. We recommended CasPlus-V1 to generate CAR-T cells.Figure 6 Repression of on-target chromosomal translocations during multiplex gene editing by CasPlus editing in primary T cells.

(A) Schematic illustrating the balanced translocations among genes PDCD1, TRBC1/2, and TRAC. (B) Representative gel images demonstrating the balanced translocations detected in HEK293T cells during Cas9, CasPlus-V1, or CasPlus-V2 editing (see “Methods”). Balanced translocation of Chr14-Chr2: TRAC-PDCD1 was undetectable by PCR. Bands with expected size (red arrowheads) were purified, TA-cloned and sequenced (one of the TA clone results was show for each type of translocation). Asterisk, non-specific bands. (C) Normalized quantification of data in (B). Each dot represents one biological replicate. (D) Evaluation of balanced chromosomal translocations in HEK293T cells during Cas9, CasPlus-V1, or CasPlus-V2 editing by TaqMan assay (see “Methods”). For each assay, the translocation efficiency in Cas9-edited cells is set as 1. Each dot represents one biological replicate. (E) Frequencies of out-of-frame and in-frame indels at four individual sites in HEK293T cells during Cas9, CasPlus-V1, or CasPlus-V2 editing. Frequencies were calculated based on ICE analysis on Sanger sequencing files. Each dot represents one biological replicate. (F) Representative gel images demonstrating the balanced translocations detected in primary human T cells during Cas9, CasPlus-V1, or CasPlus-V2 editing (see “Methods”). Balanced translocation of Chr14-Chr7: TRAC-TRBC1 and Chr2-Chr7: PDCD1-TRBC1 was undetectable by PCR. (G) Normalized quantification of data in (F). Values and error bars reflect mean ± SEM of n = 3 replicates from two donors. (H) Evaluation of balanced chromosomal translocations in primary human T cells during Cas9, CasPlus-V1, or CasPlus-V2 editing by TaqMan assay (see “Methods”). Values and error bars reflect mean ± SEM of n = 3 replicates from two donors. (I) Frequencies of out-of-frame and in-frame indels at four individual sites in primary human T cells during Cas9, CasPlus-V1, or CasPlus-V2 editing. Frequencies were calculated based on ICE analysis on Sanger sequencing files. Values and error bars reflect mean ± SEM of n = 3 replicates from two donors. Source data are available online for this figure.

We investigated CasPlus editing efficacy in suppressing chromosomal translocations among genes PDCD1, TRBC1/2 and TRAC in primary human T cells. First, we nucleofected the activated primary human T cells with Cas9 mRNA and PDCD1, TRBC1/2 and TRAC sgRNAs alone (Cas9) or in conjunction with T4-WT (CasPlus-V1) or T4-D219A (CasPlus-V2) mRNA. Four days after mRNA introduction, we accessed translocations using PCR and TaqMan assay. CasPlus-V1 induced 1.5-to-11-fold fewer translocations than Cas9 editing in PCR assays (Fig. 6F,6G). TaqMan assays confirmed that CasPlus-V1 reduced translocations by 1.2-to-4.3-fold relative to Cas9 (Fig. 6H). As in HEK293T cells, CasPlus-V2 also suppressed translocations but was less efficient compared to CasPlus-V1. Analysis of the on-target gene editing through sequencing revealed that CasPlus editing had similar knockout efficiency at PDCD1, TRBC1/2, and TRAC sites in T cells (Fig. 6I). Together, our findings indicate that CasPlus editing significantly inhibits Cas9-mediated on-target chromosomal translocations and offers a potentially safer editing strategy to engineer T-cell and other ex vivo cell therapies.

Discussion

Despite the successes achieved with all CRISPR/Cas-based genome editing technologies, including base editing and prime editing, the clinical potential of the technologies is currently constrained by the safety and efficacy concerns in cultured cells and animal models, and likely in humans. Unexpected on-target large deletions and chromosomal translocations from Cas9 editing are an emerging risk factors for in vitro, in vivo and ex vivo applications (Kosicki et al, 2018; Leibowitz et al, 2021; Nahmad et al, 2022a; Stadtmauer et al, 2020). Our results show that in cultured human cells, the CasPlus editing platform can substantially reduce deleterious on-target large deletions and chromosomal translocations while maintaining equal or higher efficiency of desired edits (Appendix Fig. S6O). Future research will assess the safety and efficacy of CasPlus in animal models using adeno-associated virus and lipid nanoparticles delivery systems.

CasPlus utilizes T4 DNA polymerase to fill in the staggered end created by Cas9 or Cas9 variants, producing small insertions and reducing relatively large deletions. Fusion of DNA polymerase I or KF to Cas9 could increase the frequency of 1-bp deletions over >1 deletions by counteracting the DNA resection process (Yoo et al, 2022). We did not observe similar results when co-expressing DNA polymerase I or KF with Cas9 at the tdTomato-d151A site, which may reflect a sequence-specific effect. In addition, fusionT4-L-Cas9 and Cas9-L-T4 increased relatively large deletions (<25 bp) at the PAM distal region at CLCN5 site which is used in previous study. Although the mechanism underlying the divergent outcomes observed when T4 DNA polymerase was delivered in trans and in cis remains unclear, it is believed that the exonuclease domain within T4 DNA polymerase may have contributed to these differences. One potential explanation is that the fusion of T4 DNA polymerase to Cas9 may impact the binding or accessibility of T4 DNA polymerase to DSBs. Further characterization of the T4 DNA polymerase, Cas9 and DNA crystal structure during DNA repair is necessary to elucidate this mechanism in more details.

Our data shows that CasPlus can favor templated 1–2-bp insertions as well as 1–2-bp deletions in a guide RNA context-dependent manner, but more comprehensive and systematic analysis is needed to predict or better control the outcomes of CasPlus editing. CasPlus-mediated 1–2-bp insertions could be harnessed to disrupt pathogenic genes or correct frameshift mutations. Base editing and prime editing are versatile approaches to disrupt and correct genes without requiring exogenous templates and DSBs. Base editing can generate single-nucleotide mutations but not indels (Gaudelli et al, 2017; Komor et al, 2016). Prime editing can achieve single-nucleotide and indels editing (Anzalone et al, 2019). However, the efficiency of prime editing varies among different pegRNA constructs in diverse targets in cells and organoids and was averagely less than Cas9 when targeting the identical genomic sites (Geurts et al, 2021; Kim et al, 2021). Efficient prime editing can achieved by introducing a second nick on the non-edited stand, but can generate undesired DSBs and large deletions in mouse embryos (Tomomi Aida et al, 2020). Other methods can reduce translocations, including nuclease combinations (Bothmer et al, 2020) or Cas12f nuclease (Xin et al, 2022) for multiplex gene editing and fusion of Cas9 to an exonuclease to prevent repeat cleavage (Yin et al, 2022). However, unlike CasPlus, these approaches cannot precisely control the editing outcomes. Since CasPlus does not negatively affect the editing efficiency of regular Cas9 and can produces a dominant genotype of 1–2-bp indel with much fewer byproducts and on-target damage, it could be a safer and more efficient method optimized for human applications.

In addition, CasPlus’ enhanced safety features can expand ex vivo applications, including chimeric antigen receptor T (CAR-T) cells to target cancer or autoimmune diseases. The US Food and Drug Administration placed temporary holds on CRISPR/Cas9-based clinical trials related to allogeneic CAR-T therapies following the detection of a chromosomal abnormality in a patient and requested control data on genomic rearrangement (Sheridan, 2022b). As eukaryotic DNA repair mechanisms are conserved, our data from HEK293T, iPSC, and primary T cells suggest that CasPlus can generate engineered cells with fewer chromosomal abnormalities for cell therapy applications. Hence, CasPlus may improve the safety and efficacy of gene editing to develop novel cellular therapies.

Methods

Plasmids

The vector pSpCas9(BB)-2A-GFP (PX458) (Addgene plasmid #48138) containing the human codon-optimized SpCas9 gene with 2A-GFP and the sgRNA backbone, vector pCMV-PE2 (Addgene plasmid # 132775), vector pCMV-BE3 (Addgene plasmids # 73021) were purchased from Addgene. p3xFlag-CMV-10 was a gift from Dr. Xiaodong Wang. pLentiV-SgRNA-tdTomato-P2A-BlasR was a gift from Dr. Lukas Dow. EF1A-CasRx-2A-EGFP was a gift from Dr. Patrick Hsu. Plasmids psPAX2 and pMD2G were gifts from Dr. Lei Bu. pBSU6_FE_Scaffold_rsv_GFP was a gift from Dr. Dirk Grimm. UCOE-SFFV-dCas9-BFP-KRAB was a gift from Dr. Richard Tsien. To construct pSpCas9(BB)-2A-BFP, the BFP gene was amplified from UCOE-SFFV-dCas9-BFP-KRAB and cloned into pSpCas9(BB)-2A-GFP (PX458) to replace GFP via Gibson assembly. To construct the lentiviral vector expressing tdTomato-d151A, the tdTomato-d151A gene was synthesized by Integrated DNA Technologies (IDT). First, it was cloned into vector p3xFlag-CMV-10, then the CMV-10-tdtomato-d151A was cloned into pLentiv-SgRNA-tdTomato-P2A-BlasR using MluI and BamHI restriction sites. To construct For DNA polymerase cloning, the coding sequences of DNA polymerase 4, DNA polymerase I, Klenow fragment, T4 DNA polymerase, RB69 DNA polymerase, and T7 DNA polymerase were codon-optimized for human cell expression using the Genewiz Codon Optimization tool. For each DNA polymerase, an expression cassette containing the polymerase, a MCP (MS2 bacteriophage coat protein) and a hemagglutinin (HA) tag, two copies of a nuclear localization sequence (NLS), and a flexible linker (L) were synthesized from Genewiz and cloned into EF1A-CasRx-2A-EGFP via Gibson assembly. Mutations of T4 DNA polymerase and RB69 DNA polymerase were introduced into the vectors EF1A-MCP-T4 DNA-Polymerase-2A-EGFP and EF1A-MCP-RB69 DNA-polymerase-2A-EGFP, respectively, via Gibson assembly. To construct Cas9 and T4 DNA polymerase fusion protein, T4 DNA polymerase was amplified from EF1A-MCP-T4-Pol-2A-GFP and cloned into backbone pSpCas9(BB)-2A-GFP (PX458) via Gibson assembly. Mutations of Cas9 were generated in the backbone pSpCas9(BB)-2A-GFP (PX458) via Gibson assembly. To test CasPlus editing, Guide RNAs were cloned into pSpCas9(BB)-2A-GFP (PX458) or Cas9 variants derived from pSpCas9(BB)-2A-GFP (PX458) according to the CRIPSR plasmid instructions from the Feng Zhang Lab (Ran et al, 2013). Prime editing guide RNAs and guide RNAs for creating a second nick were cloned into pBSU6_FE_Scaffold_rsv_GFP via Gibson assembly or restriction digestion and ligation. All guide RNA sequences are listed in Appendix Table S8. All DNA sequences synthesized for vector constructions are listed in Appendix Table S9.

Generation of HEK293T cell lines containing the tdTomato-d151A reporter gene

To generate a stable tdTomato-d151A reporter cell line in HEK293T (ATCC, CRL-3216) cells, we co-transfected pLentiV vector expressing tdTomato-d151A, the lentiviral helper plasmids psPAX2 and pMD2G, and pEGFP (Lonza) into HEK293T cells. Single cells expressing GFP were isolated in 96-well plates 72 h post-transfection and genotyped 2 weeks later. Positive clones were then stored and expanded for subsequent experiments. Primers for genotyping are shown in Appendix Table S7.

Generation of male iPS cell lines containing the DMD exon 52 deletion

Male wild-type iPSCs (NCRM-1) were electroporated with vectors expressing Cas9, GFP, and a pair of guide RNAs specific for the deletion (DMD-Ex52-g1 and DMD-Ex52-g2, see Appendix Table S8). Single cells expressing GFP were isolated in 96-well plates 72 h post-transfection and genotyped 2 weeks later. Positive clones containing the DMD exon 52 deletion were stored and expanded for subsequent experiments. Primers for genotyping are shown in Appendix Table S7.

Transfection and sorting of HEK293T cells

HEK293T cells were transfected using Lipofectamine 2000 Transfection Reagent (ThermoFisher Scientific) according to the manufacturer’s instructions. Cell sorting was performed by the Cytometry & Cell Sorting Laboratory Core Facility at New York University Langone Health. Briefly, HEK293T cells were seeded into 12-well plates. After 20–24 h, cells were co-transfected with 1 μg vectors expressing Cas9 (with 2A-GFP) and a sgRNA, and 1 μg vectors expressing one of the DNA polymerases. Seventy-two hours post-transfection, cells were dissociated using a trypsin-EDTA solution (Corning) for 2 min at 37 °C. Subsequently, 2 ml of warm Dulbecco’s modified Eagle’s medium (DMEM) (Corning) supplemented with 10% fetal bovine serum (FBS) (Gemini Bio-Products) was added. The resuspended cells were transferred into a 15-ml Falcon tube and centrifuged at 1000 rpm for 5 min at room temperature. The medium was then removed, and the cells were resuspended in 0.4–1 ml DMEM. Cells were filtered through the 50-μm-mesh cap of a CellTrix strainer (Sysmex). Cells expressing GFP were sorted by flow cytometry into a 5-ml polypropylene round-bottom tube (Corning) for immediate DNA extraction.

Isolation of raw DNA from sorted cells

Protease K (20 mg/ml) (Qiagen) was added to DirectPCR Lysis Reagent (Viagen Biotech Inc.) to a final concentration of 50 μg/ml. Sorted cells (4 × 104–1 × 105) were centrifuged at 4 °C at 12,000 rpm for 5 min and the supernatant was discarded. Cell pellets were resuspended in 20–50 μl of DirectPCR/protease K solution, incubated at 55 °C for >2 h or until no clumps were observed, incubated at 85 °C for 30 min, and then spin down briefly (10 s). In total, 1–2 μl DNA was used for PCR amplification. All PCR primer sequences are summarized in Appendix Table S7.

Prime editing

HEK293T cells were co-transfected with 1 μg vectors expressing PE2, 1 μg vectors expressing pegRNAs, and 0.5 μg vectors expressing a second nicking sgRNA. Cells expressing GFP were sorted, and DNA was extracted from sorted cells as described above. PegRNAs and sgRNAs for prime editing are listed in Appendix Table S2.

Human iPSC maintenance and nucleofection

Human iPSC lines were cultured in StemflexTM medium (ThermoFisher) and passaged approximately every 3 days (1:8–1:12 split ratio). One hour before nucleofection, iPSCs were treated with 10 μM ROCK inhibitor (Y-27632) and dissociated into single cells using Accutase (Innovative Cell Technologies Inc.). Cells (8 × 105) were mixed with 2 μg of a vector expressing Cas9 (with 2A-GFP), and a guide RNA, as well as 2 μg of a vector encoding a DNA polymerase. This mixture was electroporated into cells using the P3 Primary Cell 4D-Nucleofector X kit (Lonza) according to the manufacturer’s protocol. After nucleofection, iPSCs were cultured in StemFlexTM medium supplemented with CloneR (10×) (STEMCELL Technologies) and antibiotic-antimycotic (100×) (ThermoFisher). Three days after nucleofection, cells expressing GFP were sorted as described above and replated in StemFlexTM medium. Ten to fifteen days after sorting, cells were harvested for DNA isolation.

Cardiomyocyte differentiation and purification

Human iPSCs (edited iPSC pools or single clones with 1-bp insertions) were induced for differentiation into cardiomyocytes according to the manufacturer’s instructions using the PSC Cardiomyocyte Differentiation Kit (ThermoFisher Scientific). At 15–20 days after differentiation initiation, cells were purified in RPMI-1640 medium lacking glucose supplemented with B27 (ThermoFisher Scientific). Cells were cultured in this medium for 2–4 days. Cardiomyocytes were used for experiments on days 30–40 after the initiation of differentiation.

RNA extraction and cDNA synthesis

RNA from iPSC-derived cardiomyocytes was extracted using TRIzol (ThermoFisher Scientific) according to the manufacturer’s protocol. cDNA was synthesized using the Superscript III First-Strand cDNA Synthesis Kit (ThermoFisher Scientific) according to the manufacturer’s instructions. All RT-PCR primer sequences are summarized in Appendix Table S7.

Cell cycle analysis

HEK293T cells were transfected with Cas9 (T2A-GFP) and gRNA G10, or Cas9 (T2A-GFP), gRNA G10 and T4-WT or T4-D219A. Cells were harvested 24 h post-transfection, washed in PBS, and fixed using cold 70% ethanal/PBS overnight at 4 °C. Cells were washed with PBS and then incubated with PBS containing RNase A (1 mg/ml) at room temperature for an hour. Cells were centrifuged and resuspended in PBS containing RNase A (1 mg/ml) and PI (0.5 μg/ml) at room temperature for 15 min. Following PI staining, cells were transferred to 5-ml polypropylene round-bottom tube for cell cycle analysis in Bio-Rad ZE5 analyzer.

Western blotting

HEK293T cells and cardiomyocytes (iCMs) differentiated from iPSCs were harvested, centrifuged, and lysed with RIPA lysis buffer (Santa Cruz Biotechnology) according to the manufacturer’s protocol. Samples were lysed and centrifuged, and the supernatant was incubated at 95 °C for 10 min in the presence of Laemmli sample buffer (Bio-Rad). Proteins (20 μg per sample) were separated on Mini-PROTEAN TGX 4–15% precast SDS-PAGE gels (Bio-Rad) for 1–3 h at 100 V and then transferred to PVDF membrane (Bio-Rad) at 40 V for 2–8 h. Membranes were blocked with 5% non-fat milk (Santa Cruz) for 1–2 h. Membranes were probed overnight at 4 °C with anti-HA antibody (MBL, M180-3) and anti-glyceraldehyde-3-phosphate dehydrogenase antibody (Sigma-Aldrich, G8795) or with anti-dystrophin (Sigma-Aldrich, D8168) and anti-vinculin antibody (Sigma-Aldrich, V9131). Membranes were then washed, probed with a goat anti-mouse or goat anti-rabbit IgG H + L-HRP conjugated secondary antibody (1:5000-1:10,000) (Bio-Rad) for 1 h, and visualized with Luminol reagent (Santa Cruz) according to the manufacturer’s protocol.

Detection of large deletions in iPSCs

DMD-del52 iPSCs were co-electroporated with 2 μg vectors expressing Cas9 (with 2A-GFP), and G10 or G9 and either 2 μg empty vectors or vectors expressing T4-WT or T4-D219A. Cells expressing GFP were then sorted into 5-ml polypropylene round-bottom tubes 72 h post-electroporation. Bulk-sorted cells were replaced and expanded. DNA was isolated from expanded bulk cells using the DNeasy Blood and Tissue Kit (Qiagen) 2 weeks later and subjected to large deletions detection (PCR and PacBio sequencing). Single cells were isolated from bulk-edited cells into 96-well plates 2 weeks after electroporation and genotyped 2 weeks after isolation. Single cells containing one insert of G at DMD exon 51 or T at DMD exon 53 were stored and expanded for subsequent experiments. Bulk-edited iPSCs, and the single clones containing 1-bp insertions were further differentiated into iCMs. DNA was isolated from iCMs and subjected to large deletions detection. Primers for large deletions detection are summarized in Appendix Table S7.

FLAER staining

Nucleofection in iPSCs with a gRNA against gene PIGA was performed as described above. Seventy-two hours after nucleofection, cells expressing GFP were sorted and expanded. FLAER staining was performed 1 week after expansion. Briefly, cells (3 × 105) were harvested and resuspended in 0.1% bovine serum albumin (BSA) in PBS containing 1 μg/ml Cederlane FLAER (Alexa 488 proaerolysin variant) (Fisher Scientific). Cells were cultured in a rotator for 30 min at room temperature and then washed twice with 0.1% BSA in PBS for 2 min. Cells were resuspended with 0.1% BSA in PBS and analyzed in Bio-Rad ZE5 analyzer.

In vitro transcription of T4 DNA polymerase

The Cas9 mRNA (5meC, Ψ) was purchased from TriLink Biotechnologies (L-6125) and single RNA against genes PDCD1, TRAC, TRBC or Mybpc3 was synthesized from Synthego (https://ice.synthego.com/#/). To construct the vector for in vitro transcription of T4 DNA polymerase, the T4 DNA polymerase expression cassete (without EGFP) was amplified from EF1A-MCP-T4 DNA-Polymerase-2A-EGFP and cloned into pCMV-BE3 via Gibson assembly. The construct pCMV-T7-T4 DNA-polymerase were then used as template for in vitro transcription using Invitrogen™ mMESSAGE mMACHINE™ T7 ULTRA Transcription Kit (ThermoFisher Scientific). The RNA transcripts were purified by MEGAclear Transcription Clean Up Kit (ThermoFisher Scientific) and eluted with nuclease-free water (Ambion). The concentration of T4 DNA polymerase was measured by a NanoDrop instrument (Thermo Scientific).

In vitro fertilization and microinjection

All animal procedures were approved by the Institutional Animal Care and Use Committee at the NYU Langone Medical Center. hDMDdel52/mdx female mice (Gifts from Dr. Nicole Datson) at 4 weeks of age were used as oocyte donors for superovulation, which was performed by intraperitoneal injection of PMSG (5 IU, Sigma-Aldrich) and hCG hormone (5 IU, Sigma-Aldrich). hDMDdel52/mdx male mice (Gifts from Dr. Nicole Datson) at 6–8 weeks of age were used as sperm donors. Four hours after in vitro fertilization, total volume of 10 μl solutions containing complexes of Cas9 mRNA (100 ng/μl) and Mybpc3 sgRNA (50 ng/μl) alone or together with T4 mRNA (50 ng/μl) diluted with DEPC-treated injection buffer (0.25 mM EDTA, 10 mM Tris, pH 7.4) were injected into cytoplasm of the zygotes. After microinjection, embryos were cultured in microdrops of KSOM + AA containing d-glucose and phenol red (Millipore) under mineral oil at 37 °C for 4 days in a humidified atmosphere consisting of 5% CO2 in air.

Detection of chromosomal translocations by PCR in HEK293T cells

HEK293T cells were co-transfected with a vector expressing Cas9 (with 2A-GFP), and guide RNAs targeting either genes ROS1 and CD74 or genes PDCD1, TRBC1/TRBC2, and TRAC individually or along with an empty vector or vector expressing T4-WT or T4-D219A. Transfected cells expressing GFP were sorted into 5-ml polypropylene round-bottom tubes 72 h post-transfection and sorted cells (1 × 106) were immediately subjected to DNA extraction. DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen) and 1 μl (50 ng/μl) DNA was used for each PCR reaction. Chromosomal translocations were detected by PCR using a GoTaq kit with primers specifically recognizing the breakpoint junction region of each fused chromosomes. All the guide RNAs used for translocations detection are summarized in Appendix Table S8. All the primers used for PCR are summarized at Appendix Table S7.

Detection of chromosomal translocations by TaqMan qPCR assay

A panel of TaqMan qPCR assays were performed to detect the balanced chromosomal translocations among genes PDCD1, TRBC1/TRBC2, and TRAC in HEK293T cells and primary T cells. To increase the sensitivity and accuracy of TaqMan assays in HEK293T cells, purified genomic DNA (25 ng) was first amplified according to the manufacturer’s instructions using REPLI-g Single Cell kit (Qiagen). Amplified genomic DNA was then diluted into ~800 ng/μl and 1 μl DNA was used for each qPCR reaction. In primary T cells, DNA was extracted from unedited or edited cells, diluted into ~10 ng/μl, and 2 μl DNA was used for each qPCR reaction. For each assay, a separate 20x FAM-labeled master mix was prepared with 1.8 μl forward primer (100 μM), 1.8 μl reverse primer (100 μM), 0.5 μl FAM-labeled probes (100 μM), and 8.1 μl H2O. A qPCR reaction was prepared with 10 μl 2× TaqMan gene expression master mix (Applied Biosystems), 1 μl 20× FAM-labeled master mix, 1 μl amplified DNA (~800 ng/μl) and 8 μl H2O. Assays were run in StepOne Real-time PCR systems (Applied Biosystems) using the following program: 2 min at 50 °C, 10 min at 95 °C and followed by 40 cycles of 20 s at 95 °C, 1 min at 60 °C. The primers and probes used for TaqMan assays are listed at Appendix Table S7.

Primary human T-cell isolation and stimulation

Human peripheral blood mononuclear cells (PBMCs) were purchased from Lonza. Frozen PBMCs were thawed and cultured in X-vivo 15 medium (Lonza) with 5% human AB serum (Heat inactivated) (Valley Biomedical) for one day. Primary T cells were isolated from PBMCs using EasySep Human T Cells Isolation Kits (StemCell Technologies) according to the manufacturer’s instructions. Immediately after isolation, primary T cells were activated and stimulated with a 1:1 ratio of anti-human CD3/CD28 magnetic Dynabeads (ThermoFisher) to cells in X-vivo 15 medium supplemented with 5% human AB serum (Heat inactivated), 5 ng/mL IL-7 (PeproTech), 5 ng/mL IL-15 (PeproTech), and 200 U/mL IL-2 (PeproTech). Two days after stimulation, magnetic beads were removed, and T cells were ready for nucleofection.

T-cell nucleofection

Nucleofection in T cells were performed using P3 Primary Cell 4D-Nucleofector™ X Kit S (Lonza) according to the manufacturer’s instructions with minor modifications. Briefly, T cells (~5–7 × 105) were collected and resuspended in 20 μl P3 buffer. 1 μg Cas9 mRNA and 3 μg sgRNAs (TRAC, TRBC, PDCD1 sgRNA, 1 μg each) alone or together with 2 μg IVT T4 mRNA were added to the cells before nucleofection in a Lonza 4D-Nucleofector with pulse code EO-115. 80 μl X-vivo 15 medium with 5% human AB serum and 200 U/mL IL-2 was added to the nucleofected cells before a 15 min recovery at 37 °C. Nucleofected T cells were plated at a density of ~0.5–1 × 106 cells/ml in X-vivo 15 medium supplemented with 5% human AB serum and 200 U/mL IL-2 in 48-well plates and replenished as needed to maintain a density of 106 cells per ml. Four days after nucleofection, edited cells were harvested for analysis.

PCR amplicon preparation for high-throughput sequencing

To prepare for high-throughput sequencing, PCR amplicons of ~300 bp were amplified using a GoTaq kit (Promega), separated on a 2% agarose gel, and purified with the MinElute Gel Extraction Kit (Qiagen). For each sample, gel-purified PCR product was barcoded with the Nextera Flex Prep HT kit according to the manufacturer’s instructions and sequenced using the MiSeq paired-end 150-cycle format by the Genome Technology Center Core Facility at New York University Langone Health.

PCR amplicon preparation for whole-genome sequencing

To prepare for whole-genome sequencing (WGS), HEK293T cells were co-transfected with a vector expressing only Cas9, T4-WT, or T4-D219A proteins; Cas9 in combination with G10; or Cas9 and either T4-WT or T4-D219A in combination with G10. All the vectors transfected expressed GFP. Seventy-two hours post-transfection, cells expressing GFP were sorted into 5-ml polypropylene round-bottom tubes for immediate DNA isolation. Genomic DNA was extracted using the DNeasy Blood and Tissue Kit (Qiagen), barcoded with the PCR-free library prep kit according to the manufacturer’s instructions, and sequenced using a S2 300-cycle flow cell v1.5 by the Genome Technology Center Core Facility at New York University Langone Health.

PCR amplicon preparation for PacBio sequencing

To prepare samples for PacBio sequencing, genomic DNA was extracted from iPSCs using the DNeasy Blood and Tissue Kit. Barcodes were added to the target region via a two-step PCR reaction. The first-round PCR was performed using LA Taq DNA polymerase (Takara) according to the manufacturer’s instructions. The first-round PCR amplified a 5-kb region around the target site using target-specific primers tailed with universal forward and reverse sequences. The second round of PCR re-amplified and barcoded the first round of PCR products using universal, barcoded forward and reverse primers. The final barcoded PCR products were sequenced using the SMRT Cell (1 M v3 LR) platform by the Genome Technology Center Core Facility at New York University Langone Health. All primers used for PacBio sequencing are summarized in Appendix Table S7.

High-throughput sequencing

To detect indels in the high-throughput sequencing data, unmapped paired-end amplicon high-throughput sequencing reads were used as inputs into the CRISPResso2 tool to quantify the frequency of editing events (Pinello et al, 2016). The tool was run with default parameters (https://github.com/pinellolab/CRISPResso2).

PacBio sequencing

Raw PacBio data were demultiplexed with the corresponding barcode using the SMRTlink software to assign barcoded reads to each sample (smrtlink version: 8.0.0.80529, chemistry bundle: 8.0.0.778409, params: 8.0.0). Analysis of demultiplexed data was performed using PacBio tools distributed via Bioconda (https://github.com/PacificBiosciences/pbbioconda). For DMD exon 51 and 53 locus pileup, circular consensus sequences were converted to HiFi calls using the pbccs command and filtering for reads with support from at least three full-length subreads. The resulting fastq files were used as inputs to a custom python script that filtered for reads containing specific 50-bp index sequences at both the 5′ and 3′ regions of each read. Resulting filtered reads were mapped to the reference genome using minimap2 (ax splice --splice-flank=no -u no -G 5000). The genome coverage of the alignment files was calculated using the “bedtools genomecov -d” (v 2.27.1) command with all downstream analyses performed using custom R script (v4.1.1) and visualized with the Gviz1 package (Genomics S, 2016; Li, 2018). For DMD exon 51, the 5′ index sequence is tttttccaaacgtgcttttcaggaaacagtggtctgcttgttgaagtctg and the 3′ index sequence is aatcctggaccagaggttccattgagctgagatcacaccattgcactcca. For DMD exon 53, the 5′ index sequence is ggactatatttttgatttcatgttacaatcactagttttgtggggtcttt and the 3′ index sequence is tgatgtgtattgctgcagattcaatgtaagttcccgatacagataaagat.

Genome-wide off-target analysis

FASTQ files were provided by the Genome Technology Center Core Facility. FASTQ files were aligned to human genome reference build GRCh38 using BWA-MEM aligner (v0.7.17) followed by the GATK (v4.2.1.0) best practices pipeline. The MarkDuplicatesSpark command was used to identify and mark PCR duplicate reads. BaseRecalibrator and ApplyBQSR commands were used along with known polymorphic sites to minimize systematic errors and improve downstream accuracy. Indel and SNP calling was done using Haplotypecaller, with the resulting file separated into SNPs and indels using the SelectVariants command. Variant filtering was performed using VariantFiltration with the following parameters: SNPs: QD  <  2.0, FS  >  60.0, SOR > 4.0, MQ  <  40.0, MQRankSum < −12.5, ReadPosRankSum < -8.0; Indels: QD  <  2.0, FS  >  200.0, SOR > 10.0, MQ  <  40.0. To ensure pipeline robustness, the site of editing in the Cas9 sample was identified and confirmed for editing using a custom parsing script and IGV (McKenna et al, 2010; Robinson et al, 2011).

Predicted off-target analysis

Off-target events were predicted in silico using Cas-OFFinder allowing up to a 4-base mismatch with PAM sequences of either NGG or NAG (Bae et al, 2014). No off-target sites were predicted in this genome that were not found in WT samples.

Statistical analysis

All samples used to test CasPlus editing were assayed in duplicate unless otherwise noted in the figure legends. All data were calculated based on HTS results unless otherwise noted in the figure legends. Data were presented as mean and standard error of the mean (SEM). Data were generated and statistical analysis was performed using GraphPad Prism software.

Supplementary information

Appendix

Peer Review File

Source data Fig. 1

Source data Fig. 2

Source data Fig. 3

Source data Fig. 4

Source data Fig. 5

Source data Fig. 6

Supplementary information

Expanded view data, supplementary information, appendices are available for this paper at 10.1038/s44318-024-00158-6.

Acknowledgements

The authors thank C Zhao, M Khurram, and Y Xiao for the cloning and sequencing of guide RNAs and plasmids; X Wang, L Dow, P Hsu, D Grimm, and L Bu for subcloning or lentivirus packaging vector plasmids; H Stower and R Barr for manuscript editing; A Namboodiripad, R Iyer, M Huang, and U. Andréo for comments and suggestions. This work was supported by grants from the Departmental Start-Up Grant, NYU Langone Health, and Kids Connect Charitable Fund.

Author contributions

Qiaoyan Yang: Conceptualization; Resources; Data curation; Software; Formal analysis; Validation; Investigation; Visualization; Methodology; Writing—original draft; Writing—review and editing. Jonathan S Abebe: Software; Methodology; Writing—original draft. Michelle Mai: Data curation. Gabriella Rudy: Data curation; Writing—original draft. Sang Y Kim: Data curation; Writing—original draft. Orrin Devinsky: Conceptualization; Supervision; Funding acquisition; Methodology; Writing—original draft; Writing—review and editing. Chengzu Long: Conceptualization; Resources; Data curation; Software; Formal analysis; Supervision; Funding acquisition; Validation; Investigation; Visualization; Methodology; Writing—original draft; Project administration; Writing—review and editing.

Source data underlying figure panels in this paper may have individual authorship assigned. Where available, figure panel/source data authorship is listed in the following database record: biostudies:S-SCDT-10_1038-S44318-024-00158-6.

Data availability

All data needed to evaluate the conclusions in the paper are present in the paper and/or the Supplementary information. Additional data related to this paper may be requested from the authors.

The source data of this paper are collected in the following database record: biostudies:S-SCDT-10_1038-S44318-024-00158-6.

Disclosure and competing interests statement

CL and OD are co-founders of Script Biosciences. CL and QY are listed on two patents related to this work (U.S. Application No. 63/335,625 and No. 63/109,909). The remaining authors declare no competing interests.
==== Refs
References

Overview CRISPR clinical trials (2024) CRISPR Medicine News. Available at. https://crisprmedicinenews.com/clinical-trials/
Abdus Sattar AK Lin TC Jones C Konigsberg WH Functional consequences and exonuclease kinetic parameters of point mutations in bacteriophage T4 DNA polymerase Biochemistry 1996 35 16621 9 10.1021/bi961552q 8987997
Abdus Sattar AK, Lin TC, Jones C, Konigsberg WH (1996) Functional consequences and exonuclease kinetic parameters of point mutations in bacteriophage T4 DNA polymerase. Biochemistry 35:16621–98987997 10.1021/bi961552q
Adikusuma F Piltz S Corbett MA Turvey M McColl SR Helbig KJ Beard MR Hughes J Pomerantz RT Thomas PQ Large deletions induced by Cas9 cleavage Nature 2018 560 E8 E9 10.1038/s41586-018-0380-z 30089922
Adikusuma F, Piltz S, Corbett MA, Turvey M, McColl SR, Helbig KJ, Beard MR, Hughes J, Pomerantz RT, Thomas PQ (2018) Large deletions induced by Cas9 cleavage. Nature 560:E8–E930089922 10.1038/s41586-018-0380-z
Adorisio R Mencarelli E Cantarutti N Calvieri C Amato L Cicenia M Silvetti M D’Amico A Grandinetti M Drago F Amodeo A Duchenne dilated cardiomyopathy: cardiac management from prevention to advanced cardiovascular therapies J Clin Med 2020 9 3186 10.3390/jcm9103186 33019553
Adorisio R, Mencarelli E, Cantarutti N, Calvieri C, Amato L, Cicenia M, Silvetti M, D’Amico A, Grandinetti M, Drago F, Amodeo A (2020) Duchenne dilated cardiomyopathy: cardiac management from prevention to advanced cardiovascular therapies. J Clin Med 9:318633019553 10.3390/jcm9103186
Allen F, Crepaldi L, Alsinet C, Strong AJ, Kleshchevnikov V, De Angeli P, Palenikova P, Khodak A, Kiselev V, Kosicki M, Bassett AR, Harding H, Galanty Y, Munoz-Martinez F, Metzakopian E, Jackson SP, Parts L (2018) Predicting the mutations generated by repair of Cas9-induced double-strand breaks. Nat Biotechnol 37:64–72
Amit I Iancu O Levy-Jurgenson A Kurgan G McNeill MS Rettig GR Allen D Breier D Ben Haim N Wang Y Anavy L Hendel A Yakhini Z CRISPECTOR provides accurate estimation of genome editing translocation and off-target activity from comparative NGS data Nat Commun 2021 12 3042 10.1038/s41467-021-22417-4 34031394
Amit I, Iancu O, Levy-Jurgenson A, Kurgan G, McNeill MS, Rettig GR, Allen D, Breier D, Ben Haim N, Wang Y, Anavy L, Hendel A, Yakhini Z (2021) CRISPECTOR provides accurate estimation of genome editing translocation and off-target activity from comparative NGS data. Nat Commun 12:304234031394 10.1038/s41467-021-22417-4
Amoasii L Long C Li H Mireault AA Shelton JM Sanchez-Ortiz E McAnally JR Bhattacharyya S Schmidt F Grimm D Hauschka SD Bassel-Duby R Olson EN Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy Sci Transl Med 2017 9 eaan8081 10.1126/scitranslmed.aan8081 29187645
Amoasii L, Long C, Li H, Mireault AA, Shelton JM, Sanchez-Ortiz E, McAnally JR, Bhattacharyya S, Schmidt F, Grimm D, Hauschka SD, Bassel-Duby R, Olson EN (2017) Single-cut genome editing restores dystrophin expression in a new mouse model of muscular dystrophy. Sci Transl Med 9:eaan808129187645 10.1126/scitranslmed.aan8081
Anzalone AV Koblan LW Liu DR Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors Nat Biotechnol 2020 38 824 844 10.1038/s41587-020-0561-9 32572269
Anzalone AV, Koblan LW, Liu DR (2020) Genome editing with CRISPR-Cas nucleases, base editors, transposases and prime editors. Nat Biotechnol 38:824–84432572269 10.1038/s41587-020-0561-9
Anzalone AV Randolph PB Davis JR Sousa AA Koblan LW Levy JM Chen PJ Wilson C Newby GA Raguram A Liu DR Search-and-replace genome editing without double-strand breaks or donor DNA Nature 2019 576 149 157 10.1038/s41586-019-1711-4 31634902
Anzalone AV, Randolph PB, Davis JR, Sousa AA, Koblan LW, Levy JM, Chen PJ, Wilson C, Newby GA, Raguram A, Liu DR (2019) Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576:149–15731634902 10.1038/s41586-019-1711-4
Bae S Park J Kim JS Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases Bioinformatics 2014 30 1473 5 10.1093/bioinformatics/btu048 24463181
Bae S, Park J, Kim JS (2014) Cas-OFFinder: a fast and versatile algorithm that searches for potential off-target sites of Cas9 RNA-guided endonucleases. Bioinformatics 30:1473–524463181 10.1093/bioinformatics/btu048
Bebenek K Joyce CM Fitzgerald MP Kunkel TA The fidelity of DNA synthesis catalyzed by derivatives of Escherichia coli DNA polymerase I J Biol Chem 1990 265 13878 87 10.1016/S0021-9258(18)77430-9 2199444
Bebenek K, Joyce CM, Fitzgerald MP, Kunkel TA (1990) The fidelity of DNA synthesis catalyzed by derivatives of Escherichia coli DNA polymerase I. J Biol Chem 265:13878–872199444 10.1016/S0021-9258(18)77430-9
Bermudez-Cabrera HC Culbertson S Barkal S Holmes B Shen MW Zhang S Gifford DK Sherwood RI Small molecule inhibition of ATM kinase increases CRISPR-Cas9 1-bp insertion frequency Nat Commun 2021 12 5111 10.1038/s41467-021-25415-8 34433825
Bermudez-Cabrera HC, Culbertson S, Barkal S, Holmes B, Shen MW, Zhang S, Gifford DK, Sherwood RI (2021) Small molecule inhibition of ATM kinase increases CRISPR-Cas9 1-bp insertion frequency. Nat Commun 12:511134433825 10.1038/s41467-021-25415-8
Bothmer A Gareau KW Abdulkerim HS Buquicchio F Cohen L Viswanathan R Zuris JA Marco E Fernandez CA Myer VE Cotta-Ramusino C Detection and modulation of DNA translocations during multi-gene genome editing in T cells CRISPR J 2020 3 177 187 10.1089/crispr.2019.0074 32584143
Bothmer A, Gareau KW, Abdulkerim HS, Buquicchio F, Cohen L, Viswanathan R, Zuris JA, Marco E, Fernandez CA, Myer VE, Cotta-Ramusino C (2020) Detection and modulation of DNA translocations during multi-gene genome editing in T cells. CRISPR J 3:177–18732584143 10.1089/crispr.2019.0074
Boutin J Cappellen D Rosier J Amintas S Dabernat S Bedel A Moreau-Gaudry F ON-target adverse events of CRISPR-Cas9 nuclease: more chaotic than expected CRISPR J 2022 5 19 30 10.1089/crispr.2021.0120 35099280
Boutin J, Cappellen D, Rosier J, Amintas S, Dabernat S, Bedel A, Moreau-Gaudry F (2022) ON-target adverse events of CRISPR-Cas9 nuclease: more chaotic than expected. CRISPR J 5:19–3035099280 10.1089/crispr.2021.0120
Capson TL Peliska JA Kaboord BF Frey MW Lively C Dahlberg M Benkovic SJ Kinetic characterization of the polymerase and exonuclease activities of the gene 43 protein of bacteriophage T4 Biochemistry 1992 31 10984 94 10.1021/bi00160a007 1332748
Capson TL, Peliska JA, Kaboord BF, Frey MW, Lively C, Dahlberg M, Benkovic SJ (1992) Kinetic characterization of the polymerase and exonuclease activities of the gene 43 protein of bacteriophage T4. Biochemistry 31:10984–941332748 10.1021/bi00160a007
Cejka P Symington LS DNA end resection: mechanism and control Annu Rev Genet 2021 55 285 307 10.1146/annurev-genet-071719-020312 34813349
Cejka P, Symington LS (2021) DNA end resection: mechanism and control. Annu Rev Genet 55:285–30734813349 10.1146/annurev-genet-071719-020312
Chang HHY Pannunzio NR Adachi N Lieber MR Non-homologous DNA end joining and alternative pathways to double-strand break repair Nat Rev Mol Cell Biol 2017 18 495 506 10.1038/nrm.2017.48 28512351
Chang HHY, Pannunzio NR, Adachi N, Lieber MR (2017) Non-homologous DNA end joining and alternative pathways to double-strand break repair. Nat Rev Mol Cell Biol 18:495–50628512351 10.1038/nrm.2017.48
Choi PS Meyerson M Targeted genomic rearrangements using CRISPR/Cas technology Nat Commun 2014 5 3728 10.1038/ncomms4728 24759083
Choi PS, Meyerson M (2014) Targeted genomic rearrangements using CRISPR/Cas technology. Nat Commun 5:372824759083 10.1038/ncomms4728
Cong L Ran FA Cox D Lin S Barretto R Habib N Hsu PD Wu X Jiang W Marraffini LA Zhang F Multiplex genome engineering using CRISPR/Cas systems Science 2013 339 819 23 10.1126/science.1231143 23287718
Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F (2013) Multiplex genome engineering using CRISPR/Cas systems. Science 339:819–2323287718 10.1126/science.1231143
De Waard A Paul AV Lehman IR The structural gene for deoxyribonucleic acid polymerase in bacteriophages T4 and T5 Proc Natl Acad Sci USA 1965 54 1241 8 10.1073/pnas.54.4.1241 5219829
De Waard A, Paul AV, Lehman IR (1965) The structural gene for deoxyribonucleic acid polymerase in bacteriophages T4 and T5. Proc Natl Acad Sci USA 54:1241–85219829 10.1073/pnas.54.4.1241
Depil S Duchateau P Grupp SA Mufti G Poirot L Off-the-shelf’ allogeneic CAR T cells: development and challenges Nat Rev Drug Discov 2020 19 185 199 10.1038/s41573-019-0051-2 31900462
Depil S, Duchateau P, Grupp SA, Mufti G, Poirot L (2020) Off-the-shelf’ allogeneic CAR T cells: development and challenges. Nat Rev Drug Discov 19:185–19931900462 10.1038/s41573-019-0051-2
Duan D Goemans N Takeda S Mercuri E Aartsma-Rus A Duchenne muscular dystrophy Nat Rev Dis Primers 2021 7 13 10.1038/s41572-021-00248-3 33602943
Duan D, Goemans N, Takeda S, Mercuri E, Aartsma-Rus A (2021) Duchenne muscular dystrophy. Nat Rev Dis Primers 7:1333602943 10.1038/s41572-021-00248-3
Ferreira da Silva J Oliveira GP Arasa-Verge EA Kagiou C Moretton A Timelthaler G Jiricny J Loizou JI Prime editing efficiency and fidelity are enhanced in the absence of mismatch repair Nat Commun 2022 13 760 10.1038/s41467-022-28442-1 35140211
Ferreira da Silva J, Oliveira GP, Arasa-Verge EA, Kagiou C, Moretton A, Timelthaler G, Jiricny J, Loizou JI (2022) Prime editing efficiency and fidelity are enhanced in the absence of mismatch repair. Nat Commun 13:76035140211 10.1038/s41467-022-28442-1
Gaudelli NM Komor AC Rees HA Packer MS Badran AH Bryson DI Liu DR Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage Nature 2017 551 464 471 10.1038/nature24644 29160308
Gaudelli NM, Komor AC, Rees HA, Packer MS, Badran AH, Bryson DI, Liu DR (2017) Programmable base editing of A*T to G*C in genomic DNA without DNA cleavage. Nature 551:464–47129160308 10.1038/nature24644
Genomics S (2016) Methods and protocols. Anticancer Res 36:3224
Geurts MH de Poel E Pleguezuelos-Manzano C Oka R Carrillo L Andersson-Rolf A Boretto M Brunsveld JE van Boxtel R Beekman JM Clevers H Evaluating CRISPR-based prime editing for cancer modeling and CFTR repair in organoids Life Sci Alliance 2021 4 e202000940 10.26508/lsa.202000940 34373320
Geurts MH, de Poel E, Pleguezuelos-Manzano C, Oka R, Carrillo L, Andersson-Rolf A, Boretto M, Brunsveld JE, van Boxtel R, Beekman JM, Clevers H (2021) Evaluating CRISPR-based prime editing for cancer modeling and CFTR repair in organoids. Life Sci Alliance 4:e20200094034373320 10.26508/lsa.202000940
Hogg M Cooper W Reha-Krantz L Wallace SS Kinetics of error generation in homologous B-family DNA polymerases Nucleic Acids Res 2006 34 2528 35 10.1093/nar/gkl300 16687658
Hogg M, Cooper W, Reha-Krantz L, Wallace SS (2006) Kinetics of error generation in homologous B-family DNA polymerases. Nucleic Acids Res 34:2528–3516687658 10.1093/nar/gkl300
Hori K Mark DF Richardson CC Deoxyribonucleic acid polymerase of bacteriophage T7. Characterization of the exonuclease activities of the gene 5 protein and the reconstituted polymerase J Biol Chem 1979 254 11598 604 10.1016/S0021-9258(19)86527-4 227873
Hori K, Mark DF, Richardson CC (1979) Deoxyribonucleic acid polymerase of bacteriophage T7. Characterization of the exonuclease activities of the gene 5 protein and the reconstituted polymerase. J Biol Chem 254:11598–604227873 10.1016/S0021-9258(19)86527-4
Jiang F Taylor DW Chen JS Kornfeld JE Zhou K Thompson AJ Nogales E Doudna JA Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage Science 2016 351 867 71 10.1126/science.aad8282 26841432
Jiang F, Taylor DW, Chen JS, Kornfeld JE, Zhou K, Thompson AJ, Nogales E, Doudna JA (2016) Structures of a CRISPR-Cas9 R-loop complex primed for DNA cleavage. Science 351:867–7126841432 10.1126/science.aad8282
Jinek M Chylinski K Fonfara I Hauer M Doudna JA Charpentier E A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity Science 2012 337 816 21 10.1126/science.1225829 22745249
Jinek M, Chylinski K, Fonfara I, Hauer M, Doudna JA, Charpentier E (2012) A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science 337:816–2122745249 10.1126/science.1225829
Jinek M East A Cheng A Lin S Ma E Doudna J RNA-programmed genome editing in human cells Elife 2013 2 e00471 10.7554/eLife.00471 23386978
Jinek M, East A, Cheng A, Lin S, Ma E, Doudna J (2013) RNA-programmed genome editing in human cells. Elife 2:e0047123386978 10.7554/eLife.00471
Jore MM, Lundgren M, van Duijn E, Bultema JB, Westra ER, Waghmare SP, Wiedenheft B, Pul U, Wurm R, Wagner R, Beijer MR, Barendregt A, Zhou K, Snijders AP, Dickman MJ, Doudna JA, Boekema EJ, Heck AJ, van der Oost J, Brouns SJ (2011) Structural basis for CRISPR RNA-guided DNA recognition by Cascade. Nat Struct Mol Biol 18:529–536
Khan A Sarkar E CRISPR/Cas9 encouraged CAR-T cell immunotherapy reporting efficient and safe clinical results towards cancer Cancer Treat Res Commun 2022 33 100641 10.1016/j.ctarc.2022.100641 36193597
Khan A, Sarkar E (2022) CRISPR/Cas9 encouraged CAR-T cell immunotherapy reporting efficient and safe clinical results towards cancer. Cancer Treat Res Commun 33:10064136193597 10.1016/j.ctarc.2022.100641
Kim HK Yu G Park J Min S Lee S Yoon S Kim HH Predicting the efficiency of prime editing guide RNAs in human cells Nat Biotechnol 2021 39 198 206 10.1038/s41587-020-0677-y 32958957
Kim HK, Yu G, Park J, Min S, Lee S, Yoon S, Kim HH (2021) Predicting the efficiency of prime editing guide RNAs in human cells. Nat Biotechnol 39:198–20632958957 10.1038/s41587-020-0677-y
Komor AC Kim YB Packer MS Zuris JA Liu DR Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage Nature 2016 533 420 4 10.1038/nature17946 27096365
Komor AC, Kim YB, Packer MS, Zuris JA, Liu DR (2016) Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533:420–427096365 10.1038/nature17946
Konermann S Brigham MD Trevino AE Joung J Abudayyeh OO Barcena C Hsu PD Habib N Gootenberg JS Nishimasu H Nureki O Zhang F Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex Nature 2015 517 583 8 10.1038/nature14136 25494202
Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F (2015) Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Nature 517:583–825494202 10.1038/nature14136
Kosicki M Allen F Steward F Tomberg K Pan Y Bradley A Cas9-induced large deletions and small indels are controlled in a convergent fashion Nat Commun 2022 13 3422 10.1038/s41467-022-30480-8 35701408
Kosicki M, Allen F, Steward F, Tomberg K, Pan Y, Bradley A (2022) Cas9-induced large deletions and small indels are controlled in a convergent fashion. Nat Commun 13:342235701408 10.1038/s41467-022-30480-8
Kosicki M Tomberg K Bradley A Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements Nat Biotechnol 2018 36 765 771 10.1038/nbt.4192 30010673
Kosicki M, Tomberg K, Bradley A (2018) Repair of double-strand breaks induced by CRISPR-Cas9 leads to large deletions and complex rearrangements. Nat Biotechnol 36:765–77130010673 10.1038/nbt.4192
Kucera RB, Nichols NM (2008) DNA-dependent DNA polymerases. Curr Protoc Mol Biol Chapter 3:Unit 3 5
Labanieh L Mackall CL CAR immune cells: design principles, resistance and the next generation Nature 2023 614 635 648 10.1038/s41586-023-05707-3 36813894
Labanieh L, Mackall CL (2023) CAR immune cells: design principles, resistance and the next generation. Nature 614:635–64836813894 10.1038/s41586-023-05707-3
Leenay RT Aghazadeh A Hiatt J Tse D Roth TL Apathy R Shifrut E Hultquist JF Krogan N Wu Z Cirolia G Canaj H Leonetti MD Marson A May AP Zou J Large dataset enables prediction of repair after CRISPR-Cas9 editing in primary T cells Nat Biotechnol 2019 37 1034 1037 10.1038/s41587-019-0203-2 31359007
Leenay RT, Aghazadeh A, Hiatt J, Tse D, Roth TL, Apathy R, Shifrut E, Hultquist JF, Krogan N, Wu Z, Cirolia G, Canaj H, Leonetti MD, Marson A, May AP, Zou J (2019) Large dataset enables prediction of repair after CRISPR-Cas9 editing in primary T cells. Nat Biotechnol 37:1034–103731359007 10.1038/s41587-019-0203-2
Leibowitz ML Papathanasiou S Doerfler PA Blaine LJ Sun L Yao Y Zhang CZ Weiss MJ Pellman D Chromothripsis as an on-target consequence of CRISPR-Cas9 genome editing Nat Genet 2021 53 895 905 10.1038/s41588-021-00838-7 33846636
Leibowitz ML, Papathanasiou S, Doerfler PA, Blaine LJ, Sun L, Yao Y, Zhang CZ, Weiss MJ, Pellman D (2021) Chromothripsis as an on-target consequence of CRISPR-Cas9 genome editing. Nat Genet 53:895–90533846636 10.1038/s41588-021-00838-7
Lemos BR Kaplan AC Bae JE Ferrazzoli AE Kuo J Anand RP Waterman DP Haber JE CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles Proc Natl Acad Sci USA 2018 115 E2040 E2047 10.1073/pnas.1716855115 29440496
Lemos BR, Kaplan AC, Bae JE, Ferrazzoli AE, Kuo J, Anand RP, Waterman DP, Haber JE (2018) CRISPR/Cas9 cleavages in budding yeast reveal templated insertions and strand-specific insertion/deletion profiles. Proc Natl Acad Sci USA 115:E2040–E204729440496 10.1073/pnas.1716855115
Li H Minimap2: pairwise alignment for nucleotide sequences Bioinformatics 2018 34 3094 3100 10.1093/bioinformatics/bty191 29750242
Li H (2018) Minimap2: pairwise alignment for nucleotide sequences. Bioinformatics 34:3094–310029750242 10.1093/bioinformatics/bty191
Liu Y Tao W Wen S Li Z Yang A Deng Z Sun Y In vitro CRISPR/Cas9 system for efficient targeted DNA editing mBio 2015 6 e01714 15 10.1128/mBio.01714-15 26556277
Liu Y, Tao W, Wen S, Li Z, Yang A, Deng Z, Sun Y (2015) In vitro CRISPR/Cas9 system for efficient targeted DNA editing. mBio 6:e01714–1526556277 10.1128/mBio.01714-15
Long C Amoasii L Mireault AA McAnally JR Li H Sanchez-Ortiz E Bhattacharyya S Shelton JM Bassel-Duby R Olson EN Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy Science 2016 351 400 3 10.1126/science.aad5725 26721683
Long C, Amoasii L, Mireault AA, McAnally JR, Li H, Sanchez-Ortiz E, Bhattacharyya S, Shelton JM, Bassel-Duby R, Olson EN (2016) Postnatal genome editing partially restores dystrophin expression in a mouse model of muscular dystrophy. Science 351:400–326721683 10.1126/science.aad5725
Long C Li H Tiburcy M Rodriguez-Caycedo C Kyrychenko V Zhou H Zhang Y Min YL Shelton JM Mammen PPA Liaw NY Zimmermann WH Bassel-Duby R Schneider JW Olson EN Correction of diverse muscular dystrophy mutations in human engineered heart muscle by single-site genome editing Sci Adv 2018 4 eaap9004 10.1126/sciadv.aap9004 29404407
Long C, Li H, Tiburcy M, Rodriguez-Caycedo C, Kyrychenko V, Zhou H, Zhang Y, Min YL, Shelton JM, Mammen PPA, Liaw NY, Zimmermann WH, Bassel-Duby R, Schneider JW, Olson EN (2018) Correction of diverse muscular dystrophy mutations in human engineered heart muscle by single-site genome editing. Sci Adv 4:eaap900429404407 10.1126/sciadv.aap9004
Long C McAnally JR Shelton JM Mireault AA Bassel-Duby R Olson EN Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA Science 2014 345 1184 1188 10.1126/science.1254445 25123483
Long C, McAnally JR, Shelton JM, Mireault AA, Bassel-Duby R, Olson EN (2014) Prevention of muscular dystrophy in mice by CRISPR/Cas9-mediated editing of germline DNA. Science 345:1184–118825123483 10.1126/science.1254445
Mali P Yang L Esvelt KM Aach J Guell M DiCarlo JE Norville JE Church GM RNA-guided human genome engineering via Cas9 Science 2013 339 823 6 10.1126/science.1232033 23287722
Mali P, Yang L, Esvelt KM, Aach J, Guell M, DiCarlo JE, Norville JE, Church GM (2013) RNA-guided human genome engineering via Cas9. Science 339:823–623287722 10.1126/science.1232033
Mao Z Bozzella M Seluanov A Gorbunova V Comparison of nonhomologous end joining and homologous recombination in human cells DNA Repair 2008 7 1765 71 10.1016/j.dnarep.2008.06.018 18675941
Mao Z, Bozzella M, Seluanov A, Gorbunova V (2008) Comparison of nonhomologous end joining and homologous recombination in human cells. DNA Repair 7:1765–7118675941 10.1016/j.dnarep.2008.06.018
McKenna A Hanna M Banks E Sivachenko A Cibulskis K Kernytsky A Garimella K Altshuler D Gabriel S Daly M DePristo MA The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data Genome Res 2010 20 1297 303 10.1101/gr.107524.110 20644199
McKenna A, Hanna M, Banks E, Sivachenko A, Cibulskis K, Kernytsky A, Garimella K, Altshuler D, Gabriel S, Daly M, DePristo MA (2010) The Genome Analysis Toolkit: a MapReduce framework for analyzing next-generation DNA sequencing data. Genome Res 20:1297–30320644199 10.1101/gr.107524.110
Muntoni F Torelli S Ferlini A Dystrophin and mutations: one gene, several proteins, multiple phenotypes Lancet Neurol 2003 2 731 40 10.1016/S1474-4422(03)00585-4 14636778
Muntoni F, Torelli S, Ferlini A (2003) Dystrophin and mutations: one gene, several proteins, multiple phenotypes. Lancet Neurol 2:731–4014636778 10.1016/S1474-4422(03)00585-4
Nahmad AD Reuveni E Goldschmidt E Tenne T Liberman M Horovitz-Fried M Khosravi R Kobo H Reinstein E Madi A Ben-David U Barzel A Frequent aneuploidy in primary human T cells after CRISPR-Cas9 cleavage Nat Biotechnol 2022 40 1807 1813 10.1038/s41587-022-01377-0 35773341
Nahmad AD, Reuveni E, Goldschmidt E, Tenne T, Liberman M, Horovitz-Fried M, Khosravi R, Kobo H, Reinstein E, Madi A, Ben-David U, Barzel A (2022a) Frequent aneuploidy in primary human T cells after CRISPR-Cas9 cleavage. Nat Biotechnol 40:1807–181335773341 10.1038/s41587-022-01377-0
Nahmad AD, Reuveni E, Goldschmidt E, Tenne T, Liberman M, Horovitz-Fried M, Khosravi R, Kobo H, Reinstein E, Madi A, Ben-David U, Barzel A (2022b) Frequent aneuploidy in primary human T cells after CRISPR-Cas9 cleavage. Nat Biotechnol 40:1807–1813
Nelson CE Wu Y Gemberling MP Oliver ML Waller MA Bohning JD Robinson-Hamm JN Bulaklak K Castellanos Rivera RM Collier JH Asokan A Gersbach CA Long-term evaluation of AAV-CRISPR genome editing for Duchenne muscular dystrophy Nat Med 2019 25 427 432 10.1038/s41591-019-0344-3 30778238
Nelson CE, Wu Y, Gemberling MP, Oliver ML, Waller MA, Bohning JD, Robinson-Hamm JN, Bulaklak K, Castellanos Rivera RM, Collier JH, Asokan A, Gersbach CA (2019) Long-term evaluation of AAV-CRISPR genome editing for Duchenne muscular dystrophy. Nat Med 25:427–43230778238 10.1038/s41591-019-0344-3
O’Brien KF Kunkel LM Dystrophin and muscular dystrophy: past, present, and future Mol Genet Metab 2001 74 75 88 10.1006/mgme.2001.3220 11592805
O’Brien KF, Kunkel LM (2001) Dystrophin and muscular dystrophy: past, present, and future. Mol Genet Metab 74:75–8811592805 10.1006/mgme.2001.3220
Olson EN Toward the correction of muscular dystrophy by gene editing Proc Natl Acad Sci USA 2021 118 e2004840117 10.1073/pnas.2004840117 34074727
Olson EN (2021) Toward the correction of muscular dystrophy by gene editing. Proc Natl Acad Sci USA 118:e200484011734074727 10.1073/pnas.2004840117
Oshima J Magner DB Lee JA Breman AM Schmitt ES White LD Crowe CA Merrill M Jayakar P Rajadhyaksha A Eng CM del Gaudio D Regional genomic instability predisposes to complex dystrophin gene rearrangements Hum Genet 2009 126 411 23 10.1007/s00439-009-0679-9 19449031
Oshima J, Magner DB, Lee JA, Breman AM, Schmitt ES, White LD, Crowe CA, Merrill M, Jayakar P, Rajadhyaksha A, Eng CM, del Gaudio D (2009) Regional genomic instability predisposes to complex dystrophin gene rearrangements. Hum Genet 126:411–2319449031 10.1007/s00439-009-0679-9
Owens DDG Caulder A Frontera V Harman JR Allan AJ Bucakci A Greder L Codner GF Hublitz P McHugh PJ Teboul L de Bruijn M Microhomologies are prevalent at Cas9-induced larger deletions Nucleic Acids Res 2019 47 7402 7417 10.1093/nar/gkz459 31127293
Owens DDG, Caulder A, Frontera V, Harman JR, Allan AJ, Bucakci A, Greder L, Codner GF, Hublitz P, McHugh PJ, Teboul L, de Bruijn M (2019) Microhomologies are prevalent at Cas9-induced larger deletions. Nucleic Acids Res 47:7402–741731127293 10.1093/nar/gkz459
Papathanasiou S Markoulaki S Blaine LJ Leibowitz ML Zhang CZ Jaenisch R Pellman D Whole chromosome loss and genomic instability in mouse embryos after CRISPR-Cas9 genome editing Nat Commun 2021 12 5855 10.1038/s41467-021-26097-y 34615869
Papathanasiou S, Markoulaki S, Blaine LJ, Leibowitz ML, Zhang CZ, Jaenisch R, Pellman D (2021) Whole chromosome loss and genomic instability in mouse embryos after CRISPR-Cas9 genome editing. Nat Commun 12:585534615869 10.1038/s41467-021-26097-y
Pinello L Canver MC Hoban MD Orkin SH Kohn DB Bauer DE Yuan GC Analyzing CRISPR genome-editing experiments with CRISPResso Nat Biotechnol 2016 34 695 7 10.1038/nbt.3583 27404874
Pinello L, Canver MC, Hoban MD, Orkin SH, Kohn DB, Bauer DE, Yuan GC (2016) Analyzing CRISPR genome-editing experiments with CRISPResso. Nat Biotechnol 34:695–727404874 10.1038/nbt.3583
Poirot L Philip B Schiffer-Mannioui C Le Clerre D Chion-Sotinel I Derniame S Potrel P Bas C Lemaire L Galetto R Lebuhotel C Eyquem J Cheung GW Duclert A Gouble A Arnould S Peggs K Pule M Scharenberg AM Smith J Multiplex genome-edited T-cell manufacturing platform for “off-the-shelf” adoptive T-cell immunotherapies Cancer Res 2015 75 3853 64 10.1158/0008-5472.CAN-14-3321 26183927
Poirot L, Philip B, Schiffer-Mannioui C, Le Clerre D, Chion-Sotinel I, Derniame S, Potrel P, Bas C, Lemaire L, Galetto R, Lebuhotel C, Eyquem J, Cheung GW, Duclert A, Gouble A, Arnould S, Peggs K, Pule M, Scharenberg AM, Smith J (2015) Multiplex genome-edited T-cell manufacturing platform for “off-the-shelf” adoptive T-cell immunotherapies. Cancer Res 75:3853–6426183927 10.1158/0008-5472.CAN-14-3321
Ramsden DA Asagoshi K DNA polymerases in nonhomologous end joining: are there any benefits to standing out from the crowd? Environ Mol Mutagen 2012 53 741 51 10.1002/em.21725 22987211
Ramsden DA, Asagoshi K (2012) DNA polymerases in nonhomologous end joining: are there any benefits to standing out from the crowd? Environ Mol Mutagen 53:741–5122987211 10.1002/em.21725
Ran FA Hsu PD Wright J Agarwala V Scott DA Zhang F Genome engineering using the CRISPR-Cas9 system Nat Protoc 2013 8 2281 2308 10.1038/nprot.2013.143 24157548
Ran FA, Hsu PD, Wright J, Agarwala V, Scott DA, Zhang F (2013) Genome engineering using the CRISPR-Cas9 system. Nat Protoc 8:2281–230824157548 10.1038/nprot.2013.143
Reha-Krantz LJ Amino acid changes coded by bacteriophage T4 DNA polymerase mutator mutants. Relating structure to function J Mol Biol 1988 202 711 24 10.1016/0022-2836(88)90552-9 3172235
Reha-Krantz LJ (1988) Amino acid changes coded by bacteriophage T4 DNA polymerase mutator mutants. Relating structure to function. J Mol Biol 202:711–243172235 10.1016/0022-2836(88)90552-9
Reha-Krantz LJ Regulation of DNA polymerase exonucleolytic proofreading activity: studies of bacteriophage T4 “antimutator” DNA polymerases Genetics 1998 148 1551 7 10.1093/genetics/148.4.1551 9560374
Reha-Krantz LJ (1998) Regulation of DNA polymerase exonucleolytic proofreading activity: studies of bacteriophage T4 “antimutator” DNA polymerases. Genetics 148:1551–79560374 10.1093/genetics/148.4.1551
Reha-Krantz LJ Stocki S Nonay RL Dimayuga E Goodrich LD Konigsberg WH Spicer EK DNA polymerization in the absence of exonucleolytic proofreading: in vivo and in vitro studies Proc Natl Acad Sci USA 1991 88 2417 21 10.1073/pnas.88.6.2417 2006180
Reha-Krantz LJ, Stocki S, Nonay RL, Dimayuga E, Goodrich LD, Konigsberg WH, Spicer EK (1991) DNA polymerization in the absence of exonucleolytic proofreading: in vivo and in vitro studies. Proc Natl Acad Sci USA 88:2417–212006180 10.1073/pnas.88.6.2417
Robinson JT Thorvaldsdottir H Winckler W Guttman M Lander ES Getz G Mesirov JP Integrative genomics viewer Nat Biotechnol 2011 29 24 6 10.1038/nbt.1754 21221095
Robinson JT, Thorvaldsdottir H, Winckler W, Guttman M, Lander ES, Getz G, Mesirov JP (2011) Integrative genomics viewer. Nat Biotechnol 29:24–621221095 10.1038/nbt.1754
Sfeir A Symington LS Microhomology-mediated end joining: a back-up survival mechanism or dedicated pathway? Trends Biochem Sci 2015 40 701 714 10.1016/j.tibs.2015.08.006 26439531
Sfeir A, Symington LS (2015) Microhomology-mediated end joining: a back-up survival mechanism or dedicated pathway? Trends Biochem Sci 40:701–71426439531 10.1016/j.tibs.2015.08.006
Shen MW Arbab M Hsu JY Worstell D Culbertson SJ Krabbe O Cassa CA Liu DR Gifford DK Sherwood RI Predictable and precise template-free CRISPR editing of pathogenic variants Nature 2018 563 646 651 10.1038/s41586-018-0686-x 30405244
Shen MW, Arbab M, Hsu JY, Worstell D, Culbertson SJ, Krabbe O, Cassa CA, Liu DR, Gifford DK, Sherwood RI (2018) Predictable and precise template-free CRISPR editing of pathogenic variants. Nature 563:646–65130405244 10.1038/s41586-018-0686-x
Sheridan C Off-the-shelf, gene-edited CAR-T cells forge ahead, despite safety scare Nat Biotechnol 2022 40 5 8 10.1038/d41587-021-00027-1 34912036
Sheridan C (2022a) Off-the-shelf, gene-edited CAR-T cells forge ahead, despite safety scare. Nat Biotechnol 40:5–834912036 10.1038/d41587-021-00027-1
Sheridan C (2022b) Off-the-shelf, gene-edited CAR-T cells forge ahead, despite safety scare. Nat Biotechnol 40:5–8
Shi X Shou J Mehryar MM Li J Wang L Zhang M Huang H Sun X Wu Q Cas9 has no exonuclease activity resulting in staggered cleavage with overhangs and predictable di- and tri-nucleotide CRISPR insertions without template donor Cell Discov 2019 5 53 10.1038/s41421-019-0120-z 31636963
Shi X, Shou J, Mehryar MM, Li J, Wang L, Zhang M, Huang H, Sun X, Wu Q (2019) Cas9 has no exonuclease activity resulting in staggered cleavage with overhangs and predictable di- and tri-nucleotide CRISPR insertions without template donor. Cell Discov 5:5331636963 10.1038/s41421-019-0120-z
Shou J Li J Liu Y Wu Q Precise and predictable CRISPR chromosomal rearrangements reveal principles of Cas9-mediated nucleotide insertion Mol Cell 2018 71 498 509.e4 10.1016/j.molcel.2018.06.021 30033371
Shou J, Li J, Liu Y, Wu Q (2018) Precise and predictable CRISPR chromosomal rearrangements reveal principles of Cas9-mediated nucleotide insertion. Mol Cell 71:498–509.e430033371 10.1016/j.molcel.2018.06.021
Stadtmauer EA Fraietta JA Davis MM Cohen AD Weber KL Lancaster E Mangan PA Kulikovskaya I Gupta M Chen F CRISPR-engineered T cells in patients with refractory cancer Science 2020 367 eaba7365 10.1126/science.aba7365 32029687
Stadtmauer EA, Fraietta JA, Davis MM, Cohen AD, Weber KL, Lancaster E, Mangan PA, Kulikovskaya I, Gupta M, Chen F et al (2020) CRISPR-engineered T cells in patients with refractory cancer. Science 367:eaba736532029687 10.1126/science.aba7365
Tomomi Aida JJW, Lixin Yang, Yuanyuan Hou, Mengqi Li, Dongdong Xu, Jianbang Lin, Peimin Qi, Zhonghua Lu, Guoping Feng (2020) Prime editing primarily induces undesired outcomes in mice. Preprint at https://www.biorxiv.org/content/10.1101/2020.08.06.239723v1.full.pdf
Uddin F Rudin CM Sen T CRISPR gene therapy: applications, limitations, and implications for the future Front Oncol 2020 10 1387 10.3389/fonc.2020.01387 32850447
Uddin F, Rudin CM, Sen T (2020) CRISPR gene therapy: applications, limitations, and implications for the future. Front Oncol 10:138732850447 10.3389/fonc.2020.01387
Xin C Yin J Yuan S Ou L Liu M Zhang W Hu J Comprehensive assessment of miniature CRISPR-Cas12f nucleases for gene disruption Nat Commun 2022 13 5623 10.1038/s41467-022-33346-1 36153319
Xin C, Yin J, Yuan S, Ou L, Liu M, Zhang W, Hu J (2022) Comprehensive assessment of miniature CRISPR-Cas12f nucleases for gene disruption. Nat Commun 13:562336153319 10.1038/s41467-022-33346-1
Yin J Lu R Xin C Wang Y Ling X Li D Zhang W Liu M Xie W Kong L Si W Wei P Xiao B Lee HY Liu T Hu J Cas9 exo-endonuclease eliminates chromosomal translocations during genome editing Nat Commun 2022 13 1204 10.1038/s41467-022-28900-w 35260581
Yin J, Lu R, Xin C, Wang Y, Ling X, Li D, Zhang W, Liu M, Xie W, Kong L, Si W, Wei P, Xiao B, Lee HY, Liu T, Hu J (2022) Cas9 exo-endonuclease eliminates chromosomal translocations during genome editing. Nat Commun 13:120435260581 10.1038/s41467-022-28900-w
Yoo KW Yadav MK Song Q Atala A Lu B Targeting DNA polymerase to DNA double-strand breaks reduces DNA deletion size and increases templated insertions generated by CRISPR/Cas9 Nucleic Acids Res 2022 50 3944 3957 10.1093/nar/gkac186 35323942
Yoo KW, Yadav MK, Song Q, Atala A, Lu B (2022) Targeting DNA polymerase to DNA double-strand breaks reduces DNA deletion size and increases templated insertions generated by CRISPR/Cas9. Nucleic Acids Res 50:3944–395735323942 10.1093/nar/gkac186
Zetsche B Gootenberg JS Abudayyeh OO Slaymaker IM Makarova KS Essletzbichler P Volz SE Joung J van der Oost J Regev A Koonin EV Zhang F Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system Cell 2015 163 759 71 10.1016/j.cell.2015.09.038 26422227
Zetsche B, Gootenberg JS, Abudayyeh OO, Slaymaker IM, Makarova KS, Essletzbichler P, Volz SE, Joung J, van der Oost J, Regev A, Koonin EV, Zhang F (2015) Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163:759–7126422227 10.1016/j.cell.2015.09.038
Zhang Y Li H Min YL Sanchez-Ortiz E Huang J Mireault AA Shelton JM Kim J Mammen PPA Bassel-Duby R Olson EN Enhanced CRISPR-Cas9 correction of Duchenne muscular dystrophy in mice by a self-complementary AAV delivery system Sci Adv 2020 6 eaay6812 10.1126/sciadv.aay6812 32128412
Zhang Y, Li H, Min YL, Sanchez-Ortiz E, Huang J, Mireault AA, Shelton JM, Kim J, Mammen PPA, Bassel-Duby R, Olson EN (2020) Enhanced CRISPR-Cas9 correction of Duchenne muscular dystrophy in mice by a self-complementary AAV delivery system. Sci Adv 6:eaay681232128412 10.1126/sciadv.aay6812
Zhang Y Li H Nishiyama T McAnally JR Sanchez-Ortiz E Huang J Mammen PPA Bassel-Duby R Olson EN A humanized knockin mouse model of Duchenne muscular dystrophy and its correction by CRISPR-Cas9 therapeutic gene editing Mol Ther Nucleic Acids 2022 29 525 537 10.1016/j.omtn.2022.07.024 36035749
Zhang Y, Li H, Nishiyama T, McAnally JR, Sanchez-Ortiz E, Huang J, Mammen PPA, Bassel-Duby R, Olson EN (2022) A humanized knockin mouse model of Duchenne muscular dystrophy and its correction by CRISPR-Cas9 therapeutic gene editing. Mol Ther Nucleic Acids 29:525–53736035749 10.1016/j.omtn.2022.07.024
