
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39237647
71487
10.1038/s41598-024-71487-z
Article
Klebsiella LPS O1-antigen prevents complement-mediated killing by inhibiting C9 polymerization
Masson Frerich M.
Káradóttir Salvör
van der Lans Sjors P. A.
Doorduijn Dennis J.
de Haas Carla J. C.
Rooijakkers Suzan H. M.
Bardoel Bart W. B.W.Bardoel-2@umcutrecht.nl

https://ror.org/0575yy874 grid.7692.a 0000 0000 9012 6352 Medical Microbiology, University Medical Center Utrecht, Utrecht, The Netherlands
5 9 2024
5 9 2024
2024
14 207016 2 2024
28 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The Gram-negative bacterium Klebsiella pneumoniae is an important human pathogen. Its treatment has been complicated by the emergence of multi-drug resistant strains. The human complement system is an important part of our innate immune response that can directly kill Gram-negative bacteria by assembling membrane attack complex (MAC) pores into the bacterial outer membrane. To resist this attack, Gram-negative bacteria can modify their lipopolysaccharide (LPS). Especially the decoration of the LPS outer core with the O-antigen polysaccharide has been linked to increased bacterial survival in serum, but not studied in detail. In this study, we characterized various clinical Klebsiella pneumoniae isolates and show that expression of the LPS O1-antigen correlates with resistance to complement-mediated killing. Mechanistic data reveal that the O1-antigen does not inhibit C3b deposition and C5 conversion. In contrast, we see more efficient formation of C5a, and deposition of C6 and C9 when an O-antigen is present. Further downstream analyses revealed that the O1-antigen prevents correct insertion and polymerization of the final MAC component C9 into the bacterial membrane. Altogether, we show that the LPS O1-antigen is a key determining factor for complement resistance by K. pneumoniae and provide insights into the molecular basis of O1-mediated MAC evasion.

Subject terms

Immunology
Microbiology
European Union Horizon 2020 research program 787 H2020-EU-ITN-EJDCORVOS #860044 Netherlands Organization for Scientific Research (NWO)TTW-NACTAR #16442 http://dx.doi.org/10.13039/501100000781 European Research Council grant agreement no. 101001937, ERC-ACCENT Rooijakkers Suzan H. M. issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Klebsiella pneumoniae is a Gram-negative bacterium that has gained global attention in the past decades for its association with infection-related deaths and increasing resistance to antibiotics1. Next to resisting antibiotics, multiple Klebsiella serotypes have been reported to withstand bacterial killing by human immune proteins in serum2, but the underlying mechanistics remained understudied.

Killing of Gram-negative bacteria in human serum is mediated by the complement system, a conserved part of human immunity. It consists of soluble plasma proteins that can form a proteolytic cascade to ultimately generate so-called membrane attack complexes (MAC pores). These ring-shaped complexes insert in the outer membrane of Gram-negative bacteria and efficiently kill them3. Activation of the complement system can happen via three distinct pathways: the so-called classical pathway (CP) is engaged after binding of antibodies to surface-bound antigens, the lectin pathway (LP) that recognizes foreign sugar patterns, and finally the alternative pathway (AP) which functions to amplify the CP and LP but is also continuously active at low levels4. All three pathways converge into the cleavage of the central protein C3 and covalent binding of its activated product C3b to the target surface4. Here, unless negatively regulated, deposited C3b molecules can further amplify C3 cleavage via formation of AP C3 convertases that effectively opsonize bacteria with large amounts of C3b. Upon high enough C3b densities, a yet unknown mechanism leads to a change in substrate specificity towards C5 and then form the C5 convertase. This C5 convertase marks the beginning of the terminal part of complement activation. The C5 convertase will cleave C5 into C5b and the smaller chemoattractant C5a, which attracts neutrophils to kill Klebsiella. The unstable C5b is then immediately bound by C6, to form the more stable C5b6 complex5,6. The ensuing binding of C7 stably anchors the MAC precursor in the bacterial membrane7. Binding of C8 to the membrane-bound C5b-7 complex will lead to structural changes in C8, which will insert a transmembrane domain into the bacterial membrane8,9. Finally, up to 18 copies of C9 will bind to the C5b-8 complex in a step-wise manner and form a ring-shaped pore complex that pierces through the bacterial outer membrane, ultimately resulting in bacterial cell death 3,10,11.

Even though the MAC can efficiently kill serum-sensitive Gram-negative bacteria, many bacteria can withstand killing via the MAC12,13. Gram-positives are inherently resistant to killing via MAC pores 14 because their thick peptidoglycan layer shields the bacterial membrane. While Gram-negatives are naturally sensitive to the MAC, many clinically important Gram-negative bacteria have evolved resistance mechanisms to withstand killing in human serum. Klebsiella pneumoniae expresses a variety of polysaccharide surface structures to cover its cell envelope as a protective barrier. Namely, capsule (K-antigen), LPS (O-antigen), and exopolysaccharides (EPS). To date, 134 K-types and up to 11 distinct O-antigens have been identified15,16. The EPS is associated with the formation of bacterial biofilm, but there is still little information available regarding this virulence factor17. Previous reports correlate the presence and length of O-antigen with survival in serum for Klebsiella and other Gram-negatives18–22. Of note, serotypes O1 and O2 generally account for more than half of all infection-related K. pneumoniae isolates23,24. For Klebsiella, one polysaccharide structure that has been reported to contribute to survival in serum, is the LPS O-antigen 19,20,25,26. The O-antigen consists of repeating units of varying length of sugar moieties that are covalently bound to the LPS core27. The two most common serotypes among drug-resistant K. pneumoniae are O1 and O223,24. Both O1 and O2 serotypes have repeating units of d-Galactan I linked to the LPS core27. However, for O1-serotypes, these d-Galactan I units are covered with additional repeating units of d-Galactan II (here called O1-cap)28. Although the presence of the O-antigen polysaccharide has been described to contribute to serum survival 29, the exact mechanism by which it blocks complement-mediated killing remains elusive.

In this paper, we show that expression of LPS O1-antigen is associated with increased survival in serum. This resistance is not caused by blocking complement activation as such. Rather, C3b deposition and C5 conversion are increased, preventing correct insertion and polymerization of C9 into a functional MAC pore in the bacterial outer membrane. Incorrectly formed MAC pre-pores are then released in their soluble form from the bacterial surface. This study therefore gives insights into how Klebsiella LPS O1-antigen enables bacteria to evade MAC-mediated killing.

Results

Expression of LPS O1-antigen correlates with resistance to complement-mediated killing

To understand complement resistance in Klebsiella pneumoniae, we first screened a panel of 23 clinical isolates, expressing a variety of different capsular and O-antigen serotypes. Bacteria were sequenced, and O- and K-type were assessed using the KAPTIVE online tool30,31. For these strains, we determined the capacity to survive exposure to 10% normal human serum (NHS). For this, we used a membrane non-permeable DNA dye (Sytox) as a marker of membrane integrity. Upon membrane damage (e.g. via MAC deposition), Sytox can flow into the bacterial cell and becomes fluorescent after binding to DNA32. In addition, bacterial survival was analysed by colony enumeration. Strains were classified in three categories: resistant, intermediate-resistant and sensitive. Strains were classified as ‘resistant’ if they survived serum exposure (Fig. 1a lower panel) and had no more than a twofold above background increase in Sytox signal (Fig. 1a upper panel). ‘Intermediate-resistant’ were strains that survived serum exposure an showed a more than twofold increase in membrane damage over background (Fig. 1b). The remaining strains with a high membrane damage and decrease in CFU, were termed as ‘sensitive’ (Fig. 1c). Based on this analysis, 7 out of 23 clinical K. pneumoniae isolates were serum resistant, 12 strains were determined to be intermediate-resistant and four strains were serum-sensitive (Fig. 1d). To determine if killing was MAC-dependent, we added two well-described C5 cleavage inhibitors (OmCI and Eculizumab33,34). For all intermediate-resistant and serum-sensitive strains, membrane damage and killing were inhibited in the presence of C5 inhibitors (Figs. S1, S2), indicating that the observed killing was MAC-dependent.Fig. 1 Characterization of serum resistance of clinical K. pneumoniae isolates. Bacteria were exposed to 10% NHS, 10% HI NHS or 10% NHS with added C5 inhibitors at 37 °C for 120 min. Inner membrane damage was assessed using SytoxGreen DNA stain. After serum exposure, serial dilutions of bacteria in PBS were plated and CFUs were assessed the next day. The grey bar is indicating the detection limit of the assay. (a) Serum-resistant phenotype showing no Sytox signal and no decrease in CFU counts. (b) Intermediate-resistant phenotype with minor Sytox signal but no decrease in CFU after serum exposure. (c) Serum-sensitive phenotype with high Sytox signal and decrease in CFU. (d) Overview of Sytox value and survival of all tested strains. Fold survival was calculated by dividing CFUs at t = 0 by CFUs after exposure to 10% NHS. Strains carrying an LPS O1-antigen are marked with red dots, those carrying the O2a-antigen are marked in blue. Dotted lines represent respective cut-off values for classification of resistance. Data shown represent mean value ± SD of three independent experiments. In (d) only mean values are shown. Statistical analysis was done using a paired one-way ANOVA with Tukey’s multiple comparisons’ test. Significance shown as ns, non-significant, or ****p ≤ 0.0001.

To show the correlation for multiple strains between Sytox and CFU, we plotted bacterial survival against relative Sytox over background after 2 h of serum exposure (Fig. 1d). In general, high Sytox values correlated with sensitivity to serum-mediated killing. We analyzed the clinical isolates for possible common determinants of serum resistance. A correlation between O-antigen and serum survival has been reported by others for various Gram-negative bacteria and Klebsiella 18,25. In Klebsiella, the O1 serotype is associated with serum resistance, while the O2 serotype is much more sensitive25,35,36. In our study, all strains presenting an LPS O1-antigen grouped together as resistant or intermediate-resistant to serum exposure, while strains bearing only an O2-antigen were either fully sensitive or intermediate-resistant (Fig. 1d). All other classes of O-antigen present in our panel of strains showed not such a clear distinction. Because of the clear link between O1-antigen expression and serum resistance, we set out to further elucidate the role of the O1-antigen on MAC resistance.

Deletion of LPS O1-antigen renders serum resistant strain fully sensitive to MAC

To more definitely show the involvement of the O1 antigen in serum resistance, we deleted specific genes involved in O1 synthesis. To delete the entire O1 antigen (ΔO-Ag), we created a knockout mutant lacking the wbbO gene, an early gene in O-antigen synthesis, resulting in a total loss of O-antigen expression26,37. We validated the mutants by antibody staining with an anti-O1 monoclonal antibody using flow cytometry (Fig. S3). We then exposed the strains to NHS to check for MAC sensitivity. Deletion of wbbO (ΔO-Ag) led to an increase in inner membrane permeability in response to serum, as determined by increase in Sytox (Fig. 2a). Furthermore, we observed total loss of viability upon serum exposure, in contrast to the wild type (Fig. 2b).Fig. 2 Deletion of O1-antigen or O1-antigen cap, but not capsule, render resistant strain fully sensitive to serum killing. (a) Bacteria were exposed to 10% NHS at 37 °C for 120 min. Inner membrane damage was assessed using SytoxGreen DNA stain and measured every 90 s in a multi-well plate reader assay. (b) Bacteria were exposed to 10% NHS or 10% HI NHS 37 °C for two hours. After serum exposure, serial dilutions of bacteria in PBS were plated, the next day CFU counts were assessed and colony forming units per ml were calculated. The grey bar is indicating the detection limit of the assay. (c) Schematic overview of the O1 and O2a antigen, and the knockout mutants used in this study. (d) Bacteria were exposed to 10% NHS at 37 °C for 120 min. Inner membrane damage was assessed using SytoxGreen DNA stain and measured every 90 s in a multi-well plate reader assay. (a,b,d) Data represent mean values ± SD (thin lines and error bars, respectively) of three independent experiments. Statistical analysis was done using a paired one-way ANOVA with Tukey’s multiple comparisons’ test. Significance shown as *p ≤ 0.05 or **p ≤ 0.01.

To assess ift the complete O1-antigen is required for serum resistance, we created another deletion mutant without the O1-cap. The genes wbbY and wbbZ are necessary for the synthesis of the d-galactan II repeating unit on top of d-galactan I, specific for the O1-antigen 16,38,39. To specifically delete the O1 cap (ΔO1-cap), we created a mutant of the KpO1_1 strain lacking the wbbY gene, which is sufficient to prevent O1 cap synthesis (Fig. 2c). Deletion of the O1-cap led to an increase in inner membrane permeability (Fig. 2a) and loss of viabiolity (Fig. 2b) upon serum exposure compared to wild-type. Complementation of the knockout strains with a plasmid containing the respective genes lead to reversion of the observed susceptibility to serum-dependent killing (Fig. 2b). This data indicates that the full O1-antigen comprising both O2a-antigen and O1-antigen cap is required for serum-resistance in K. pneumoniae.

To confirm that the O1-antigen is also causing serum resistance in other LPS O1-antigen-bearing strains, we set out to create knockouts of the genes wbbO and wbbY in another K. pneumoniae isolate (KpO1_2). The previously fully serum-resistant strain KpO1_2 became sensitive to MAC-induced inner membrane damage through deletions of either wbbO or wbbY (Fig. S4). Besides the O-antigen, the capsule has been described to have a role in serum resistance40. In contrast to the O1-antigen, deletion of capsule (ΔwbaP)41,42 in strain KpO1_1 had no effect on serum survival (Fig. S5) and did not lead to an increased membrane damage upon serum exposure (Fig. 2d).

To further validate the importance of the O1-cap on MAC-resistance, we wondered if we could make an O2a-antigen bearing strain resistant by overexpressing the O1 cap. Therefore, we introduced a plasmid carrying the genes wbbY and wbbZ into the serum-susceptible strain KpO2_1, introducing the O1-cap and changing the O-antigen from O2a to O1 (Fig. S6a). Upon expression of these two additional genes, the previously serum-sensitive strain became serum-resistant, as determined by both reduction in Sytox signal (Fig. S6b) and survival in 10% NHS (Fig. S6c,d). In conclusion, we show that the O1-antigen determines serum sensitivity in two O1-expressing K. pneumoniae strains.

O1-antigen does not block early stages of complement activation

The clear effect of the O1-antigen on MAC-mediated killing raised the question at what stage the O1 antigen interferes with the complement cascade. Antibody deposition of both IgG and IgM from serum showed no significant differences between KpO1_1 and the cap knock-out (Fig. S7a,b). To check if the O1-antigen does not completely block complement activation, we first checked for C3b deposition. This activation product covalently binds to the bacterial surface and is the culminating point of all pathways of early complement activation leading to opsonization4. C3b deposition was analyzed with a fluorescently labelled C3b specific antibody using flow cytometry. Both the KpO1_1 wildtype and O1-cap mutant deposited C3b to comparable levels at 10% NHS (Fig. 3a). However, deletion of the entire O1-antigen containing the O1 cap and the O2a-antigen (ΔO-Ag) lead to a decrease in C3b deposition compared with the wild-type at lower serum concentrations. These results indicate that the effect of the O1-antigen on MAC-mediated killing is caused by a difference in the later stage of the complement cascade. We therefore set out to assess activation of further downstream complement components.Fig. 3 O-antigen does not block early complement activation. (a) Bacteria were incubated with serial dilutions of normal human serum (NHS) which was supplemented with C5-inhibitors Eculizumab (15 µg/ml) and OmCI (6 µg/ml) at 10% serum. After washing, C3b deposition was determined through flow cytometry by measuring geometric mean fluorescence of α-C3b-A405 antibody. (b) Bacteria were exposed to NHS at 37 °C for 15 min. Supernatant was collected, and C5a conversion was measured with an ELISA assay. Data shown in both panels represent mean values ± SD of three independent experiments. Statistical analysis was done using paired t-test. Significance shown as *p ≤ 0.05 or **p ≤ 0.01.

The cleavage of C5 into C5b and C5a marks the beginning of the terminal step of complement activation, the formation of a MAC pore. At high density, covalently bound C3b molecules form the basis of the C5 convertase43,44. To determine if the O-antigen poses a hindrance to complement activation at a later stage, we determined the C5a formation rates by the K. pneumoniae mutants. Serum-resistant Gram-negatives expressing an LPS O-antigen, can potently convert C5 into C5a and C5b21. We observed that the wild-type KpO1_1 strain and the O1 cap mutant showed potent C5 conversion upon exposure to serum. In contrast, the deletion of the complete O-antigen lead to a decrease in C5a conversion (Figs. 3b, S8a). This indicates that the presence of an O-antigen in K. pneumoniae can increase the conversion of C5 in human serum. However, how this increased C5 conversion influenced resistance to MAC, remained unclear. For this reason, we continued to investigate the influence of the O1-antigen on MAC formation.

Presence of O1-antigen increases the deposition of terminal complement components

Deletion of the entire O1-antigen or only the O1-cap enhances complement-mediated killing despite their difference in C5 convertase activity. This raised questions about the downstream MAC formation. After its formation, the C5 cleavage product C5b will bind C6 to form the C5b6 complex, followed by binding of proteins C7, C8, and multiple copies of C9 which will then form the MAC. To assess how the O1 antigen influences MAC assembly, we first analyzed C5b6 complex formation. For this, we spiked NHS with fluorescently labelled C6 and quantified the presence of fluorescently labelled C6 on the bacterial surface. Both wild-type and O1-cap deletion mutant deposited complement C6 to comparable levels (Fig. 4a). Upon deletion of the entire O1-antigen (ΔO-Ag), levels of surface bound C6 were decreased, compared to wild-type. Altogether, the C6 deposition correlates with C5 conversion on the KpO1_1 wild-type and O1-antigen knockouts. We therefore hypothesize that the O1-antigen influences the last steps of MAC assembly. To this reason we determined deposition of C9, the final component of the MAC. For this, bacteria were exposed to serum depleted of C9, that was repleted with fluorescently labelled C9. In line with C6 deposition, the amount of C9 detected on the bacterial surface was the highest for KpO1_1 wild-type and O1 cap mutant, and lowest for the entire O1-antigen knockout (Figs. 4b, S8b). In conclusion, the amount of detectable terminal complement components on the bacterial surface does not explain the difference in killing caused by the O1-cap.Fig. 4 Presence of O-antigen correlates with increased deposition of terminal complement components. Bacteria were exposed for 15 min at 37 °C to either: (a) NHS with serological concentrations of directly labelled C6 added. C6 deposition was determined using flow cytometry and measuring geometric mean fluorescence intensity of directly labelled C6-FITC. (b) C9 depleted serum repleted with serological concentrations of directly labelled C9-Cy5. C9 deposition was determined using flow cytometry and measuring geometric mean fluorescence intensity of directly labelled C9-Cy5. Bacteria used were transformed to express RFP. (c) Ratios shown were calculated by dividing the geometric mean fluorescence values of bacteria with directly labelled C9wt by geometric mean fluorescence values of bacteria with C9TMH1-lock. Data shown in (a), (b) and (c) represent mean values ± SD of at least three independent experiments. Statistical analysis in (a) was done using paired t-test. Statistical analysis in (b) was done using a paired one-way ANOVA with Tukey’s multiple comparisons’ test. Significance shown as * p ≤ 0.05 or ** p ≤ 0.01.

O1-antigen prevents polymerization of C9 into functional MAC

Since the amount of C9 on the bacteria did not coincide with killing, we hypothesized that the O1-antigen interferes with polymerization and insertion of C9 into a functional MAC pore in the bacterial membrane. Together with the high oberserved C5 conversion, this would lead to increased deposition of MAC precursors, explaining the earlier results. In order to assess the capacity of C9 to bind to the bacterial membrane and polymerize, we used C8 depleted serum together with the previously described recombinant C9TMH1-lock mutant. The C9TMH1-lock mutant is unable to polymerize and form functional MAC pores45. Using C9TMH1-lock should therefore result in the formation of MAC pre-pores containing only a single copy of C9. In contrast, repletion with wild-type C9 (C9wt) will result in polymerization and up to 18 copies of C9 will make up the MAC pore.

We pre-incubated bacteria with C8-depleted serum to allow for pre-pore formation on the bacteria. Next, bacteria were washed and incubated with purified C8 and either directly labelled C9 or C9TMH1-lock. For this, we used C9 and C9TMH1-lock both labelled in a site-specific manner with the same fluorophore to a similar degree of labelling. We measured fluorescence of labelled C9wt and C9TMH1-lock on bacteria (Fig. S9). Introduction of a washing step already led to decreased detectable levels of labelled C9 on KpO1_1 wild-type when compared to the setup in full serum (Figs. 4b, S9). This suggests that unstably inserted MAC precursors got released from the surface during the washing step. From these data, we calculated the ratio between the fluorescence values of C9wt and C9TMH1-lock. A high C9 : C9TMH1-lock ratio of the complete O1-antigen knockout strain indicated that polymerization of C9 is taking place and C9 is forming a MAC pore (Fig. 4c). Conversely, the wild-type strain showed almost no difference in fluorescence levels between wild-type C9 and C9TMH1-lock, and therefore a very low C9 polymerization ratio, suggesting that C9 is unable to polymerize on its surface. Based on the decreased viability upon serum exposure, we expected the O1-antigen cap mutant to also show a high C9 : C9TMH1-lock ratio. We observed an increased ratio compared to wild-type, however, lower compared to the full O1-antigen mutant. This indicates that part of the C9 can polymerize and form MAC pores in the O1-cap mutant, thereby killing the bacteria.

O1-antigen prevents insertion of C9 into the bacterial membrane

Since polymerization of C9 was inhibited on KpO1_1, we wondered if C9 binds to the C5b-8 complex and insert into the bacterial outer membrane. For this, we used the same setup as for the C9 polymerization assay, but introducing an additional trypsinization step to digest and thereby remove incorrectly assembled MAC pores6. For the KpO1_1 wild-type strain, trypsinization led to a further decrease of detectable C9 on the bacterial surface, confirming that the O1-antigen prevents anchoring of MAC on its surface (Fig. 5a). In contrast, for both the full O1-antigen knockout, and O1-antigen cap knockout trypsinization did not lead to a decrease in detectable C9 on the bacterial surface. Taken together, this suggests that the O1-antigen has an influence on bacterial survival by hindering MAC insertion.Fig. 5 O-antigen prevents correct polymerization and insertion of C9 on the bacterial surface. (a) RFP-positive bacteria where incubated for 15 min at 37 °C in 10% C8 depleted serum to allow MAC precursor formation, washed, followed by incubation for 15 min at 37 °C with serological concentrations of C8 and directly labelled C9, followed by incubation for 15 min at 37 °C with 10 µg/ml chymotrypsin. MAC shave-off was determined through measuring geometric mean fluorescence intensity of labelled C9 using flow cytometry. (b) Bacteria where incubated for 15 min at 37 °C in C6 depleted serum repleted with serological concentrations of biotinylated C6. sMAC release was determined via sandwich ELISA using α-C9neo-antibody (clone aE11), and streptavidin. Data shown in all panels represent mean values ± SD of at least three independent experiments. Statistical analysis of a) and b) was done using paired t-test. Significance shown as *p ≤ 0.05 or **p ≤ 0.01.

O1-antigen leads to increased sMAC release

Since KpO1_1 wild-type showed reduced insertion of C9 into the bacterial membrane, this left us with the question whether the presence of the O1-antigen leads to more release of MAC pre-pores from the bacterial surface. As has been described for E. coli, presence of an O-antigen can interfere with attachment of MAC precursors on the bacterial outer membrane of Gram-negatives, leading to the release of pre-pores also known as soluble MAC (sMAC) into the supernatant 21,46.

We therefore determined the release of soluble MAC from the bacterial surface using a sandwich ELISA. We found an increase of sMAC formation in the supernatant of the O1 wild-type and O1-cap knockout (Fig. 5b). In contrast, in absence of entire O1-antigen, formation of sMAC was only slightly increased compared to spontaneous formation in serum. To summarize, our data suggest that Klebsiella O1-antigen prevents insertion and polymerization of C9 into a functional MAC pore, which is released as sMAC from the bacterial surface.

Discussion

Insertion and correct polymerization of the membrane attack complex (MAC) into the outer membrane is paramount for killing of Gram-negatives such as Klebsiella pneumoniae by the complement system6. Although the link between expression of LPS O-antigen and resistance to MAC-mediated killing has been established for Klebsiella25,29,47, we here show that specifically the LPS O1-antigen of Klebsiella prevents polymerization of C9 into functional MAC, thereby preventing killing (Fig. 6).Fig. 6 Schematic representation of MAC formation on LPS O1-antigen. If no O-antigen is present, C5 convertase is active and the MAC can form in the bacterial membrane and perforate it. When only O2a-antigen is present, C5a conversion is enhanced. The increased C5 conversion results in enhanced deposition of MAC precursors. Part of the MAC precursors are released as C5b91-3 (sMAC) from the bacterial surface. However, some pores can still correctly form in the outer membrane and induce killing. In presence of O1-antigen, C9 polymerization is inhibited, preventing MAC formation and killing.

Our findings confirm previous data showing that Klebsiella pneumoniae expressing an O1-antigen are more resistant to MAC-mediated killing than those expressing an O2a-antigen. By deletion of genes involved in O1-antigen synthesis, we could pinpoint MAC resistance to not only the presence of the O1-antigen, but we could also show that specifically the O1-cap (d-galactan II repeating units) is required to create a MAC-resistant phenotype. Next to the O-antigen, the capsule can contribute to bacterial survival in serum40,48. However, for strain KpO1_1, we were not able to measure an effect of the capsule on bacterial survival in serum. We only analyzed the capsule mutant of KpO1_1, and therefore the finding that the capsule does not play a role in complement resistance cannot be generalized to other strains. Since the O1 antigen showed a major phenotype in membrane damage and survival assays, we focused on the role of the O1-antigen.

Our results confirm the previously reported discrepancy in serum-resistance between the O1 and O2a serotypes, namely that O1-antigen strains are more resistant to MAC-mediated killing than O2-antigen strains20,25,36. While the O1-antigen and its structure have been known for more than thirty years49, the two genes responsible for the synthesis of d-galactan II, wbbY and wbbZ, respectively, have been only recently characterized38,39. While wbbY has been shown to be an essential glycosyltransferase for the synthesis of d-galactan II, the role of wbbZ, a pyruvyltransferase, remains understudied. Additionally, these two genes are located between transposable elements and might have gotten acquired via lateral gene transfer35.

Despite their susceptibility to serum, strains expressing an O2-antigen are commonly found among Klebsiella serotypes causing infections in the blood stream24. This could be due to the fact that the O2-antigen seems to be less likely recognized by antibodies due to shielding by capsule and therefore more resistant against recognition by antibodies and opsonophagocytic uptake24,35.

Our mechanistic studies show that expression of O1-antigen does not block early steps of complement activation. Instead, expression of the O-antigen leads to increased deposition of C3b and C5 conversion and therefore high levels of bacterium-bound C5b6 and even C5b-9 complexes. However, deposited C5b-9 complexes are not functional on O1-antigen strains, because the complexes are unable to correctly insert into the bacterial outer membrane and polymerize into a functional pore. Our finding that deposition of C3b was not impaired by the presence of an O-antigen, is in disagreement with previous reports, where serum-resistant K. pneumoniae LPS smooth strains (O1-strains) deposited less C3 than their serum-sensitive LPS rough (O-antigen negative strains)47. We can, however, confirm earlier findings that the O1-antigen does not lead to evasion of complement activation19. Surprisingly, in presence of O1-antigen, we observed higher levels of C3b deposition, which are also reflected in the higher amount of C5 converted to C5a and C5b. Presence of the shorter O2a-antigen (O1-cap deletion) still leads to high C5 conversion, while deletion of the entire O1-antigen leads to drastically lower C5 conversion rates. This is partly in line with previous findings, that serum-resistant Gram-negatives which express an LPS O-antigen can potently convert C521. However, it seems the shorter O2-antigen is enough to trigger the increased C5 conversion, even though it does not lead to MAC-resistance. The strong release of pro-inflammatory C5a in response to LPS constitutes a great risk factor for an anaphylactic shock, as has been shown in mice50.

The potent C5 conversion further correlated with deposition of C9, the terminal protein of the MAC. Surprisingly, the amount of detectable C9 on the bacterial surface did not correlate with killing. This is seemingly in line with previous findings of potent MAC deposition on serum-resistant Gram-negative bacteria such as Acinetobacter, but also on Gram-positives like Streptococcus 51,52. However, it should be noted that the frequently used detection antibody for MAC, aE11, is unable to discriminate the C5b-9 pre-pore from a fully polymerized MAC pore, as it binds to two adjacent C9 molecules53. Therefore, researching if C9 is polymerizing turns out essential for mechanistic studies. By using directly labelled C9 and the recently described C9 variant that locks C9 in its monomeric form, we could show that expression of the O1-antigen prevents polymerization of C9 into a bactericidal pore. We can link this mechanism not only to MAC-resistant strains, but to the presence of the O1-antigen specifically. In presence of the full O1-antigen, detectable levels of C9 are highest, while C9 polymerization and insertion into the bacterial membrane are impaired. As a consequence, sMAC is released. While the shorter O2a-antigen might not be sufficient to prevent MAC-mediated killing, it nevertheless decreases the efficiency of how the MAC can form on the bacterial surface, whereas the O1-antigen prevents MAC-formation altogether. The underlying mechanism might be explained by the excessive consumption of complement components by C5 convertases resulting in MAC pre-pores. We speculate that the LPS O1-antigen, by activating more C5 convertases, changes the local ratio of C5 to C9 to conditions where only a suboptimal amount of C9 molecules are available per C5b6 pre-pore complex21. Unable to correctly anchor, insert into the membrane and to further polymerize, these MAC pre-pores would get released into the bacterial supernatant as soluble MAC. Doorduijn et al. have reported a similar finding in E. coli, where presence of an O-antigen prevented polymerization of C9 and lead to increased C5 conversion and sMAC generation 21,22.

In the case of a shorter O2-antigen, convertase activity will still be increased and lead to partial release of MAC precursors as sMAC. However, the O2a-antigen gives less protection against membrane insertion of the MAC, and some pores form correctly and penetrate the outer membrane, thereby killing the bacteria. These findings highlight the importance of the O1-antigen for MAC-resistance in K. pneumoniae. It might also serve as a possible explanation why O1-bearing K. pneumoniae are the most common serotype of clinical relevance35. Potentially, these data suggest a multi-faceted role of the O1-antigen during an infection. Not only does the O1-antigen render K. pneumoniae non-susceptible to MAC-killing, but the increased release of anaphylatoxin C5a also pose a high inflammatory burden during an ongoing infection. The release of soluble MAC components in both cases might serve as a biomarker of ongoing infections with K. pneumoniae.

In light of the rise of multidrug resistant hypervirulent Klebsiella strains54, understanding how K. pneumoniae resists exposure to the complement system and killing via the MAC is of increasing importance. This study gives molecular insights into how expression of the LPS O-antigen helps K. pneumoniae withstand direct killing through the MAC.

Methods

Serum, reagents and bacterial strains

Normal human serum (NHS) was derived by pooling serum of ~ 20 healthy donors and prepared as described before6. Heat-inactivated serum was obtained by incubating NHS at 56 °C for 30 min. OmCI was produced and purified as previously described33. Eculizumab was kindly provided by Frank Beurskens (Genmab, Utrecht, The Netherlands). RPMI (ThermoFisher) supplemented with 0.05% human serum albumin (HSA, Sanquin), further referred to as RPMI buffer, was used in all experiments, unless otherwise stated. Sera depleted of complement factors C6, C8 and C9 were obtained from Complement Technology. Klebsiella pneumoniae clinical isolates were collected during routine diagnostics in the medical microbiology department in the University Medical Centre Utrecht, The Netherlands, kindly provided by Jelle Scharringa, Janetta Top and Ad Fluit (see Table 1). Determination of capsule and O-antigen type of clinical Klebsiella pneumoniae isolates was performed using the Kaptive online tool (v. 2.0.4)15,30,31. C9 deposition and trypsin shaving experiments were performed using clinical isolates and knockout mutants transformed with plasmid pTU2-A-RFP (gift from Paul Freemont, Addgene plasmid #72954)55. Table 1 Strains used in this study.

Strain	Description	K-type	O-type	Origin	
O1_1 (UM-05-A#1)		KL114	O1	Verschuren et al., unpublished	
O1_1 ΔwbbO	O-antigen KO	KL114	–	van der Lans et al., unpublished	
O1_1 ΔwbaP	Capsule KO	–	O1	van der Lans et al., unpublished	
O1_1 ΔwbbY	O1-cap KO	KL114	O2a	van der Lans et al., unpublished	
O1_1 ΔwbbO::pTU2-wbbO	O-antigen KO, complemented with O-antigen	KL114	O1	This study	
O1_1 ΔwbbY::pTU2-wbbYZ	O1-cap KO, complemented	KL114	O1	This study	
O1_2 (UM-2A#3.1)		KL20	O1	Verschuren et al., unpublished	
O1_2 ΔwbbO	O-antigen KO	KL20	–	This study	
O1_2 ΔwbbY	O1-cap KO	KL20	O2a	This study	
O1_2 ΔwbbY::pTU2-wbbYZ	O1-cap KO, complemented	KL20	O1	This study	
O1_3 (UM13B#1)		KL19	O1	Verschuren et al., unpublished	
O1_4 (MB-17667)		KL30-D1	O1	Van den Bunt et al. 62	
O1_5 (MA-28030)		KL10	O1	Van den Bunt et al. 62	
O2_1 (UM-05-B-#1)		KL114	O2a	Verschuren et al., unpublished	
O2_1 ΔwbbO	O-antigen KO	KL114	–	This study	
O2_2 (MC-04166)		KL136	O2afg	Van den Bunt et al. 62	
O2_3		KL102	O2afg	This study	
O2_4 (JS367*)		KL9	O2afg	van der Lans et al., unpublished	
O2_5		KL107	O2afg	This study	
O3_1 (MB-16059)		KL2	O3b	Van den Bunt et al. 62	
O3_2 (MA-25932)		KL60	O3b	Van den Bunt et al. 62	
O3_3 (MA-31364)		KL125	O3b	Van den Bunt et al. 62	
O3_4 (MC-40993)		No confidence match	O3b	Van den Bunt et al. 62	
O3_5 (MA-47281)		No confidence match	O3b	Van den Bunt et al. 62	
O4_1 (MA-02666)		KL151	O4	Van den Bunt et al. 62	
O4_2 (MA-49950)		KL17	O4	Van den Bunt et al. 62	
O4_3		KL36	O4	This study	
O5_1 (MC-39002)		No confidence match	O5	Van den Bunt et al. 62	
O5_2 (MA-44575)		KL10	O5	Van den Bunt et al. 62	
O104_1 (MA-18898)		KL14	OL104	Van den Bunt et al. 62	
Ox_1 (MA-18684)		No confidence match	no confidence match	Van den Bunt et al. 62	
Ox_2 (MA-48971)		No confidence match	no confidence match	Van den Bunt et al. 62	

Site-specific labelling of MAC components

To produce fluorescently labelled C9, C9-3xGGGGS-LPETG-6xHis was recombinantly expressed in Expi293F cells and site-specifically labelled with Cy5 via C-terminal sortagging as done previously56. C9TMH1-lock was produced and labelled in the same manner, as described previously21. Biotinylated C6 and FITC-labelled C6 were produced in a similar manner, by expressing and isolating C6-LPETGG-6xHis, as previously described7 and subsequent C-terminal sortagging with GGGK-biotin (kindly provided by Louris Feitsma, Department of Crystal and Structural Chemistry, Bijvoet Institute) or GGGK-FITC. C6 and C9 were labelled with fluorescent probes as described previously. 50 μM of protein with C-terminal LPETGG-His tag was incubated with 25 μM His-tagged sortase-A7+ (recombinantly expressed in E. coli) and 1 mM GGG-substrate in Tris/NaCl buffer (50 mM Tris/300 mM NaCl at pH 7.8) for two hours at 4 °C. GGGK-FITC (Isogen Life Science) was used for C6-LPETGG-His and GGGK-azide (Genscript) for C9-LPETGG-His. Sortagged proteins were purified on a HisTrap FF column (GE Healthcare), which captures protein that was not sortagged and still contains a His-tag. In addition, FITC-labelled C6 was purified by SEC on a Superdex 200 Increase column on the Akta Explorer with PBS 22. GGG-azide labelled proteins were concentrated to 25 μM on a 30 kDa Amicon Tube (Merck Millipore) in Tris/NaCl buffer and next labelled with 100 μM DBCO-Cy5 (Sigma Aldrich) via copper-free click chemistry for 3h at 4 °C. Finally, Cy5-labelled proteins were also purified by SEC on a Superdex 200 Increase column with PBS. Labelling of the proteins was monitored during SEC by measuring absorbance at 280 nm (protein), 488 nm (FITC) and 633 nm (Cy5) nm and finally verified by SDS-PAGE by measuring in-gel fluorescence with LAS4000 Imagequant (GE Healthcare)21.

Bacterial culture

Bacteria used in this study are shown in Table 1. Bacteria were freshly plated from glycerol stocks on blood agar plates. Single colonies were picked and cultured overnight at 37 °C in liquid LB medium under shaking conditions. The following day, bacteria were diluted 100-fold in fresh LB medium and incubated at 37 °C shaking until an OD600 of ~ 0.5 was reached. Bacteria were then washed with RPMI buffer and resuspended to a final OD600 of 1 for experiments.

SYTOX™ assay

Bacteria (final OD600 = 0.05; ~ 5 × 107 bacteria/ml) were incubated with 1 µM SYTOX™ Green nucleic acid stain (Invitrogen) and serum/heat-inactivated serum/serum with C5 inhibitors for 2 h at 37 °C in a Clariostar plate reader (BMG labtech). C5 inhibition was achieved by adding 20 µg/ml of Eculizumab and 20 µg/ml OmCI. Sytox Green fluorescence was measured using an excitation wavelength of 484–15 nm and an emission wavelength of 527–20 every 90 s.

Bactericidal assays (CFU)

After the Sytox assay, bacterial cultures were pre-diluted 1000-fold in PBS. tenfold serial dilutions of samples were prepared in PBS and spotted in duplicate on LB agar plates, followed by overnight incubation at 37 °C. Colony forming units count was determined the next day and the correspondent concentration of CFU/ml was calculated. Survival was calculated by dividing the sample’s CFU/ml by the CFU/ml at t = 0.

RFP-labelling

Bacterial subculture (OD600 ~ 0.5) was spun down at 4 °C and washed three times with ice-cold 10% (v/v) Glycerol. Approximately 100 ng of pTU2-A-RFP plasmid was added to 50 µl competent bacteria, followed by electroporation on a Bio-Rad Gene Pulser Xcell (1.8 kV, 25 µF, 200 Ω). After electroporation, 250 µl of super optimal conditions (SOC, Invitrogen) medium was added, and bacteria were incubated at 37 °C for 90 min, before plating on selective LB agar plates with 20 µg/ml chloramphenicol and overnight incubation at 37 °C. Plasmid pTU2-A-RFP was a gift from Paul Freemont (Addgene plasmid #72954)55.

Single gene deletions and complementations

Competent bacteria were transformed with 100 ng temperature-sensitive pREDKI helper plasmid57 as described above, but cultured at 30 °C and in presence of 50 µg/ml kanamycin as selective marker. Plasmid-bearing bacteria were cultured overnight in LB with kanamycin at 30 °C while shaking. The subculture was incubated with the addition of L-Arabinose (15 mM final concentration) to induce the λ-red recombination system, and then made competent again using the aforementioned method. Competent bacteria were then transformed by electroporation with 100 ng of linear DNA fragments consisting of a gentamycin resistance cassette flanked by 50 bp overhang sequences homolog to the flanking sequences of the gene to be knocked out. Primer sequences for the primers used for the generation of linear DNA fragments can be found in Table 2. Bacteria were incubated at 30 °C for 90 min in SOC, before plating on selective LB agar plates with 50 µg/ml gentamycin and incubation overnight at 30 °C. Successful knock-out colonies were confirmed by PCR, and confirmed clones were cultured overnight at 37 °C in LB + 50 µg/ml gentamycin to lose the helper plasmid. For complementations, genes were cloned onto plasmid pTU2 under regulation of the corresponding promotor of strain KpO1_1. Plasmids were then transformed into bacteria made competent using the method mentioned above. Table 2 Primers used in this study.

Primer name	Sequence 5ʹ–3ʹ	
WbbO_For	CACATGGCATAAAAGGTATTAGTGGTAAGTATCATTAAGTGGGCATAGCACTAGTGAGCTCATGCATGATCG	
WbbO_Rev	GGTAAAGAAACAATATCTGGCAATTAATAAAAAAGGATAACCGTTTGATCGACAACGAATTGGGGATCTTGAAGTACC	
WbbY_For	CACTACTTCAATTCACTAATATCATAGAAAAGTCTAGGTTACAAAGGAAGGGTTACACTAGTGAGCTCATGCATGATCG	
WbbYZ_Rev	TAGCTGAAAGTTAATATTATTTTTGCGGAGCCCTTTCGGGCCCCGAATATTACTCGAATTGGGGATCTTGAAGTACC	
WbaP_For	ATGACGCATTTTACTAAAAATGTATTGTGCAGTGTATTTTTAGCTACAGCAGCTAGTGAGCTCATGCATGATCG	
WbaP_Rev	TTAGTATGCGCCATCTCTTTTTAAAACGACACCAACCGTTTTAAACAAAATAGCGAATTGGGGATCTTGAAGTACC	
WbaP_Check_For	ACGATTCGAACAAAGTGGTGT	
WbaP_Check_Rev	TGCCCATGGGAATATCCTGT	
KO_cass_DN_For	TAAATTGTCACAACGCCGCG	
KO_cass_UP_Rev	CGTTCGGTCAAGGTTCTGGA	

Antibody deposition assays

For deposition of natural IgG and IgM from serum pool, bacteria (~ OD600 0.05 final conc.) were incubated with NHS for 20 min at 4 °C shaking. Bacteria were then washed twice with RPMI buffer, followed by incubation with directly labelled goat-anti-human-AF405 (Invitrogen, A48275) or goat-anti-human-IgM-FITC (Southern Biotech, 2020-02) for 20 min at 4 °C shaking. Before FACS analysis, samples were diluted 1:10 in ice-cold 1% PFA in RPMI buffer. The S. aureus Newman strain used as positive control, is a spa (staphyolococcal protein A) and sbi (staphylococcal immunoglobulin-binding protein) double knockout mutant to not interfere with deposition of immunoglobulins on the surface (obtained from58).

For deposition of O-antigen specific monoclonal antibodies, bacteria (~ OD600 0.05 final conc.) were first incubated with human monoclonal antibodies against Klebsiella LPS O1-antigen (sequence patented in59, produced in-house as described in60) for 30 min at 4 °C shaking. Bacteria were then washed with RPMI buffer, followed by incubation with directly labelled goat-anti-human-IgG-AF488 (2040-3, Southern Biotech) for 30 min at 4 °C shaking. Before FACS analysis, bacterial samples were diluted tenfold in RPMI buffer with 1% PFA.

C3b deposition

Bacterial culture (~ OD600 0.05, appox. 5 × 107 bacteria/ml final conc.) was incubated with serial dilutions of normal human serum (NHS) which was supplemented with C5-inhibitors Eculizumab (15 µg/ml) and OmCI (6 µg/ml) at 10% serum in a microtiter plate for 30 min at 37 °C shaking. Bacteria were then washed twice in RPMI-HSA, and resuspended with directly labelled anti-C3b antibody (bH661, produced in-house6, 3 µg/ml final concentration in RPMI buffer). Bacteria were then washed once in RPMI-HSA and diluted to 2.5 × 106 bacteria/ml in ice-cold RPMI buffer + 1% PFA before FACS analysis.

C6 deposition

Bacterial culture was incubated with serial dilutions of NHS together with directly labelled complement C6-FITC added in serological concentrations. Normal concentrations of MAC components in 100% serum are: 500 nM C6, 367 nM C8, and 845 nM C9. Incubation in a microtiter plate was 15 min at 37 °C while shaking. Incubation was stopped by diluting the sample 1:1 in ice-cold RPMI buffer + 1% PFA before FACS analysis.

C9 deposition

Bacterial culture was incubated with C9 depleted human serum complemented with serological concentrations of either directly labelled C9-Cy5 or C9TMH1-lock-Cy5 for 15 min at 37 °C shaking. Incubation was stopped by diluting the sample 1:10 in ice-cold RPMI buffer + 1% PFA before FACS analysis. C9 polymerization ratio was calculated by dividing the gMFI of C9-Cy5 by the gMFI of C9TMH1-lock-Cy5.

C9 polymerization and trypsin shaving

Bacteria were incubated with 10% C8 depleted serum for 15 min at 37 °C shaking, and then resuspended in RPMI buffer. Bacteria were then incubated with 10% serum equivalent serological concentrations of purified human C8 (Complement Technology), and either directly labelled C9-Cy5 or C9TMH1-lock-Cy5 for 15 min at 37 °C while shaking. After incubation with final complement components, bacteria were further incubated with either addition of 10 µg/ml chymotrypsin or RPMI buffer for 15 min at 37 °C while shaking. The reaction was stopped by diluting the samples 1:10 in ice-cold 1% PFA in RPMI buffer before FACS analysis.

Complement product activation ELISA’s

Bacteria (final conc. ~ OD600 0.05) were incubated with serum titrations for 15 min at 37 °C shaking. For C5a, this was NHS, whereas for soluble MAC (sMAC) this was C6 depleted serum repleted with serological concentrations of biotinylated C6. Supernatants were then stored at − 20 °C until use. Serum supernatants were diluted 1:1 (v/v) in PBS-T supplemented with 1% BSA for sample analysis.

Nunc Maxisorp ELISA plates were coated with 1 µg/ml capture antibody in PBS at 4 °C overnight. For C5a, a commercially available kit was used, using C5a capture and detection antibodies specific for C5a and not native C5 (R&D, DY2037). For sMAC, capture was performed using mouse-α-C9neo-antibody (clone aE11, kindly provided by T. Mollnes and P. Garred). Blocking was performed by incubating with 4% BSA in PBS-T for one hour at 37 °C. Samples were then loaded and incubated for 1 h at room temperature. Plates were then incubated with detection antibodies for 1 h at RT. For sMAC, this was executed using 1:5000 HRP-conjugated Streptavidin (Southern Biotech). Washing between steps was performed three times with PBS-Tween 0.05% (PBS-T). Plates were developed for 2 min with fresh tetramethylbenzidine (TMB) substrate solution. Reaction was stopped using 2N sulfuric acid, and OD450 was then measured.

Western blotting

Bacteria (~ OD600 1 or 0.1, respectively) were incubated (1:1, v/v) with NHS at indicated concentrations for 15 min at 37 °C shaking. After washing, bacterial pellets were resuspended in PBS and diluted 1:1 in reducing SDS sample buffer supplemented with 50 µg/ml dithiotreitol (DTT) and incubated at 95 °C for 5 min. Samples were run on a 4–12% Bis–Tris gradient gel (Invitrogen) for 45 min at 200V in MES buffer. As controls, 10 µg of purified C5 or C9 were loaded. Proteins were transferred with the Trans-Blot Turbo transfer system (Bio-Rad) to 0.2 µM PVDF membranes (Bio-Rad). Initial blocking was performed using 4% skim milk (ELK, Campina) in PBS-T (PBS with 0.05% Tween) for 45 min at 37 °C. Primary staining was performed using a 1:500 dilution of either goat-anti-human-C5 (Complement Technology) or goat-anti-human-C9 (Complement Technology) in PBS-T supplemented with 1% ELK for 45 min at 37 °C. Secondary staining was performed using a 1:5000 dilution of HRP-conjugated pooled donkey antisera against goat IgG (H + L) (Southern Biotech) in PBS-T supplemented with 1% ELK for 45 min at 37 °C. In between all steps and after final staining washing was performed thrice using PBS-T. Finally membranes were developed with Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific) for 1 min at room temperature and imaged on the LAS4000 Imagequant (GE Healthcare).

FACS and data analysis

For deposition of C3b, C6, and binding of O-antigen specific monoclonal antibodies, bacterial samples were analyzed in a MACSquant VYB flow cytometer (Miltenyi) for forward scatter (FSC), side scatter (SSC), RFP, and AF488. For deposition of C9, and MAC shave-off, bacterial samples were analyzed on a BD FACSVerse flow cytometer for FSC, SSC, and Cy5. Flow cytometry data was analyzed in FlowJo version 10. Bacteria were gated on FSC and SSC.

Supplementary Information

Supplementary Figures.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-71487-z.

Acknowledgements

The authors would like to thank Jelle Scharringa, Janetta Top and Ad Fluit for providing the K. pneumoniae used in this study, and Jos van Strijp for critically reading the manuscript. Image Figs. 2c and 6 was created by Frerich Masson using Adobe Illustrator v28.2.

Author contributions

F.M.M., S.H.M.R., and B.W.B. conceived the project. F.M.M., S.K. and D.J.D. performed experiments. D.J.D. and C.J.C.d.H. cloned, expressed, and generated antibodies and proteins. D.J.D. and C.J.C.d.H. fluorescently labelled proteins. F.M.M., S.K., and C.J.C.d.H. generated K. pneumoniae mutants. S.P.A.v.d.L. performed sequence analysis. F.M.M., S.K., B.W.B. and D.J.D. performed data analysis. F.M.M., D.J.D., S.H.M.R., and B.W.B. wrote the manuscript. All authors approved the final version of the manuscript.

Funding

This work was supported by the European Union’s Horizon 2020 research program 787 H2020-EU-ITN-EJD (CORVOS #860044), the Netherlands Organization for Scientific Research (NWO) through a TTW-NACTAR Grant #16442 and the European Research Council (ERC) under the European Union’s Horizon 2020 research and innovation program (grant agreement no. 101001937, ERC-ACCENT). The funders had no role in study design, data collection and analysis, or preparation of the manuscript.

Data availability

The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request. Unless otherwise stated, data collected as three independent biological replicates and analyzed using GraphPad Prism Version 10.1.1 (270).

Competing interests

The authors declare no competing interests.

Ethics statement

Human blood was isolated after informed consent was obtained from all subjects in accordance with the Declaration of Helsinki. Approval was obtained from the medical ethics committee of the UMC Utrecht, The Netherlands.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Tacconelli E Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis Lancet Infect. Dis. 2018 18 318 327 10.1016/S1473-3099(17)30753-3 29276051
Tacconelli, E. et al. Discovery, research, and development of new antibiotics: The WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect. Dis. 18, 318–327 (2018).29276051 10.1016/S1473-3099(17)30753-3
2. Opstrup KV Bennike TB Christiansen G Birkelund S Complement killing of clinical Klebsiella pneumoniae isolates is serum concentration dependent Microbes Infect. 2023 25 105074 10.1016/j.micinf.2022.105074 36336240
Opstrup, K. V., Bennike, T. B., Christiansen, G. & Birkelund, S. Complement killing of clinical Klebsiella pneumoniae isolates is serum concentration dependent. Microbes Infect. 25, 105074 (2023).36336240 10.1016/j.micinf.2022.105074
3. Doorduijn DJ Rooijakkers SHM Heesterbeek DAC How the membrane attack complex damages the bacterial cell envelope and kills gram-negative bacteria Bioessays 2019 41 e1900074 10.1002/bies.201900074 31452228
Doorduijn, D. J., Rooijakkers, S. H. M. & Heesterbeek, D. A. C. How the membrane attack complex damages the bacterial cell envelope and kills gram-negative bacteria. Bioessays 41, e1900074 (2019).31452228 10.1002/bies.201900074
4. Merle NS Church SE Fremeaux-Bacchi V Roumenina LT Complement system part I—molecular mechanisms of activation and regulation Front. Immunol. 2015 6 262 10.3389/fimmu.2015.00262 26082779
Merle, N. S., Church, S. E., Fremeaux-Bacchi, V. & Roumenina, L. T. Complement system part I—molecular mechanisms of activation and regulation. Front. Immunol. 6, 262 (2015).26082779 10.3389/fimmu.2015.00262
5. DiScipio RG Linton SM Rushmere NK Function of the factor I modules (FIMS) of human complement component C6 J. Biol. Chem. 1999 274 31811 31818 10.1074/jbc.274.45.31811 10542204
DiScipio, R. G., Linton, S. M. & Rushmere, N. K. Function of the factor I modules (FIMS) of human complement component C6. J. Biol. Chem. 274, 31811–31818 (1999).10542204 10.1074/jbc.274.45.31811
6. Heesterbeek DA Bacterial killing by complement requires membrane attack complex formation via surface-bound C5 convertases EMBO J. 2019 10.15252/embj.201899852 30643019
Heesterbeek, D. A. et al. Bacterial killing by complement requires membrane attack complex formation via surface-bound C5 convertases. EMBO J.10.15252/embj.201899852 (2019).30643019 10.15252/embj.201899852
7. Doorduijn DJ Bacterial killing by complement requires direct anchoring of membrane attack complex precursor C5b–7 PLoS Pathog. 2020 16 e1008606 10.1371/journal.ppat.1008606 32569291
Doorduijn, D. J. et al. Bacterial killing by complement requires direct anchoring of membrane attack complex precursor C5b–7. PLoS Pathog. 16, e1008606 (2020).32569291 10.1371/journal.ppat.1008606
8. Brannen C Sodetz J Incorporation of human complement C8 into the membrane attack complex is mediated by a binding site located within the C8β MACPF domain Mol. Immunol. 2007 44 960 965 10.1016/j.molimm.2006.03.012 16624411
Brannen, C. & Sodetz, J. Incorporation of human complement C8 into the membrane attack complex is mediated by a binding site located within the C8β MACPF domain. Mol. Immunol. 44, 960–965 (2007).16624411 10.1016/j.molimm.2006.03.012
9. Sharp TH Faas FGA Koster AJ Gros P Imaging complement by phase-plate cryo-electron tomography from initiation to pore formation J. Struct. Biol. 2017 197 155 162 10.1016/j.jsb.2016.09.008 27663685
Sharp, T. H., Faas, F. G. A., Koster, A. J. & Gros, P. Imaging complement by phase-plate cryo-electron tomography from initiation to pore formation. J. Struct. Biol. 197, 155–162 (2017).27663685 10.1016/j.jsb.2016.09.008
10. Serna M Giles JL Morgan BP Bubeck D Structural basis of complement membrane attack complex formation Nat. Commun. 2016 7 10587 10.1038/ncomms10587 26841837
Serna, M., Giles, J. L., Morgan, B. P. & Bubeck, D. Structural basis of complement membrane attack complex formation. Nat. Commun. 7, 10587 (2016).26841837 10.1038/ncomms10587
11. Menny A CryoEM reveals how the complement membrane attack complex ruptures lipid bilayers Nat. Commun. 2018 9 5316 10.1038/s41467-018-07653-5 30552328
Menny, A. et al. CryoEM reveals how the complement membrane attack complex ruptures lipid bilayers. Nat. Commun. 9, 5316 (2018).30552328 10.1038/s41467-018-07653-5
12. Joiner KA Complement evasion by bacteria and parasites Annu. Rev. Microbiol. 1988 42 201 230 10.1146/annurev.mi.42.100188.001221 3059994
Joiner, K. A. Complement evasion by bacteria and parasites. Annu. Rev. Microbiol. 42, 201–230 (1988).3059994 10.1146/annurev.mi.42.100188.001221
13. Taylor PW Bactericidal and bacteriolytic activity of serum against gram-negative bacteria Microbiol. Rev. 1983 47 46 83 10.1128/mr.47.1.46-83.1983 6343827
Taylor, P. W. Bactericidal and bacteriolytic activity of serum against gram-negative bacteria. Microbiol. Rev. 47, 46–83 (1983).6343827 10.1128/mr.47.1.46-83.1983
14. Joiner KA Warren KA Hammer C Frank MM Bactericidal but not nonbactericidal C5b–9 is associated with distinctive outer membrane proteins in Neisseria gonorrhoeae J. Immunol. 1985 134 1920 1925 10.4049/jimmunol.134.3.1920 3918112
Joiner, K. A., Warren, K. A., Hammer, C. & Frank, M. M. Bactericidal but not nonbactericidal C5b–9 is associated with distinctive outer membrane proteins in Neisseria gonorrhoeae. J. Immunol. 134, 1920–1925 (1985).3918112 10.4049/jimmunol.134.3.1920
15. Wyres KL Identification of Klebsiella capsule synthesis loci from whole genome data Microb. Genom. 2016 10.1099/mgen.0.000102 28348868
Wyres, K. L. et al. Identification of Klebsiella capsule synthesis loci from whole genome data. Microb. Genom.10.1099/mgen.0.000102 (2016).28348868 10.1099/mgen.0.000102
16. Clarke BR Molecular basis for the structural diversity in serogroup O2-antigen polysaccharides in Klebsiella pneumoniae J. Biol. Chem. 2018 293 4666 4679 10.1074/jbc.RA117.000646 29602878
Clarke, B. R. et al. Molecular basis for the structural diversity in serogroup O2-antigen polysaccharides in Klebsiella pneumoniae. J. Biol. Chem. 293, 4666–4679 (2018).29602878 10.1074/jbc.RA117.000646
17. Patro LPP Rathinavelan T Targeting the sugary armor of Klebsiella species Front. Cell Infect. Microbiol. 2019 10.3389/fcimb.2019.00367 31781512
Patro, L. P. P. & Rathinavelan, T. Targeting the sugary armor of Klebsiella species. Front. Cell Infect. Microbiol.10.3389/fcimb.2019.00367 (2019).31781512 10.3389/fcimb.2019.00367
18. Grossman N Lipopolysaccharide size and distribution determine serum resistance in Salmonella montevideo J. Bacteriol. 1987 169 856 863 10.1128/jb.169.2.856-863.1987 2433267
Grossman, N. et al. Lipopolysaccharide size and distribution determine serum resistance in Salmonella montevideo. J. Bacteriol. 169, 856–863 (1987).2433267 10.1128/jb.169.2.856-863.1987
19. Tomás JM Benedí VJ Ciurana B Jofre J Role of capsule and O antigen in resistance of Klebsiella pneumoniae to serum bactericidal activity Infect. Immun. 1986 54 85 89 10.1128/iai.54.1.85-89.1986 3531020
Tomás, J. M., Benedí, V. J., Ciurana, B. & Jofre, J. Role of capsule and O antigen in resistance of Klebsiella pneumoniae to serum bactericidal activity. Infect. Immun. 54, 85–89 (1986).3531020 10.1128/iai.54.1.85-89.1986
20. Williams P Lambert PA Brown MR Jones RJ The role of the O and K antigens in determining the resistance of Klebsiella aerogenes to serum killing and phagocytosis J. Gen. Microbiol. 1983 129 2181 2191 6195306
Williams, P., Lambert, P. A., Brown, M. R. & Jones, R. J. The role of the O and K antigens in determining the resistance of Klebsiella aerogenes to serum killing and phagocytosis. J. Gen. Microbiol. 129, 2181–2191 (1983).6195306
21. Doorduijn DJ Soluble MAC is primarily released from MAC-resistant bacteria that potently convert complement component C5 Elife 2022 10.7554/eLife.77503 35947526
Doorduijn, D. J. et al. Soluble MAC is primarily released from MAC-resistant bacteria that potently convert complement component C5. Elife10.7554/eLife.77503 (2022).35947526 10.7554/eLife.77503
22. Doorduijn DJ Polymerization of C9 enhances bacterial cell envelope damage and killing by membrane attack complex pores PLoS Pathog. 2021 17 e1010051 10.1371/journal.ppat.1010051 34752492
Doorduijn, D. J. et al. Polymerization of C9 enhances bacterial cell envelope damage and killing by membrane attack complex pores. PLoS Pathog. 17, e1010051 (2021).34752492 10.1371/journal.ppat.1010051
23. Follador R The diversity of Klebsiella pneumoniae surface polysaccharides Microb. Genom. 2016 10.1099/mgen.0.000073 28348868
Follador, R. et al. The diversity of Klebsiella pneumoniae surface polysaccharides. Microb. Genom.10.1099/mgen.0.000073 (2016).28348868 10.1099/mgen.0.000073
24. Trautmann M Held TK Cross AS O antigen seroepidemiology of Klebsiella clinical isolates and implications for immunoprophylaxis of Klebsiella infections Vaccine 2004 22 818 821 10.1016/j.vaccine.2003.11.026 15040933
Trautmann, M., Held, T. K. & Cross, A. S. O antigen seroepidemiology of Klebsiella clinical isolates and implications for immunoprophylaxis of Klebsiella infections. Vaccine 22, 818–821 (2004).15040933 10.1016/j.vaccine.2003.11.026
25. Merino S Camprubí S Albertí S Benedí VJ Tomás JM Mechanisms of Klebsiella pneumoniae resistance to complement-mediated killing Infect. Immun. 1992 60 2529 2535 10.1128/iai.60.6.2529-2535.1992 1587619
Merino, S., Camprubí, S., Albertí, S., Benedí, V. J. & Tomás, J. M. Mechanisms of Klebsiella pneumoniae resistance to complement-mediated killing. Infect. Immun. 60, 2529–2535 (1992).1587619 10.1128/iai.60.6.2529-2535.1992
26. Shankar-Sinha S The Klebsiella pneumoniae O antigen contributes to bacteremia and lethality during murine pneumonia Infect. Immun. 2004 72 1423 1430 10.1128/IAI.72.3.1423-1430.2004 14977947
Shankar-Sinha, S. et al. The Klebsiella pneumoniae O antigen contributes to bacteremia and lethality during murine pneumonia. Infect. Immun. 72, 1423–1430 (2004).14977947 10.1128/IAI.72.3.1423-1430.2004
27. Vinogradov E Structures of lipopolysaccharides from Klebsiella pneumoniae J. Biol. Chem. 2002 277 25070 25081 10.1074/jbc.M202683200 11986326
Vinogradov, E. et al. Structures of lipopolysaccharides from Klebsiella pneumoniae. J. Biol. Chem. 277, 25070–25081 (2002).11986326 10.1074/jbc.M202683200
28. Kol O Structure of the O-specific polysaccharide chain of Klebsiella pneumoniae O1K2 (NCTC 5055) lipopolysaccharide. A complementary elucidation Carbohydr. Res. 1992 236 339 344 10.1016/0008-6215(92)85028-X 1291059
Kol, O. et al. Structure of the O-specific polysaccharide chain of Klebsiella pneumoniae O1K2 (NCTC 5055) lipopolysaccharide. A complementary elucidation. Carbohydr. Res. 236, 339–344 (1992).1291059 10.1016/0008-6215(92)85028-X
29. Albertí S C1q binding and activation of the complement classical pathway by Klebsiella pneumoniae outer membrane proteins Infect. Immun. 1993 61 852 860 10.1128/iai.61.3.852-860.1993 8432605
Albertí, S. et al. C1q binding and activation of the complement classical pathway by Klebsiella pneumoniae outer membrane proteins. Infect. Immun. 61, 852–860 (1993).8432605 10.1128/iai.61.3.852-860.1993
30. Wick RR Heinz E Holt KE Wyres KL Kaptive web: User-friendly capsule and lipopolysaccharide serotype prediction for Klebsiella genomes J. Clin. Microbiol. 2018 10.1128/JCM.00197-18 29618504
Wick, R. R., Heinz, E., Holt, K. E. & Wyres, K. L. Kaptive web: User-friendly capsule and lipopolysaccharide serotype prediction for Klebsiella genomes. J. Clin. Microbiol.10.1128/JCM.00197-18 (2018).29618504 10.1128/JCM.00197-18
31. Lam MMC Wick RR Judd LM Holt KE Wyres KL Kaptive 2.0: Updated capsule and lipopolysaccharide locus typing for the Klebsiella pneumoniae species complex Microb. Genom. 2022 10.1099/mgen.0.000800 35311639
Lam, M. M. C., Wick, R. R., Judd, L. M., Holt, K. E. & Wyres, K. L. Kaptive 2.0: Updated capsule and lipopolysaccharide locus typing for the Klebsiella pneumoniae species complex. Microb. Genom.10.1099/mgen.0.000800 (2022).35311639 10.1099/mgen.0.000800
32. Roth BL Poot M Yue ST Millard PJ Bacterial viability and antibiotic susceptibility testing with SYTOX green nucleic acid stain Appl. Environ. Microbiol. 1997 63 2421 2431 10.1128/aem.63.6.2421-2431.1997 9172364
Roth, B. L., Poot, M., Yue, S. T. & Millard, P. J. Bacterial viability and antibiotic susceptibility testing with SYTOX green nucleic acid stain. Appl. Environ. Microbiol. 63, 2421–2431 (1997).9172364 10.1128/aem.63.6.2421-2431.1997
33. Nunn MA Complement inhibitor of C5 activation from the soft tick Ornithodoros moubata J. Immunol. 2005 174 2084 2091 10.4049/jimmunol.174.4.2084 15699138
Nunn, M. A. et al. Complement inhibitor of C5 activation from the soft tick Ornithodoros moubata. J. Immunol. 174, 2084–2091 (2005).15699138 10.4049/jimmunol.174.4.2084
34. Kaplan M Eculizumab (Alexion) Curr. Opin. Investig. Drugs 2002 3 1017 1023 12186261
Kaplan, M. Eculizumab (Alexion). Curr. Opin. Investig. Drugs 3, 1017–1023 (2002).12186261
35. Pennini ME Immune stealth-driven O2 serotype prevalence and potential for therapeutic antibodies against multidrug resistant Klebsiella pneumoniae Nat. Commun. 2017 8 1991 10.1038/s41467-017-02223-7 29222409
Pennini, M. E. et al. Immune stealth-driven O2 serotype prevalence and potential for therapeutic antibodies against multidrug resistant Klebsiella pneumoniae. Nat. Commun. 8, 1991 (2017).29222409 10.1038/s41467-017-02223-7
36. McCallum KL Schoenhals G Laakso D Clarke B Whitfield C A high-molecular-weight fraction of smooth lipopolysaccharide in Klebsiella serotype O1:K20 contains a unique O-antigen epitope and determines resistance to nonspecific serum killing Infect. Immun. 1989 57 3816 3822 10.1128/iai.57.12.3816-3822.1989 2478478
McCallum, K. L., Schoenhals, G., Laakso, D., Clarke, B. & Whitfield, C. A high-molecular-weight fraction of smooth lipopolysaccharide in Klebsiella serotype O1:K20 contains a unique O-antigen epitope and determines resistance to nonspecific serum killing. Infect. Immun. 57, 3816–3822 (1989).2478478 10.1128/iai.57.12.3816-3822.1989
37. Guan S Clarke AJ Whitfield C Functional analysis of the galactosyltransferases required for biosynthesis of d-galactan I, a component of the lipopolysaccharide O1 antigen of Klebsiella pneumoniae J. Bacteriol. 2001 183 3318 3327 10.1128/JB.183.11.3318-3327.2001 11344139
Guan, S., Clarke, A. J. & Whitfield, C. Functional analysis of the galactosyltransferases required for biosynthesis of d-galactan I, a component of the lipopolysaccharide O1 antigen of Klebsiella pneumoniae. J. Bacteriol. 183, 3318–3327 (2001).11344139 10.1128/JB.183.11.3318-3327.2001
38. Hsieh P-F d-galactan II is an immunodominant antigen in O1 lipopolysaccharide and affects virulence in Klebsiella pneumoniae: Implication in vaccine design Front. Microbiol. 2014 10.3389/fmicb.2014.00608 25477867
Hsieh, P.-F. et al. d-galactan II is an immunodominant antigen in O1 lipopolysaccharide and affects virulence in Klebsiella pneumoniae: Implication in vaccine design. Front. Microbiol.10.3389/fmicb.2014.00608 (2014).25477867 10.3389/fmicb.2014.00608
39. Kelly SD Identification of a second glycoform of the clinically prevalent O1 antigen from Klebsiella pneumoniae Proc. Natl. Acad. Sci. 2023 10.1073/pnas.2301302120 37428935
Kelly, S. D. et al. Identification of a second glycoform of the clinically prevalent O1 antigen from Klebsiella pneumoniae. Proc. Natl. Acad. Sci.10.1073/pnas.2301302120 (2023).37428935 10.1073/pnas.2301302120
40. Alvarez D Merino S Tomás JM Benedí VJ Albertí S Capsular polysaccharide is a major complement resistance factor in lipopolysaccharide O side chain-deficient Klebsiella pneumoniae clinical isolates Infect. Immun. 2000 68 953 955 10.1128/IAI.68.2.953-955.2000 10639470
Alvarez, D., Merino, S., Tomás, J. M., Benedí, V. J. & Albertí, S. Capsular polysaccharide is a major complement resistance factor in lipopolysaccharide O side chain-deficient Klebsiella pneumoniae clinical isolates. Infect. Immun. 68, 953–955 (2000).10639470 10.1128/IAI.68.2.953-955.2000
41. Kaszowska M The mutation in wbaP cps gene cluster selected by phage-borne depolymerase abolishes capsule production and diminishes the virulence of Klebsiella pneumoniae Int. J. Mol. Sci. 2021 22 11562 10.3390/ijms222111562 34768992
Kaszowska, M. et al. The mutation in wbaP cps gene cluster selected by phage-borne depolymerase abolishes capsule production and diminishes the virulence of Klebsiella pneumoniae. Int. J. Mol. Sci. 22, 11562 (2021).34768992 10.3390/ijms222111562
42. Shu H-Y Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates Microbiology 2009 155 4170 4183 10.1099/mic.0.029017-0 19744990
Shu, H.-Y. et al. Genetic diversity of capsular polysaccharide biosynthesis in Klebsiella pneumoniae clinical isolates. Microbiology 155, 4170–4183 (2009).19744990 10.1099/mic.0.029017-0
43. Ramm LE Whitlow MB Mayer MM Transmembrane channel formation by complement: Functional analysis of the number of C5b6, C7, C8, and C9 molecules required for a single channel Proc. Natl. Acad. Sci. USA 1982 79 4751 4755 10.1073/pnas.79.15.4751 6289316
Ramm, L. E., Whitlow, M. B. & Mayer, M. M. Transmembrane channel formation by complement: Functional analysis of the number of C5b6, C7, C8, and C9 molecules required for a single channel. Proc. Natl. Acad. Sci. USA 79, 4751–4755 (1982).6289316 10.1073/pnas.79.15.4751
44. Ramm LE Whitlow MB Mayer MM The relationship between channel size and the number of C9 molecules in the C5b–9 complex J. Immunol. 1985 134 2594 2599 10.4049/jimmunol.134.4.2594 2579147
Ramm, L. E., Whitlow, M. B. & Mayer, M. M. The relationship between channel size and the number of C9 molecules in the C5b–9 complex. J. Immunol. 134, 2594–2599 (1985).2579147 10.4049/jimmunol.134.4.2594
45. Spicer BA The first transmembrane region of complement component-9 acts as a brake on its self-assembly Nat. Commun. 2018 9 3266 10.1038/s41467-018-05717-0 30111885
Spicer, B. A. et al. The first transmembrane region of complement component-9 acts as a brake on its self-assembly. Nat. Commun. 9, 3266 (2018).30111885 10.1038/s41467-018-05717-0
46. Barnum SR Bubeck D Schein TN Soluble membrane attack complex: Biochemistry and immunobiology Front. Immunol. 2020 11 585108 10.3389/fimmu.2020.585108 33240274
Barnum, S. R., Bubeck, D. & Schein, T. N. Soluble membrane attack complex: Biochemistry and immunobiology. Front. Immunol. 11, 585108 (2020).33240274 10.3389/fimmu.2020.585108
47. Albertí S Analysis of complement C3 deposition and degradation on Klebsiella pneumoniae Infect. Immun. 1996 64 4726 4732 10.1128/iai.64.11.4726-4732.1996 8890232
Albertí, S. et al. Analysis of complement C3 deposition and degradation on Klebsiella pneumoniae. Infect. Immun. 64, 4726–4732 (1996).8890232 10.1128/iai.64.11.4726-4732.1996
48. Short FL Genomic profiling reveals distinct routes to complement resistance in Klebsiella pneumoniae Infect. Immun. 2020 10.1128/IAI.00043-20 32513855
Short, F. L. et al. Genomic profiling reveals distinct routes to complement resistance in Klebsiella pneumoniae. Infect. Immun.10.1128/IAI.00043-20 (2020).32513855 10.1128/IAI.00043-20
49. Whitfield C Richards JC Perry MB Clarke BR MacLean LL Expression of two structurally distinct d-galactan O antigens in the lipopolysaccharide of Klebsiella pneumoniae serotype O1 J. Bacteriol. 1991 173 1420 1431 10.1128/jb.173.4.1420-1431.1991 1704883
Whitfield, C., Richards, J. C., Perry, M. B., Clarke, B. R. & MacLean, L. L. Expression of two structurally distinct d-galactan O antigens in the lipopolysaccharide of Klebsiella pneumoniae serotype O1. J. Bacteriol. 173, 1420–1431 (1991).1704883 10.1128/jb.173.4.1420-1431.1991
50. Funayama H Pharmacological characterization of anaphylaxis-like shock responses induced in mice by mannan and lipopolysaccharide Int. Immunopharmacol. 2009 9 1518 1524 10.1016/j.intimp.2009.09.006 19755175
Funayama, H. et al. Pharmacological characterization of anaphylaxis-like shock responses induced in mice by mannan and lipopolysaccharide. Int. Immunopharmacol. 9, 1518–1524 (2009).19755175 10.1016/j.intimp.2009.09.006
51. Magda M Clinical isolates of Acinetobacter spp. are highly serum resistant despite efficient recognition by the complement system Front. Immunol. 2022 10.3389/fimmu.2022.814193 35173727
Magda, M. et al. Clinical isolates of Acinetobacter spp. are highly serum resistant despite efficient recognition by the complement system. Front. Immunol.10.3389/fimmu.2022.814193 (2022).35173727 10.3389/fimmu.2022.814193
52. Joiner K Brown E Hammer C Warren K Frank M Studies on the mechanism of bacterial resistance to complement-mediated killing. III. C5b–9 deposits stably on rough and type 7 S. pneumoniae without causing bacterial killing J. Immunol. 1983 130 845 849 10.4049/jimmunol.130.2.845 6848598
Joiner, K., Brown, E., Hammer, C., Warren, K. & Frank, M. Studies on the mechanism of bacterial resistance to complement-mediated killing. III. C5b–9 deposits stably on rough and type 7 S. pneumoniae without causing bacterial killing. J. Immunol. 130, 845–849 (1983).6848598 10.4049/jimmunol.130.2.845
53. Bayly-Jones C The neoepitope of the complement C5b–9 Membrane Attack Complex is formed by proximity of adjacent ancillary regions of C9 Commun. Biol. 2023 6 42 10.1038/s42003-023-04431-y 36639734
Bayly-Jones, C. et al. The neoepitope of the complement C5b–9 Membrane Attack Complex is formed by proximity of adjacent ancillary regions of C9. Commun. Biol. 6, 42 (2023).36639734 10.1038/s42003-023-04431-y
54. Gu D A fatal outbreak of ST11 carbapenem-resistant hypervirulent Klebsiella pneumoniae in a Chinese hospital: A molecular epidemiological study Lancet Infect. Dis. 2018 18 37 46 10.1016/S1473-3099(17)30489-9 28864030
Gu, D. et al. A fatal outbreak of ST11 carbapenem-resistant hypervirulent Klebsiella pneumoniae in a Chinese hospital: A molecular epidemiological study. Lancet Infect. Dis. 18, 37–46 (2018).28864030 10.1016/S1473-3099(17)30489-9
55. Moore SJ EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology ACS Synth. Biol. 2016 5 1059 1069 10.1021/acssynbio.6b00031 27096716
Moore, S. J. et al. EcoFlex: A multifunctional MoClo kit for E. coli synthetic biology. ACS Synth. Biol. 5, 1059–1069 (2016).27096716 10.1021/acssynbio.6b00031
56. Heesterbeek DAC Complement-dependent outer membrane perturbation sensitizes Gram-negative bacteria to Gram-positive specific antibiotics Sci. Rep. 2019 9 3074 10.1038/s41598-019-38577-9 30816122
Heesterbeek, D. A. C. et al. Complement-dependent outer membrane perturbation sensitizes Gram-negative bacteria to Gram-positive specific antibiotics. Sci. Rep. 9, 3074 (2019).30816122 10.1038/s41598-019-38577-9
57. Yang J High-efficiency scarless genetic modification in escherichia coli by using lambda red recombination and I-SceI cleavage Appl. Environ. Microbiol. 2014 80 3826 3834 10.1128/AEM.00313-14 24747889
Yang, J. et al. High-efficiency scarless genetic modification in escherichia coli by using lambda red recombination and I-SceI cleavage. Appl. Environ. Microbiol. 80, 3826–3834 (2014).24747889 10.1128/AEM.00313-14
58. Sibbald MJJB Synthetic effects of secG and secY2 mutations on exoproteome biogenesis in Staphylococcus aureus J. Bacteriol. 2010 192 3788 3800 10.1128/JB.01452-09 20472795
Sibbald, M. J. J. B. et al. Synthetic effects of secG and secY2 mutations on exoproteome biogenesis in Staphylococcus aureus. J. Bacteriol. 192, 3788–3800 (2010).20472795 10.1128/JB.01452-09
59. Wang, Q. et al. Anti-O1 antibodies and uses thereof. (2017).
60. Muts RM Artificial surface labelling of Escherichia coli with StrepTagII antigen to study how monoclonal antibodies drive complement-mediated killing Sci. Rep. 2023 13 18836 10.1038/s41598-023-46026-x 37914798
Muts, R. M. et al. Artificial surface labelling of Escherichia coli with StrepTagII antigen to study how monoclonal antibodies drive complement-mediated killing. Sci. Rep. 13, 18836 (2023).37914798 10.1038/s41598-023-46026-x
61. Garred P Mollnes TE Lea T Fischer E Characterization of a monoclonal antibody MoAb bH6 reacting with a neoepitope of human C3 expressed on C3b, iC3b, and C3c Scand. J. Immunol. 1988 27 319 327 10.1111/j.1365-3083.1988.tb02353.x 2451273
Garred, P., Mollnes, T. E., Lea, T. & Fischer, E. Characterization of a monoclonal antibody MoAb bH6 reacting with a neoepitope of human C3 expressed on C3b, iC3b, and C3c. Scand. J. Immunol. 27, 319–327 (1988).2451273 10.1111/j.1365-3083.1988.tb02353.x
62. van den Bunt G Dynamics of intestinal carriage of extended-spectrum beta-lactamase–producing enterobacteriaceae in the Dutch general population, 2014–2016 Clin. Infect. Dis. 2020 71 1847 1855 10.1093/cid/ciz1091 31688916
van den Bunt, G. et al. Dynamics of intestinal carriage of extended-spectrum beta-lactamase–producing enterobacteriaceae in the Dutch general population, 2014–2016. Clin. Infect. Dis. 71, 1847–1855 (2020).31688916 10.1093/cid/ciz1091
