
==== Front
Ecol Evol
Ecol Evol
10.1002/(ISSN)2045-7758
ECE3
Ecology and Evolution
2045-7758
John Wiley and Sons Inc. Hoboken

10.1002/ece3.70260
ECE370260
ECE-2024-05-00912.R1
Biodiversity Ecology
Phylogenetics
Taxonomy
Zoology
Nature Notes
Nature Notes
One becomes three: An integrative morphological and molecular analysis of the windowpane oyster Placuna (Bivalvia: Pectinida) reveals new species
Lin et al.
Lin Yi‐Tao https://orcid.org/0000-0003-0724-4326
1
Li Yi‐Xuan https://orcid.org/0000-0002-2023-2867
1
Loke Hai‐Xin https://orcid.org/0009-0001-4105-9426
1
Han Xiao https://orcid.org/0009-0002-6607-3002
2
Qiu Jian‐Wen https://orcid.org/0000-0002-1541-9627
1 qiujw@hkbu.edu.hk

1 Department of Biology Hong Kong Baptist University Hong Kong China
2 Laboratory of Shellfish Genetics and Breeding Ocean University of China Qingdao China
* Correspondence
Jian‐Wen Qiu, Department of Biology, Hong Kong Baptist University, 224 Waterloo Road, Kowloon Tong, Hong Kong SAR, China.
Email: qiujw@hkbu.edu.hk

05 9 2024
9 2024
14 9 10.1002/ece3.v14.9 e7026016 7 2024
09 5 2024
20 8 2024
© 2024 The Author(s). Ecology and Evolution published by John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Abstract

For decades, many marine animals have been considered to exhibit cosmopolitan or transoceanic distribution. This situation is prevalent in Asia, where many species were collected and named by American or European experts in the 1700s to early 1900s. Using the windowpane oysters Placuna—a small genus of bivalves with five recognized species—we show that careful analysis is required to reassess the validity of these species. Currently, only two species of Placuna (P. placenta and P. ephippium) widely reported in the Indo‐Pacific region have been recorded from Chinese coastal waters. Here, we described two new species of Placuna from China. Placuna vitream sp. nov. can be distinguished from P. placenta by its larger ridge angle. Phylogenetic analysis using five gene fragments fully supported that P. vitream sp. nov. is a sister to the specimen from Singapore identified as P. placenta and more distant from other Placuna species with available molecular data. Besides, based on subfossil shells, we describe Placuna aestuaria sp. nov. that differs from its congeneric species by its broad hinge, medium ridge angle, and nearly straight ridges. Finally, we suggest a combination of hinge structure and ridge angle that can be used for identifying Placuna species and preparing a key to this genus. Our findings of two new species expand the diversity of Placuna and prompt reassessment of the many presumably widely distributed marine species in Asia.

We sequenced five genes from three species and conducted a phylogenetic analysis of the windowpane oysters Placuna. We found that previous records of Placuna placenta in China are actually two different species. Further studies should be conducted to examine the divergence of this widely distributed genus in the Indo‐Pacific Ocean.

Bivalvia
capiz shell
phylogeny
Placunidae
windowpane oyster
Hong Kong Offshore LNG Terminal ProjectMCEF22003 Lantau Conservation FundRE‐2020‐22 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:06.09.2024
Lin, Y.‐T. , Li, Y.‐X. , Loke, H.‐X. , Han, X. , & Qiu, J.‐W. (2024). One becomes three: An integrative morphological and molecular analysis of the windowpane oyster Placuna (Bivalvia: Pectinida) reveals new species. Ecology and Evolution, 14 , e70260. 10.1002/ece3.70260
==== Body
pmc1 INTRODUCTION

Many marine species have been considered to exhibit transoceanic or even cosmopolitan distribution (Hutchings & Kupriyanova, 2018; Knowlton, 1993). This situation is especially prevalent in the Asia‐Pacific where many species were collected and named by American or European experts in the 1700s to early 1900s (Hutchings & Kupriyanova, 2018). The extensive distribution was attributed to the high uniformity of the marine water, the absence of physical barriers for larval dispersal, and the extended larval dispersal period observed in certain taxa (Hansen, 1980; Scheltema, 1971; Schulze et al., 2012). Reassessment of such widely distributed species, however, has shown mixed results. While some have discovered morphologically similar cryptic species such as those from chemosynthetic habitats (Bickford et al., 2007; Hutchings & Kupriyanova, 2018; Pérez‐Portela et al., 2013; Wang et al., 2020), others have confirmed their wide distribution patterns (McCowin et al., 2019; Thomas et al., 2020). Nevertheless, a significant number of marine species have not undergone a thorough evaluation of their species identity and distribution, impeding our comprehension of diversity and biogeographical patterns.

The family Placunidae Rafinesque, 1815, commonly called windowpane oysters, windowpane shells, or capiz shells, serve as a compelling case for investigating species identity and distribution patterns. This family, classified in the order Pectinida Gray, 1854, inhabits predominantly the coastal waters of the Indo‐Pacific. The family is monogeneric, with Placuna Lightfoot, 1786 as the only genus, and it contains five extant species (P. ephippium Retzius, 1788, P. lincolnii Gray, 1849, P. lobata Sowerby, 1871, P. placenta Linnaeus, 1758, and P. quadrangula Retzius, 1788) and two fossil species (P. mandirantjanensis Martin, 1909 and P. pseudoplacenta Martin, 1909), all named between 1758 and 1871 (MolluscaBase, 2024). The type species P. placenta, characterized by semitransparent shells, has high commercial value: it is an edible species and its shells are widely used for crafting ornamental wares and traditional windowpanes (Gallardo et al., 1995; Rustia et al., 2023). This species is widely reported from the northern to the eastern Indian Ocean and the western to southern Pacific Ocean (MolluscaBase, 2024). In China, P. placenta has been reported from the intertidal zone of the northern South China Sea and the southern East China Sea (Li et al., 2019; Liu, 2008). However, our preliminary analysis of the mitochondrial cytochrome c oxidase subunit I (cox1) of “P. placenta” specimens from the Chinese coastal waters revealed Kimura 2‐parameter (K2P) genetic distances >11% with a P. placenta sample collected from Singapore (Bieler et al., 2014). These K2P distances are much larger than the variations typically considered intraspecific for bivalves (i.e., 2.0%) (Lin et al., 2022; Yu & Li, 2012). In addition, we collected several shells of 8000–6000 years old from Hong Kong (WWF Hong Kong, 2013), which appear to come from an extinct species since we cannot find any living windowpane oysters in that area. These live specimens and subfossil shells appear distinct from each other and the recognized species of the genus.

Therefore, this study aims to characterize the two new species of Placuna from China based on a rigorous molecular phylogenetic framework and morphological analysis. We describe the morphology of the two new species of Placuna and construct an identification key to all species of the genus. For species with soft tissues available, we amplified five gene fragments and conducted a phylogenetic study of Placuna spp. Our results enrich the genetic information of Placunidae and prompt reevaluation of marine bivalve species that are considered widely distributed (Jackson et al., 2015).

2 MATERIALS AND METHODS

2.1 Sample collection

Type specimens of P. vitream sp. nov. were collected from the intertidal zone of Xincun Port (18°24.55’ N, 109°58.49′ E), Sanya, Hainan Island, China, in November 2023. The type specimens of P. aestuaria sp. nov. (empty shells only) were collected from the Mai Po Nature Reserve (22°29.03’ N, 114°01.56′ E), Hong Kong, in July 2023, buried in the unearthed mud located in the Deep Bay area. The adductor muscles of fresh specimens were preserved using 100% ethanol for DNA extraction, and all shells were cleaned and kept in room temperature (Table 1).

TABLE 1 Specimens used in this study.

Species	Specimen ID	Condition	Date	Location	
Placuna vitream sp. nov.	TMBC031019‐031023	Complete individuals	11/2023	Sanya, Hainan, China	
TMBC031024‐031036	Complete individuals	05/2023	Haikou, Hainan, China	
TMBC031037	Adductor muscle	01/2023	Xiamen, Fujian, China	
P. aestuaria sp. nov.	TMBC031038‐031057	Subfossil paired shells	07/2023	Hong Kong, China	
P. ephippium	TMBC031058	Left shell	11/2023	Sanya, Hainan, China	
TMBC031059‐031060	Paired shell	12/2023	Sanya, Hainan, China	
TMBC031061‐031063	Complete individual	12/2023	Sanya, Hainan, China	
P. quadrangula	TMBC031064‐031065	Paired shells	Unknown	Mactan Island, Philippines	
TMBC031066	Shells with air‐dried adductor muscle	Unknown	Bilangbilangan Island, Philippines	

2.2 Other materials studied

More specimens of P. vitream sp. nov. were purchased from the fisherman in Dongmen Market, Haikou, Hainan Island, China, in May 2023, while an adductor muscle sample of P. vitream sp. nov. was collected from Xiajin Bay (24°30.48’ N, 118°12.25′ E), Xiamen, Fujian, China, in January 2023. The specimens of P. ephippium were collected from the same location as the P. vitream sp. nov. type specimens. The samples of P. quadrangula were collected from the intertidal zone of Bilangbilangan Island (10°14.49’ N, 124°27.14′ E), Philippines (Table 1).

2.3 Morphological measurement and photography

The Placuna shells were measured using a vernier caliper to determine the shell length (L), height (H), hinge length (HL), hinge height (HH), anterior hinge length (AHL), anterior ridges length (ARL), posterior ridges length (PRL), scar length (SL), anterior length (AL), dorsal height (DH), and ridge angle (RA) (Figure 1). The specimens were photographed using an EOS 5D Mark IV camera (Canon, Japan), and their details were observed using a digital Stereo Microscope MZ1270i Imaging System (Nikon, Japan). The type specimens used in this study were deposited in the Tropical Marine Biodiversity Collections of the South China Sea (TMBC), Chinese Academy of Sciences, Guangzhou, China.

FIGURE 1 Schematic view of the Placuna shell. AL, anterior length; AHL, anterior hinge length; ARL, anterior ridges length; DH, dorsal height; H, height; HH, hinge height; HL, hinge length; L, length; PRL, posterior ridges length; RA, ridge angle; SL, scar length.

2.4 DNA extraction and PCR

The genomic DNA of P. vitream sp. nov., P. ephippium, and P. quadrangula was extracted from the adductor muscle using the CTAB method (Stewart & Via, 1993). The genomic DNA quality was determined using agarose gel (1.0%) electrophoresis and quantified using a NanoDrop ND‐1000 spectrophotometer (Thermo Scientific, USA). Three nuclear (18S rRNA, 28S rRNA, and histone H3) and two mitochondrial (cox1 and 16S rRNA) maker genes were amplified using KOD One PCR Master Mix (Toyobo, Japan) following the manufacturer's protocol. The following primers were used: LCO1490 and HCO2198 (5′‐GGTCAACAAATCATAAAGATATTGG‐3′/5′‐TAAACTTCAGGGTGACCAAAAAATCA‐3′) (Folmer et al., 1994) for cytochrome oxidase I (cox1), LRJ and 16SA (5′‐CTCCGGTTTGAACTCAGATCA‐3′/5′‐ATGTTTTTGATAAACAGGCG‐3′) (Baco‐Taylor, 2002; Ratnasingham & Hebert, 2007) for 16S rRNA, F19 and R1843 (5′‐ACCTGGTTGATCCTGCCA‐3′/5′‐GGATCCAAGCTTGATCCTTCTGCAGGTTCACCTAC‐3′) (Elwood et al., 1985; Turbeville et al., 1994) for 18S rRNA, D1R and LSUB (5′‐ACCCGCTGAATTTAAGCATA‐3′/5′‐ACGAACGATTTGCACGTCAG‐3′) (Litaker et al., 2003; Scholin et al., 1994) for 28S rRNA, and H3F and H3R (5′‐ATGGCTCGTACCAAGCAGACGC‐3′/5′‐ATATCCTTGGCATATGTGAC‐3′) (Colgan et al., 1998) for histone H3. The PCR products were bidirectionally sequenced on an ABI PRISM 3730xl DNA Analyzer (Thermo Fisher Scientific). The sequences for phylogenetic analyses were assembled using SeqMan (DNASTAR).

2.5 Phylogenetic analyses and genetic distance estimation

Phylogenetic analyses were conducted to determine the position of P. vitream sp. nov. based on the five abovementioned gene fragments. Available sequences of 22 representative species from the order Pectinida and Limidae (outgroup) were downloaded from GenBank (https://www/ncbi.nlm.nih.gov/) (Table 2). The longest fragment for each gene was selected if one species had two or more sequence records. The analyses were conducted using PhyloSuite v1.2.2 (Zhang et al., 2020) with several plug‐in programs: (1) MAFFT v7.520 (Katoh & Standley, 2013) under the “auto” option was applied to align each gene fragment with the “Normal alignment” mode; (2) Gblocks v0.91b (Talavera & Castresana, 2007) was applied to remove ambiguously aligned fragments in batches, with missing genes or alignment gaps filled with “‐”; (3) Then, the fragments were concatenated and ModelFinder v1.5.4 (Kalyaanamoorthy et al., 2017) was used to select the best‐fit model according to the BIC criterion; (4) Bayesian inference (BI) and maximum‐likelihood (ML) analyses were conducted using MrBayes v3.2.6 (Ronquist et al., 2012) and IQ‐TREE2 v2.1.2 (Nguyen et al., 2015) with the GTR + R3 + F model, under the partition model for 10 million generations and 100 thousand ultrafast bootstraps, respectively (Minh et al., 2013). The pairwise genetic distances between different species for each gene were estimated using the Kimura 2‐parameter (K2P) model implemented in MEGA v7.0 (Kumar et al., 2016).

TABLE 2 Genbank accession numbers of the gene fragments used in the genetic distance calculations and phylogenetic analyses.

Family	Genus	Species	cox1	16S rRNA	18S rRNA	28S rRNA	Histone H3	
Placunidae	Placuna	vitreum nov. sp. HT1	PP711111	PP599757	PP599752	PP599761	PP663639	
vitreum nov. sp. HT2	PQ008987	PQ032325	PQ032329	PQ008442	PQ030828	
vitreum nov. sp. HT3	PQ008988	PQ032326	PQ032330	PQ008443	PQ030829	
vitreum nov. sp. HT4	PQ008989	PQ032327	PQ032331	PQ008444	PQ030830	
vitreum nov. sp. HT5	PQ008990	PQ032328	PQ032332	PQ008445	PQ030831	
vitreum nov. sp. PT1	PP711110	PP599756	PP599751	PP599762	PP663638	
vitreum nov. sp. PT2	PP711112	PP599758	PP599753	PP599763	PP663640	
ephippium	PP711114	PP599760	PP599755	PP599765	PP663642	
quadrangula	PP711113	PP599759	PP599754	PP599764	PP663641	
placenta	KC429104	HQ840731	KC429343	KC429442	KC429180	
sp. HS0121	MT896307	/	/	/	/	
Anomiidae	Anomia	simplex	KF850693	JN133626	/	/	/	
ephippium	KF369196	KX713191	AF120535	KX713358	KX713513	
chinensis	MN608245	/	/	AB105361	/	
sp. FP2010	GQ166573	GQ166557	/	/	/	
Pododesmus	caelata	/	/	AJ389650	AJ307555	/	
patelliformis	/	KC429261	KC429342	KC429441	KC429179	
Dimydae	Dimya	lima	/	KX713213	KC429344	KX713375	KC429181	
sp. DJC‐2016	/	/	KX713288	KX713376	KX713532	
Entoliidae	Pectinella	aequoris	/	/	/	MH464049	MH464038	
Plicatuloidea	Plicatula	sp. DJC‐2016	/	/	KX713337	KX713424	KX713573	
australis	/	/	AF229626	AB102737	KC429178	
Spondylidae	Spondylus	gaederopus	JF496776	KR676345	KT757808	KT757854	KT757896	
Propeamussiidae	Parvamussium	torresi	/	MH464019	MH464099	MH464043	MH464032	
Propeamussium	sp. VLG‐2013	KC429103	KC429259	KC429340	KC429437	KC429176	
Pectinidae	Argopecten	purpuratus	KP265825	JN848518	EU660809	/	EU379526	
Adamussium	colbecki	/	HM600752	MH464058	FJ263652	EU379491	
Chlamys	hastata	/	FJ263648	MH464068	FJ263658	FJ263667	
Crassadoma	gigantea	/	EU379444	L49050	FJ263654	EU379498	
Flexopecten	glaber	HQ197900	MH490816	AJ389662	AJ307545	JQ611569	
Pecten	maximus	KC429102	X82501	L49053	KC429436	KC429175	
Outgroup	Lima	lima	AF120649	KC429257	KC429339	AJ307558	JQ611555	

3 RESULTS

3.1 Systematics

Order: Pectinida Gray, 1854.

Superfamily: Anomioidea Rafinesque, 1815.

Family: Placunidae Rafinesque, 1815.

Genus: Placuna Lightfoot, 1786.

Synonyms: Ephippium Röding, 1798; Placenta (Retzius, 1788); Sellaria Link, 1807.

Type species: Placuna placenta Linnaeus, 1758.

Synonyms: Anomia placenta Linnaeus, 1758; Ephippium transparens Röding, 1798; Placenta orbicularis Retzius, 1788; Placenta auriculata Mörch, 1853; Placenta communis Megerle von Mühlfeld, 1811.

Diagnosis (modified from Matsukuma, 1987): Shell inequivalve, thin, very compressed, translucent to opaque, slightly fragile. Valves roughly subquadrate to subcircular, left valve more convex, ventral margin rounded. External surface lamellate, periostracum absent, internal surface smooth. Inverted V‐shaped hinge ridges and ligaments equal or unequal. Adductor muscle scar subcircular, close to valve center.

3.2 Placuna vitream sp. nov

https://zoobank.org/NomenclaturalActs/cb26877e‐51dd‐4330‐9de5‐3bce8b151c1c

3.2.1 Type materials and locality

Holotype (TMBC031019), paratypes 1–4 (TMBC031020‐031023), collected from the type locality Xincun Port (18°24.55’ N, 109°58.49′ E), Sanya City, Hainan Island, China by Mr. Yi‐Tao Lin and Mr. Junhao Pan in May 2023. Paratypes 5–18 (TMBC031024‐031036), collected from Dongmen Market (20°2′26″, 110°20′45″), Haikou City, Hainan Island, China by Mr. Xiao Han, Dr. Yanjie Zhang, and Mr. Juhao Wang in May 2023.

3.2.2 Distribution

Currently known from Xincun Port, Sanya, and Xiajin Bay, Xiamen in China.

3.2.3 Etymology

The epithet “vitream” refers to this species' translucent and pearl‐like glittery shells.

3.2.4 Diagnosis

Shell up to 110 mm, subcircular and translucent. Hinge slim with clear hinge teeth. Umbones slightly prominent, close to the anterior end of the hinge. Auricles obvious, anterior auricle larger than posterior auricle. Ridges angle moderate from 28° to 31°. Hinge ridges and ligaments slightly curved; anterior ridge shorter than posterior ridge.

3.2.5 Description

Shell (Figures 2 and 3a,b, Tables 3 and 4) subcircular, translucent, and very compressed. Left valve more convex than right valve. External surface with growth lines, mauve dorsal, and gray lamella, without radial lines. Length up to 110 mm, nearly equal to height (L/H = 0.960–1.050) and approximate equilateral (AL/L = 0.450–0.507). Umbones slightly prominent, close to anterior end of hinge (AHL/HL = 0.205–0.325). Auricles obvious, anterior auricle larger than posterior auricle. Hinge slim (HH/HL = 0.082–0.135), slightly rounded, with obscure hinge teeth or without teeth. Hinge ridges and ligaments slightly curved, inverted V‐shaped, with moderate ridge angle (RA) from 28° to 31°. Anterior hinge ridge and ligament shorter than posterior ridge (ARL/PRL = 0.594–0.761). Anterior pedal retractor scar oval, close to middle between ligament posterior ends. Adductor muscle scar subcircular, close to valve center.

FIGURE 2 External and internal views of the left and right valves from three pairs of Placuna vitream sp. nov. specimens. (a–d) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of the holotype (TMBC031019), respectively; (e–h) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of the paratype 1 (TMBC031020), respectively; (i–l) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of the paratype 2 (TMBC031021), respectively. Scale bar: 10 mm.

FIGURE 3 Internal views of three Placuna species and the statistical study of morphological features of the two new species. (a,b) The left and right valves of P. vitream sp. nov. holotype (TMBC031019); (c) Anatomy of P. vitream sp. nov. paratype 2 (TMBC031021); (d,e) The left and right valves of P. aestuaria sp. nov. holotype (TMBC031038). (f) The type specimen of Placuna placenta stored in the Linnean Society of London (https://linnean‐online.org/) for morphological comparison. (g) Statistical study of the shell morphological indices and ridge angles between two new species. The details are shown in Tables 3 and 4. AL, anterior length; AHL, anterior hinge length; ARL, anterior ridges length; a, anus; ad, adductor muscle; dd, digestive diverticula; DH, dorsal height; f, foot; gi, gill; go, gonad; H, height; HH, hinge height; HL, hinge length; L, length; m, mantle; PRL, posterior ridges length; r, rectum; RA, ridge angle; SL, scar length; t, tentacle; v, ventricle. Scale bar: 10 mm.

TABLE 3 Measurements of the left valves of the specimens (in mm where applicable).

Species	Specimen ID	Length (L)	Height (H)	Hinge length (HL)	Hinge height (HH)	Anterior hinge length (AHL)	Anterior ridge length (ARL)	Posterior ridge length (PRL)	Scar length (SL)	Anterior length (AL)	Dorsal height (DH)	Ridge angle (RA)	
Placuna vitream sp. nov.	TMBC031019	108.3	103.1	23.7	3.2	6.1	18.6	26.3	17.4	53.7	55.6	29.5	
TMBC031020	65.7	64.5	12.6	1.5	4.1	9.6	15.1	10.5	33.0	30.9	29.5	
TMBC031021	64.4	65.2	18.2	1.6	4.0	9.3	15.0	10.1	30.8	32.4	29.0	
TMBC031022	57.2	62.5	14.8	1.3	3.5	9.4	14.0	9.9	29.0	30.3	28.5	
TMBC031023	59.3	61.6	18.2	1.5	3.9	8.2	13.8	9.2	27.9	30.4	30.0	
TMBC031024	55.8	58.1	14.0	1.3	3.2	8.0	13.4	9.5	25.1	29.2	31.0	
TMBC031025	50.3	50.7	12.2	1.0	2.5	6.7	10.1	8.0	24.5	24.8	30.0	
TMBC031026	106.2	107.2	23.4	2.6	6.2	16.8	24.3	18.2	53.1	53.4	28.0	
TMBC031027	104.0	100.8	21.2	2.0	6.8	16.6	21.8	19.5	48.8	52.9	28.0	
TMBC031028	63.9	68.4	12.9	1.2	4.0	10.2	15.0	8.5	29.9	33.5	29.0	
TMBC031029	58.2	57.9	12.8	1.1	2.3	8.0	12.1	10.0	30.4	27.0	29.5	
TMBC031030	56.8	55.3	17.6	1.3	2.9	7.3	11.2	7.4	27.2	25.3	28.0	
TMBC031031	57.2	58.3	14.1	1.1	2.5	7.8	11.2	9.1	26.5	27.5	30.0	
TMBC031032	51.0	58.8	14.3	1.2	2.9	8.9	12.7	8.0	24.8	29.5	28.5	
TMBC031033	55.1	55.0	15.5	1.2	3.2	7.6	12.5	9.3	27.8	26.9	32.0	
TMBC031034	51.5	49.8	10.9	0.8	3.0	6.9	10.1	8.2	24.9	23.2	30.0	
TMBC031035	55.2	55.0	10.0	1.0	2.1	7.1	11.2	8.9	28.0	27.0	29.5	
TMBC031036	58.2	62.2	7.3	0.7	1.5	7.0	11.8	8.3	31.4	26.3	29.0	
P. aestuaria sp. nov.	TMBC031038	109.8	108.1	18.7	4.0	6.2	18.9	22.8	18.3	53.8	54.6	23.0	
TMBC031039	107.2	116.0	22.0	5.7	7.0	18.5	28.0	17.0	54.0	60.4	26.0	
TMBC031040	81.4	84.1	11.8	3.5	3.5	15.2	24.4	12.9	42.3	43.0	24.0	
TMBC031041	121.1	133.2	24.6	7.2	10.3	30.0	41.6	21.1	62.5	78.0	25.0	
TMBC031042	78.2	77.3	14.4	3.0	4.5	11.8	17.2	12.3	38.5	37.0	24.0	
TMBC031043	95.7	95.0	18.8	4.2	5.0	16.7	24.5	15.0	45.2	48.0	25.5	
TMBC031044	92.5	89.8	14.6	4.7	5.3	14.8	20.5	16.8	45.2	45.9	26.0	
TMBC031045	92.2	81.8	21.0	4.5	5.0	13.5	19.2	14.8	44.6	43.9	22.0	
TMBC031046	87.4	94.9	18.4	4.8	6.9	16.2	24.8	15.5	40.2	47.0	25.0	
TMBC031047	86.5	78.0	15.1	4.3	4.1	13.5	21.9	12.0	44.0	41.7	23.0	
TMBC031048	85.8	78.9	19.1	4.9	4.8	12.0	18.2	14.8	43.2	41.8	25.5	
TMBC031049	82.9	81.0	18.0	3.8	6.5	13.0	18.2	12.6	41.5	40.9	21.0	
TMBC031050	79.6	77.5	16.8	3.7	4.6	12.9	17.3	12.4	41.0	40.0	21.0	
	TMBC031051	75.0	79.8	15.3	3.2	4.3	13.0	18.9	10.7	39.5	38.0	23.0	
TMBC031052	78.0	79.2	18.9	4.8	6.0	14.7	20.1	12.3	36.8	42.7	22.0	
TMBC031053	72.4	69.7	14.8	3.1	5.4	10.3	15.5	11.2	34.8	33.0	25.5	
TMBC031054	69.9	67.0	14.0	3.0	3.9	10.1	15.6	11.7	35.6	33.0	23.5	
TMBC031055	104.1	104.5	23.5	5.3	7.3	18.7	27.6	17.5	52.5	58.1	24.0	
TMBC031056	86.1	91.3	20.2	5.4	5.5	17.7	25.2	16.0	45.2	48.4	22.0	
TMBC031057	69.8	68.1	13.0	2.8	3.0	10.2	15.1	12.6	33.0	34.4	21.0	
P. ephippium	TMBC031058	156.8	105.9	20.7	1.7	10.0	20.0	20.7	17.7	78.5	53.0	68.0	
TMBC031059	122.2	101.7	27.0	2.3	13.8	17.7	18.7	14.9	67.0	48.2	70.0	
TMBC031060	101.2	87.8	24.4	2.3	12.2	13.6	15.2	14.2	53.0	43.3	69.0	
TMBC031061	89.8	78.9	23.2	1.9	8.2	12.9	13.2	12.9	47.0	36.3	66.0	
TMBC031062	91.2	87.4	25.8	2.8	13.5	14.5	17.0	11.3	47.2	38.7	66.0	
TMBC031063	119.8	107.7	17.4	1.4	8.1	14.5	15.6	13.4	60.3	42.6	70.0	
P. quadrangula	TMBC031064	80.9	69.7	19.0	2.1	9.5	10.5	10.4	10.7	39.7	28.0	75.0	
TMBC031065	81.9	71.2	19.7	2.0	10.1	11.2	12.0	10.4	40.2	31.5	75.0	
TMBC031066	83.8	72.7	20.8	2.2	10.3	10.7	11.5	10.3	44.0	28.0	80.0	

TABLE 4 Shell morphological ratios of the specimens used in this study.

Species	Specimen ID	L/H	HL/L	HH/HL	AHL/HL	ARL/PRL	SL/L	AL/L	DH/H	
P. vitream sp. nov.	TMBC031019	1.050	0.219	0.135	0.257	0.707	0.161	0.496	0.539	
TMBC031020	1.019	0.192	0.119	0.325	0.636	0.160	0.502	0.479	
TMBC031021	1.032	0.204	0.094	0.321	0.761	0.188	0.469	0.525	
TMBC031022	0.915	0.259	0.088	0.236	0.671	0.173	0.507	0.485	
TMBC031023	0.963	0.307	0.082	0.214	0.594	0.155	0.470	0.494	
TMBC031024	0.960	0.251	0.093	0.229	0.597	0.170	0.450	0.503	
TMBC031025	0.992	0.243	0.082	0.205	0.663	0.159	0.487	0.489	
TMBC031026	0.991	0.220	0.111	0.265	0.691	0.171	0.500	0.498	
TMBC031027	0.988	0.283	0.088	0.220	0.620	0.157	0.478	0.497	
TMBC031028	0.934	0.202	0.093	0.310	0.680	0.133	0.468	0.490	
TMBC031029	1.005	0.220	0.086	0.180	0.661	0.172	0.522	0.466	
TMBC031030	1.027	0.310	0.074	0.165	0.652	0.130	0.479	0.458	
TMBC031031	0.981	0.247	0.078	0.177	0.696	0.159	0.463	0.472	
TMBC031032	0.867	0.280	0.084	0.203	0.701	0.157	0.486	0.502	
TMBC031033	1.002	0.281	0.077	0.206	0.608	0.169	0.505	0.489	
TMBC031034	1.034	0.212	0.073	0.275	0.683	0.159	0.483	0.466	
TMBC031035	1.004	0.181	0.100	0.210	0.634	0.161	0.507	0.491	
TMBC031036	0.936	0.125	0.096	0.205	0.593	0.143	0.540	0.423	
P. aestuaria sp. nov.	TMBC031038	1.016	0.170	0.214	0.332	0.829	0.167	0.490	0.505	
TMBC031039	0.924	0.205	0.259	0.318	0.661	0.159	0.504	0.521	
TMBC031040	0.968	0.145	0.297	0.297	0.623	0.158	0.520	0.511	
TMBC031041	0.909	0.203	0.293	0.419	0.721	0.174	0.516	0.586	
TMBC031042	1.012	0.184	0.208	0.313	0.686	0.157	0.492	0.479	
TMBC031043	1.007	0.196	0.223	0.266	0.682	0.157	0.472	0.505	
TMBC031044	1.030	0.158	0.322	0.363	0.722	0.182	0.489	0.511	
TMBC031045	1.127	0.228	0.214	0.238	0.703	0.161	0.484	0.537	
TMBC031046	0.921	0.211	0.261	0.375	0.653	0.177	0.460	0.495	
TMBC031047	1.109	0.175	0.285	0.272	0.616	0.139	0.509	0.535	
TMBC031048	1.087	0.223	0.257	0.251	0.659	0.172	0.503	0.530	
TMBC031049	1.023	0.217	0.211	0.361	0.714	0.152	0.501	0.505	
TMBC031050	1.027	0.211	0.220	0.274	0.746	0.156	0.515	0.516	
TMBC031051	0.940	0.204	0.209	0.281	0.688	0.143	0.527	0.476	
TMBC031052	0.985	0.242	0.254	0.317	0.731	0.158	0.472	0.539	
TMBC031053	1.039	0.204	0.209	0.365	0.665	0.155	0.481	0.473	
TMBC031054	1.043	0.200	0.214	0.279	0.647	0.167	0.509	0.493	
TMBC031055	0.996	0.226	0.226	0.311	0.678	0.168	0.504	0.556	
TMBC031056	0.943	0.235	0.267	0.272	0.702	0.186	0.525	0.530	
TMBC031057	1.025	0.186	0.215	0.231	0.675	0.181	0.473	0.505	
P. ephippium	TMBC031058	1.481	0.132	0.082	0.483	0.966	0.113	0.501	0.500	
TMBC031059	1.202	0.221	0.085	0.511	0.947	0.122	0.548	0.474	
TMBC031060	1.153	0.241	0.094	0.500	0.895	0.140	0.524	0.493	
TMBC031061	1.138	0.258	0.082	0.353	0.977	0.144	0.523	0.460	
TMBC031062	1.043	0.283	0.109	0.523	0.853	0.124	0.518	0.443	
TMBC031063	1.112	0.145	0.080	0.466	0.929	0.112	0.503	0.396	
P. quadrangula	TMBC031064	1.161	0.235	0.111	0.500	1.010	0.132	0.491	0.402	
TMBC031065	1.150	0.241	0.102	0.513	0.933	0.127	0.491	0.442	
TMBC031066	1.153	0.248	0.106	0.495	0.930	0.123	0.525	0.385	

Anatomy (Figure 3c): Mantle large, thin, and semitransparent, with distinct mantle edge and row of tentacles at the margin. Large and C‐shaped gill at anterior side. Digestive diverticula subcircular. Adductor muscle large, circular, near shell center. Foot small, anteriorly located between digestive diverticula and adductor muscle. Ventricle circular, posteriorly located between digestive diverticula and adductor muscle. Gonad folded scrotiform, posterior to digestive diverticula.

3.2.6 Remarks

Within the genus Placuna, P. vitream sp. nov. can be distinguished from P. ephippium, P. quadrangula, P. lincolnii, and P. lobata by its unequal length of the hinge ridges and ligaments (Das et al., 2019; Dunker, 1879; Matsukuma, 1987) (Figures 3a,b and 6, Tables 3 and 4). The AHL/HL ratio of P. vitream sp. nov. is much smaller than that of P. ephippium and P. quadrangula, which means the umbones of the former are located at the anterior end of the hinge, whereas those of the latter two are located near the hinge center. Although such data are unavailable for P. lincolnii and P. lobata, previous studies showed that their umbones are in the middle of the hinge (Dunker, 1879; Gray, 1849; Matsukuma, 1987). Placuna vitream sp. nov. and two fossil species P. pseudoplacenta and P. mandirantjanensis exhibit similar shell shapes, outlines, and V‐shaped hinges. However, the ridge angles of the two fossil species are substantially larger (RA > 60°) (Martin, 1909) than P. vitream sp. nov. (28°–31°), and the anterior hinge ridge of P. vitream sp. nov. is straighter. Notably, P. vitream sp. nov. is morphologically most similar to the windowpane shell P. placenta, which may explain its records as a common species in Chinese coastal waters (Li et al., 2019; Liu, 2008). They are extremely similar in shell shape, outline, hinge ridge and ligament form, and autonomy (Yonge, 1977). Considering the widely distributed so‐called “P. placenta” and the taxonomic uncertainty of the specimens from other locations, we only compared P. vitream sp. nov. with the holotype of P. placenta (Figure 3f) stored in the Linnean Society of London (https://linnean‐online.org/). The P. placenta holotype, whose sampling locality is unknown as Carl Linnaeus only wrote “Pelago” = the Ocean for its habitat, processes a gentle dorsal outline and inconspicuous umbones (Linnaeus, 1758). Our statistical study shows that ridge angle is a significant feature for species identification within Placuna (Figure 3g). The ridge angle of P. placenta is about 21° (Linnaeus, 1758), which is slightly smaller than 28° to 31° in P. vitream sp. nov. (Figures 2 and 3a,b, Table 2). In conclusion, P. vitream sp. nov. can be distinguished from its congeneric species and regarded as a new species.

3.2.7 Phylogenetic and genetic distance analyses

Sequencing the target gene fragments of P. vitream sp. nov., P. ephippium, and P. quadrangula produced 657 bp cox1, 384–388 bp 16S rRNA, 1765 bp 18S rRNA, 2098–2102 bp 28S rRNA, and 328 bp histone H3. After alignment, trimming, and concatenation of these five fragments with 22 other Pectinida species and an outgroup Limida, a 4745 bp matrix was generated. The BI and ML trees are identical in topology (Figure 4). The Placuna species form a single clade of Placunidae with new data from three species: P. quadrangula, P. ephippium, and the new species. Among them, the P. vitream sp. nov. specimens are fully supported to be sister to the specimen from Singapore identified as P. placenta (posterior probability = 1.0, bootstrap value = 100). Among the eight families of Pectinida included in the analyses, only Anomiidae is paraphyletic, with Anomia simplex and Anomia sp. being sister to Placunidae, and together they are sister to A. chinensis and a clade comprising A. ephippium, Pododesmus caelata, and P. patellifomis.

FIGURE 4 Phylogenetic relationships of Pectinida. (a) The placement of Placuna vitream sp. nov. in Pectinida revealed by a 4745‐bp concatenated alignment (cox1‐16S rRNA‐18S rRNA‐28S rRNA‐histone H3) using Bayesian inference (BI) analysis. Bootstrap values from maximum‐likelihood analysis and posterior probabilities values from BI analysis are given at nodes. Sequences generated from this study are highlighted in red color. The sequences P. vitream sp. nov. HT1‐5 represent the specimens TMBC031019‐TMBC031023 collected from the type locality, while the sequences P. vitream sp. nov. PT1‐2 represent the specimens collected from Haikou and Xiamen, respectively.

The intraspecific K2P genetic distances within P. vitream sp. nov. are 0%–0.31% for cox1 (Figure 5) and 0% for the other four gene fragments. By contrast, the K2P distances between P. vitream sp. nov. and other congeneric species are much larger, ranging from 11.43% to 19.17%. Even for the sister species P. placenta, their divergences were 11.43%–11.82% for cox1, 0.38% for 16S rRNA, and 0.91% for 18S rRNA (Figure 5). However, 28S rRNA and histone H3 were highly conserved with genetic distances of 0.17% and 0% between P. vitream sp. nov. and P. placenta, respectively. The large interspecific genetic distances of cox1 between P. vitream sp. nov. and other Placuna species support our recognition of the new species.

FIGURE 5 The Kimura 2‐parameter (K2P) genetic distances (%) based on the cox1 fragments among Pectinida. The analysis was performed based on a 615‐bp matrix, with the species Lima lima as the outgroup. The sequences P. vitream sp. nov. HT1‐5 represent the specimens TMBC031019‐TMBC031023 collected from the type locality, while the sequences P. vitream sp. nov. PT1‐2 represent the specimens collected from Haikou and Xiamen, respectively.

3.3 Placuna aestuaria sp. nov

https://zoobank.org/NomenclaturalActs/4FBABB26‐BFE7‐41DF‐8317‐809F8E621BBA

3.3.1 Type materials and locality

Holotype (TMBC031038), paratypes 1–19 (TMBC031039‐031057), collected in the type locality Mai Po Nature Reserve (22°29.03’ N, 114°01.56′ E), Hong Kong SAR, China by Mr. Yi‐Tao Lin and Dr. Carmen K. M. Or, in July 2023.

3.3.2 Distribution

Currently known only from the Mai Po Nature Reserve, Hong Kong SAR, China.

3.3.3 Etymology

The species epithet “aestuaria” comes from “estuarial” in Latin, which refers to the estuarine waters of the type locality of this species.

3.3.4 Diagnosis

Placuna with a large shell up to 122 mm, oval to subcircular, and semitransparent to opaque. Hinge broad with clear hinge teeth. Umbones anteriorly close to the hinge center. Ridges angle 23° to 26°. Anterior hinge ridge and ligament shorter than posterior. Auricle broad and large, and anterior auricle approximately equal to or slightly larger than posterior auricle.

3.3.5 Description

Shell (Figures 3d,e and 7, Tables 3 and 4) oval to subcircular, opaque, and very compressed. Left valve more convex than right valve. External surface with growth lines and gray lamella, without radial lines. Length up to 122 mm, nearly equal to the height (L/H = 0.909–1.016) and approximate equilateral (AL/L = 0.490–0.520). Hinge broad (HH/HL = 0.208–0.297), slightly rounded, with clear hinge teeth. Umbones anteriorly close to middle of hinge (AHL/HL = 0.297–0.419). Hinge ridges and ligaments nearly straight, inverted V‐shaped with moderate ridge angle (RL) from 23° to 26°. Anterior hinge ridge and ligament shorter than posterior ridge (ARL/PRL = 0.623–0.829). Auricles broad and large, anterior auricle approximately equal or slightly larger than posterior auricle. Anterior pedal retractor scar oval, located between the distal ends of two ridges, slightly close to anterior ridge. Adductor muscle scar subcircular, close to valve center.

3.3.6 Remarks

The unequal hinge ridges and ligaments allow P. aestuaria sp. nov. to be distinguished from P. ephippium, P. quadrangula, P. lincolnii, and P. lobata with equal hinge ridges and ligaments, and the ratio AHL/HL of P. aestuaria sp. nov. is much smaller than that of P. ephippium and P. quadrangula (Das et al., 2019; Dunker, 1879; Matsukuma, 1987) (Figures 3d,e, 6, and 7, Tables 3 and 4). The ridge angle of P. aestuaria sp. nov. (23°–26°) is slightly larger than that of P. placenta (21°), and much smaller than that (60°) of the fossil species P. pseudoplacenta and P. mandirantjanensis (Martin, 1909). Besides, our statistical study between P. aestuaria sp. nov. and P. vitream sp. nov. clearly shows that the morphological indices, including HH/HL and AHL/HL, and ridge angle are significantly different (Figure 3g). Furthermore, the hinge and auricles of P. aestuaria sp. nov. are substantially distinct and broad with nearly straight hinge ridges (both anterior and posterior), which could not be observed in the congeneric species (Figures 6d,e and 7). These distinct characteristics support our description of P. aestuaria sp. nov.

FIGURE 6 External and internal views of the left and right valves from two species of Placuna. (a–d) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of P. ephippium (TMBC031059), respectively; (e–h) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of P. quadrangula (TMBC031064), respectively. Scale bar: 10 mm.

FIGURE 7 External and internal views of the left and right valves from three pairs of Placuna aestuaria sp. nov. specimens. (a–d) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of the holotype (TMBC031038), respectively; (e–h) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of the paratype 1 (TMBC031039), respectively; (i–l) External view of left valve, external view of right valve, internal view of left valve, internal view of right valve of the paratype 2 (TMBC031040), respectively. Scale bar: 10 mm.

4 DISCUSSION

The identification of Placuna species is challenging due to the variability in shell size, shape, outline, and even the inner surface color, which varies from light purple to dark brown. Placuna contains many synonyms, such as Sellaria Link, 1807 and P. planicostata Dunker, 1879. A previous morphological study posited the hinge as a more appropriate shell section for species identification within this genus, whereas ridge length was also used to separate two groups (or subgenera) of Placuna (i.e., Ephippium and Placenta, currently unaccepted) (Gray, 1849). Besides, the wide geographical ranges of P. placenta, P. ephippium, and P. quadrangula make it difficult to confirm their identification by their geographic locality (Hung & Carson, 2014; Retzius, 1788; Rustia et al., 2023). In this study, we successfully applied a combination of hinge morphology (including the AHL/HL and HH/HL ratios), ridge angle, and auricle features to distinguish the species of Placuna (Figure 3g).

Molecular data are also very limited in Placunidae. Prior to this study, only five gene fragments from P. placenta and a cox1 sequence of an undetermined Placuna species have been published (Bieler et al., 2014; Chang et al., 2020; Sharma et al., 2013). The lack of molecular data makes it difficult to determine the phylogenetic relationships among Placuna spp. and the position of Placuna in Pectinida. The two mitochondrial and three nuclear gene fragments for P. ephippium, P. quadrangula, and P. vitream sp. nov. generated in this study will be useful for future phylogenetic studies of Placula and even Bivalvia. Furthermore, given that DNA‐based analyses have been widely used to distinguish morphologically similar species, such as species in Mytilida, Pteriida, and Venerida (Lemer et al., 2014; Ni et al., 2012; Shen et al., 2014), our discovery of P. vitream sp. nov. suggests that Placuna might be more diverse than previously thought, and “P. placenta” specimens from other locations should be examined to determine their real identities (Gallardo et al., 1995; Li et al., 2019; Rustia et al., 2023; Song et al., 2022).

Key to Placuna Lightfoot, 1786:

1a. Hinge ridges equal in length……2.

1b. Anterior ridge shorter than posterior ridge……4.

2a. Shell saddle or subquadrate shaped……3.

2b. Shell oval to subcircular……P. lincolnii.

3a. Shell flexuous with purple or brown color inter surface……P. ephippium.

3b. Outer surface ornamented with ribs……P. lobata.

3c. Shell semitransparent with radial reddish‐brown stripes……P. quadrangula.

4a. Ridges gently diverged with an angle less than 40°……5.

4b. Anterior ridge strongly curved and ridge angle 60°or larger……7.

5a. Hinge and auricles obvious……6.

5b. The ridge angle smaller than 25°……P. placenta.

6a. The ridge angle larger than 25°……P. vitream sp. nov.

6b. Hinge broad with nearly straight ridges……P. aestuaria.

7a. Shell outer surface with feather‐like, sharply prominent radial sculpture……P. mandirantjanensis.

7b. Shell outer surface dashed by fine and radial ribs……P. pseudoplacenta.

5 CONCLUSION

We reported two new species of Placuna, P. vitream sp. nov., and P. aestuaria, and sequenced two mitochondrial and three nuclear genes for P. ephippium, P. quadrangula, and P. vitream sp. nov. Our K2P genetic distance analyses showed that the three specimens from different locations in China are P. vitream sp. nov. The genetic distance and phylogenetic analyses confirmed the distinction between P. vitream sp. nov. and its sister species from Singapore, which was identified as P. placenta, as well as other congeneric species with corresponding DNA sequences. Besides, we described the shell morphological features of P. vitream sp. nov. and P. aestuaria, and the internal anatomy of P. vitream sp. nov. and P. aestuaria can be distinguished from congeneric species by their hinge structures, ridge angles, and auricle features. Our discovery of P. vitream sp. nov. and P. aestuaria enhances our understanding of the diversity of Placuna. This case study also highlights the urgency of reevaluation of the identity and distribution of marine species in Asian waters, especially those described in the 1970s to early 1900s and considered to have wide distribution ranges.

AUTHOR CONTRIBUTIONS

Yi‐Tao Lin: Data curation (lead); methodology (lead); visualization (lead); writing – original draft (lead). Yi‐Xuan Li: Methodology (equal); visualization (equal). Hai‐Xin Loke: Data curation (equal). Xiao Han: Data curation (equal). Jian‐Wen Qiu: Conceptualization (lead); funding acquisition (lead); project administration (lead); supervision (lead).

CONFLICT OF INTEREST STATEMENT

The authors declare that they have no competing interests.

ACKNOWLEDGMENTS

This project was supported by the Lantau Conservation Fund (RE‐2020‐22) and the Hong Kong Offshore LNG Terminal Project (MCEF22003). We thank Dr. Carmen K. M. Or (WWF Hong Kong), Dr. Yanjie Zhang (Hainan University), Mr. Juhao Wang, and Mr. Junhao Pan for their assistance in sample collection.

DATA AVAILABILITY STATEMENT

The genetic sequences generated in this study are available in GenBank (https://www.ncbi.nlm.nih.gov/genbank/) under the accession numbers shown in Table 2.
==== Refs
REFERENCES

Baco‐Taylor, A. R. (2002). Food web structure, succession, and phylogenetics on deep‐sea whale skeletons. PhD Thesis. University of Hawaii at Manoa.
Bickford, D. , Lohman, D. J. , Sodhi, N. S. , Ng, P. K. L. , Meier, R. , Winker, K. , Ingram, K. K. , & das, I. (2007). Cryptic species as a window on diversity and conservation. Trends in Ecology & Evolution, 22 (3 ), 148–155.17129636
Bieler, R. , Mikkelsen, P. M. , Collins, T. M. , Glover, E. A. , González, V. L. , Graf, D. L. , Harper, E. M. , Healy, J. , Kawauchi, G. Y. , Sharma, P. P. , Staubach, S. , Strong, E. E. , Taylor, J. D. , Tëmkin, I. , Zardus, J. D. , Clark, S. , Guzmán, A. , McIntyre, E. , Sharp, P. , & Giribet, G. (2014). Investigating the bivalve Tree of life–an exemplar‐based approach combining molecular and novel morphological characters. Invertebrate Systematics, 28 (1 ), 32–115.
Chang, J. J. M. , Ip, Y. C. A. , Ng, C. S. L. , & Huang, D. (2020). Takeaways from mobile DNA barcoding with BentoLab and MinION. Genes, 11 (10 ), 1121.32987804
Colgan, D. J. , McLauchlan, A. , Wilson, G. D. , Livingston, S. P. , Edgecombe, G. D. , Macaranas, J. , Cassis, G. , & Gray, M. R. (1998). Histone H3 and U2 snRNA DNA sequences and arthropod molecular evolution. Australian Journal of Zoology, 46 (5 ), 419–437.
Das, R. R. , Samuel, V. K. D. , Sampath, G. , Krishnan, P. , Ramachandran, P. , & Ramachandran, R. (2019). The windowpane oyster family Placunidae Rafinesque, 1815 with additional description of Placuna quadrangula (Philipsson, 1788) from India. Journal of Threatened Taxa, 11 (15 ), 15061–15067.
Dunker, W. (1879). Mollusca quaedam nova. Journal de Conchyliologie, 27 (3 ), 212–217.
Elwood, H. J. , Olsen, G. J. , & Sogin, M. L. (1985). The small‐subunit ribosomal RNA gene sequences from the hypotrichous ciliates Oxytricha nova and Stylonychia pustulata . Molecular Biology and Evolution, 2 (5 ), 399–410.3939705
Folmer, O. , Black, M. , Hoeh, W. , Lutz, R. , & Vrijenhoek, R. (1994). DNA primers for amplification of mitochondrial cytochrome C oxidase subunit I from diverse metazoan invertebrates. Molecular Marine Biology and Biotechnology, 3 , 294–299.7881515
Gallardo, W. G. , Siar, S. V. , & Encena, V., II . (1995). Exploitation of the window‐pane shell Placuna placenta in The Philippines. Biological Conservation, 73 (1 ), 33–38.
Gray, J. E. (1849). On the species of the genus placenta of Retzius. Proceedings of the Royal Society of London, 1849 , 114–115.
Gray, J. E. (1854). A revision of the arrangement of the families of bivalve shells (Conchifera). Annals and Magazine of Natural History, 13 , 408–418.
Hansen, T. A. (1980). Influence of larval dispersal and geographic distribution on species longevity in neogastropods. Paleobiology, 6 (2 ), 193–207.
Hung, H. C. , & Carson, M. T. (2014). Foragers, fishers and farmers: Origins of the Taiwanese Neolithic. Antiquity, 88 (342 ), 1115–1131.
Hutchings, P. , & Kupriyanova, E. (2018). Cosmopolitan polychaetes‐fact or fiction? Personal and historical perspectives. Invertebrate Systematics, 32 (1 ), 1–9.
Jackson, J. A. , Linse, K. , Whittle, R. , & Griffiths, H. J. (2015). The evolutionary origins of the Southern Ocean philobryid bivalves: Hidden biodiversity, ancient persistence. PLoS One, 10 (4 ), e0121198.25853413
Kalyaanamoorthy, S. , Minh, B. Q. , Wong, T. K. , von Haeseler, A. , & Jermiin, L. S. (2017). ModelFinder: Fast model selection for accurate phylogenetic estimates. Nature Methods, 14 (6 ), 587–589.28481363
Katoh, K. , & Standley, D. M. (2013). MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Molecular Biology and Evolution, 30 (4 ), 772–780.23329690
Knowlton, N. (1993). Sibling species in the sea. Annual Review of Ecology and Systematics, 24 (1 ), 189–216.
Kumar, S. , Stecher, G. , & Tamura, K. (2016). MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Molecular Biology and Evolution, 33 (7 ), 1870–1874.27004904
Lemer, S. , Buge, B. , Bemis, A. , & Giribet, G. (2014). First molecular phylogeny of the circumtropical bivalve family Pinnidae (Mollusca, Bivalvia): Evidence for high levels of cryptic species diversity. Molecular Phylogenetics and Evolution, 75 , 11–23.24569016
Li, Q. , Zheng, X. D. , & Kong, L. F. (2019). Mollusks of the Chinese coastal seas. Science Press.
Lightfoot, J. (1786). A catalogue of the Portland museum, lately the property of the duchess dowager of Portland, deceased: Which will be sold by auction by Mr Skinner and Co. (p. 16).
Lin, Y. T. , Kiel, S. , Xu, T. , & Qiu, J. W. (2022). Phylogenetic placement, morphology and gill‐associated bacteria of a new genus and species of deep‐sea mussel (Mytilidae: Bathymodiolinae) from the South China Sea. Deep Sea Research Part I: Oceanographic Research Papers, 190 , 103894.
Link, H. F. (1807). Beschreibung der Naturalien‐Sammlung der Universität zu Rostock. Adlers Erben.
Linnaeus, C. (1758). Systema naturae per regna tria naturae :Secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Editio decima, reformata.
Litaker, R. W. , Vandersea, M. W. , Kibler, S. R. , Reece, K. S. , Stokes, N. A. , Steidinger, K. A. , Millie, D. F. , Bendis, B. J. , Pigg, R. J. , & Tester, P. A. (2003). Identification of Pfiesteria piscicida (Dinophyceae) and Pfiesteria‐like organisms using internal transcribed spacer‐specific PCR assays. Journal of Phycology, 39 , 754–761.
Liu, R. (2008). Checklist of marine biota of China seas. Science Press.
Martin, K. (1909). Lamellibranchiata. Sammlungen des geologischen reichs‐museums in leiden. Neue Folge, 1 (2 ), 333–386.
Matsukuma, A. (1987). Studies on the kawamura collection (Mollusca) stored in the national science museum, Tokyo IV: The family placunidae (Bivalvia) with special reference to their ligament. Venus (Japanese Journal of Malacology), 45 (4 ), 231–244.
McCowin, M. F. , Rowden, A. A. , & Rouse, G. W. (2019). A new record of Lamellibrachia columna (Siboglinidae, Annelida) from cold seeps off New Zealand, and an assessment of its presence in the western Pacific Ocean. Marine Biodiversity Records, 12 , 1–12.
Megerle von Mühlfeld, J. C. (1811). Entwurf eines neuen Systems der Schaltiergehäuse [Design of a new system of shellfish enclosures]. Magazin für die neuesten Entdecklungen in der gesammten Naturkunde von der Gesellschaft Naturforschaft Freunde zu Berlin, 5 (1 ), 38–72.
Minh, B. Q. , Nguyen, M. A. T. , & Von Haeseler, A. (2013). Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution, 30 (5 ), 1188–1195.23418397
MolluscaBase . (2024). MolluscaBase. Placuna Lightfoot, 1786). Accessed through: World Register of Marine Species at. https://marinespecies.org/aphia.php?p=taxdetails&id=206348.
Mörch, O. A. L. (1853). Catalogus conchyliorum quae reliquit D. Alphonso d‘Aguirra & Gadea comes de Yoldi: regis danlae cubiculariorum princeps, ordinis dannebrogici in prima classe & ordinis caroli terth eques [Catalog of the shells left by D. Alphonso d‘Aguirra & Gadea, count of Yoldi: Chief of the chamberlains of King Danla, of the order of the Dannebrog in the first class & knight of the third order of Charles]. Ludovici Kleine.
Nguyen, L. T. , Schmidt, H. A. , von Haeseler, A. , & Minh, B. Q. (2015). IQ‐TREE: A fast and effective stochastic algorithm for estimating maximum‐likelihood phylogenies. Molecular Biology and Evolution, 32 (1 ), 268–274.25371430
Ni, L. , Li, Q. , Kong, L. , Huang, S. , & Li, L. (2012). DNA barcoding and phylogeny in the family Mactridae (Bivalvia: Heterodonta): Evidence for cryptic species. Biochemical Systematics and Ecology, 44 , 164–172.
Pérez‐Portela, R. , Arranz, V. , Rius, M. , & Turon, X. (2013). Cryptic speciation or global spread? The case of a cosmopolitan marine invertebrate with limited dispersal capabilities. Scientific Reports, 3 , 3197.24217373
Rafinesque, C. S. (1815). Analyse de la Nature, ou tableau de l'univers et des corps organisés. Aux dépens de l'auteur.
Ratnasingham, S. , & Hebert, P. D. N. (2007). BOLD: The barcode of life data system. Molecular Ecology Notes, 7 , 355–364.18784790
Retzius, A. J. (1788). Dissertatio historico‐naturalis sistens nova Testaceorum genera. Typis Berlingianis.
Röding, P. F. (1798). Museum Boltenianum sive Catalogus cimeliorum e tribus regnis naturæ quæ olim collegerat Joa. Fried Bolten, M. D. p. d. per XL. annos proto physicus Hamburgensis. Pars secunda continens Conchylia sive Testacea univalvia, bivalvia & multivalvia [The Boltenian Museum or Catalog of souvenirs from the three kingdoms of nature which Joa had once collected. Fried Bolten, M. D. p. d. by 40 years ago, a Hamburg scientist. The second part containing Conchylia or Testacea univalvia, bivalvia & multivalvia]. Trapp, Hamburg.
Ronquist, F. , Teslenko, M. , van der Mark, P. , Ayres, D. L. , Darling, A. , Höhna, S. , Larget, B. , Liu, L. , Suchard, M. A. , & Huelsenbeck, J. P. (2012). MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61 (3 ), 539–542.22357727
Rustia, J. M. , Antonino, J. P. , Velasco, R. R. , Lima, M. A. , Yates, E. A. , & Fernig, D. G. (2023). History and prospects for the sustainability and circularity of the windowpane oyster placuna placenta fishery in The Philippines. Fishes, 8 (10 ), 493.
Scheltema, R. S. (1971). Larval dispersal as a means of genetic exchange between geographically separated populations of shallow‐water benthic marine gastropods. The Biological Bulletin, 140 (2 ), 284–322.
Scholin, C. A. , Herzog, M. , Sogin, M. , & Anderson, D. M. (1994). Identification of group and strain‐specific genetic markers for globally distributed Alexandrium (Dinophyceae). II. Sequence analysis of a fragment of the LSU rRNA gene. Journal of Phycology, 30 , 999–1011.
Schulze, A. , Maiorova, A. , Timm, L. E. , & Rice, M. E. (2012). Sipunculan larvae and “cosmopolitan” species. Integrative and Comparative Biology, 52 (4 ), 497–510.22634356
Sharma, P. P. , Zardus, J. D. , Boyle, E. E. , González, V. L. , Jennings, R. M. , McIntyre, E. , Wheeler, W. C. , Etter, R. J. , & Giribet, G. (2013). Into the deep: A phylogenetic approach to the bivalve subclass Protobranchia. Molecular Phylogenetics and Evolution, 69 (1 ), 188–204.23742885
Shen, X. , Meng, X. P. , Chu, K. H. , Zhao, N. N. , Tian, M. , Liang, M. , & Hao, J. (2014). Comparative mitogenomic analysis reveals cryptic species: A case study in Mactridae (Mollusca: Bivalvia). Comparative Biochemistry and Physiology Part D: Genomics and Proteomics, 12 , 1–9.
Song, N. , Li, J. , Li, B. , Pan, E. , & Ma, Y. (2022). Transcriptome analysis of the bivalve Placuna placenta mantle reveals potential biomineralization‐related genes. Scientific Reports, 12 (1 ), 4743.35304539
Sowerby, G. B. (1871). Monograph of the genus Ptaeuna . Conch Icon, 18 , 1–5.
Stewart, C. N. , & Via, L. E. (1993). A rapid CTAB DNA isolation technique useful for RAPD fingerprinting and other PCR applications. BioTechniques, 14 , 748–751.8512694
Talavera, G. , & Castresana, J. (2007). Improvement of phylogenies after removing divergent and ambiguously aligned blocks from protein sequence alignments. Systematic Biology, 56 , 564–577.17654362
Thomas, E. A. , Liu, R. , Amon, D. , Copley, J. T. , Glover, A. G. , Helyar, S. J. , Olu, K. , Wiklund, H. , Zhang, H. , & Sigwart, J. D. (2020). Chiridota heheva—The cosmopolitan holothurian. Marine Biodiversity, 50 , 1–13.
Turbeville, J. M. , Schulz, J. R. , & Raff, R. A. (1994). Deuterostome phylogeny and the sister group of the chordates: Evidence from molecules and morphology. Molecular Biology and Evolution, 11 (4 ), 648–655.8078403
Wang, Z. , Xu, T. , Zhang, Y. , Zhou, Y. , Liu, Z. , Chen, C. , Watanabe, H. K. , & Qiu, J. W. (2020). Molecular phylogenetic and morphological analyses of the ‘monospecific’ Hesiolyra (Annelida: Hesionidae) reveal two new species. Deep Sea Research Part I: Oceanographic Research Papers, 166 , 103401.
WWF Hong Kong . (2013). Mai Po Nature Reserve habitat management, monitoring, and research plan 2013–2018. https://apps.wwf.org.hk/file/MP_Plan_V1_V2.pdf
Yonge, M. (1977). Form and evolution in the Anomiacea (Mollusca: Bivalvia)‐Pododesmus, Anomia, Patro, Enigmonia (Anomiidae): Placunanomia, Placuna (Placunidae fam. nov.). Philosophical Transactions of the Royal Society of London. Series B: Biological Sciences, 276 (950 ), 453–523.15289
Yu, H. , & Li, Q. (2012). Complete mitochondrial DNA sequence of Crassostrea nippona: Comparative and phylogenomic studies on seven commercial Crassostrea species. Molecular Biology Reports, 39 , 999–1009.21562763
Zhang, D. , Gao, F. , Jakovlić, I. , Zou, H. , Zhang, J. , Li, W. X. , & Wang, G. T. (2020). PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources, 20 , 348–355.31599058
