
==== Front
F1000Res
F1000Res
F1000Research
2046-1402
F1000 Research Limited London, UK

39148497
10.12688/f1000research.123652.3
Research Article
Articles
Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan
[version 3; peer review: 1 approved

Adam Mosab Investigation Methodology Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0000-0003-4094-0323
a12
Shen Hongwei Investigation Methodology Writing – Original Draft Preparation Writing – Review & Editing 23
Enan Khalid-A Methodology Supervision Writing – Review & Editing 1
Wang Hao Methodology 2
Musa Azza B. Musa Formal Analysis 1
El Hussein Abdel R. Methodology Supervision Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0000-0002-3951-9315
1
Khidir Isam M. Investigation Methodology Project Administration Supervision Writing – Original Draft Preparation Writing – Review & Editing 14
Ma Xuejun Investigation Methodology Project Administration Supervision Writing – Review & Editing 2
1 Department of Virology, Ministry of Higher Education and Scientific Research, Khartoum, Sudan,, khartoum, Sudan
2 National Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, China., beijing, China
3 Futian District Center for Disease Control and Prevention, Shenzhen, China., Shenzhen, China
4 Department of Microbiology and Parasitology,, Faculty of Medicine, University of Khartoum, Khartoum, Sudan, khartoum, Sudan
a mosabko1986@gmail.com
No competing interests were disclosed.

14 6 2024
2022
11 14015 6 2024
Copyright: © 2024 Adam M et al.
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Diarrhea is a significant health problem in the Third World. Identification of the pathogen that causes diarrhea is vital for measures to prevent and control this disease. There are also very few reports of diarrhea in Sudan. Our study aimed to determine the Prevalence of specific protozoan pathogens ( Entamoeba histolytica, Cryptosporidium parvum., and Giardia spp) in children in Khartoum, Sudan.

Methods

We conducted a cross-sectional survey among children under five years of age who were hospitalized with acute diarrhea between April and December 2014. Diarrheal stool samples were collected and E. histolytica, C. parvum, and Giardia spp were examined using multiplex real-time PCR.

Results

Four hundred and thirty-seven children with acute diarrheawere included in this study; the higher Prevalence of diarrhea was in the age less than ≤ 2 years old (403,92.2%). The male-to-female ratio in this study was 1:1.7. infection with intestinal parasite was found in 155 (35.5%) cases, and co-infection was detected in 16 (10.3%) cases. Giardia spp(18.8%) and C. parvum (15.8 %) were the most frequently identified parasites, followed by E. histolytica (0.9). The parasite infection rate was highest and lowest in the under 2-year-old group (92.3%) and the 2–4-year-old group (7.3%). The infection rate was higher in boys (67.1%) than in girls (32.9%). The incidence of protozoan infection was higher in the rainy season (August to December) (92.2%), corresponding with that in the dry Season (April to June). (7.8%).

Discussion

Our present study demonstrated the high prevalence of Giardia spp and C. parvum in children with diarrhea in the Khartoum region and the usefulness of the multiplex real-time method in disclosing pathogenic protozoal agents. Our result highlighted the necessity of developing intervention measurement and control strategies to deal with childhood parasitic diarrhea in this region.

Diarrhea
Detection
Parasitic
Protozoan
Pathogens
Childhood
China Mega-Project for Infectious Disease (2017ZX10302301-00401-0101-0101 and 2010).This work is supported by grants from the National key research and development plan of China (2016TFC1202700, 2016YFC1200900, and 2017YFC1200503)This work was supported, until 2021, by grants from the National key research and development plan of China (2016TFC1202700, 2016YFC1200900, and 2017YFC1200503) and the China Mega-Project for Infectious Disease (2017ZX10302301-00401-0101-0101 and 2010). The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Revised Amendments from Version 2

We made revisions throughout the text with a valuable comment from reviewers throughout the article with a tracker change, including: - We revised the typographical errors and grammar throughout the article - We made the change of name of the pathogen text (giardia lamblia to giardia spp and intestinalis as the reviewer suggested, which was precise; however, for C.parvum, we checked the primer that was used in the study through the BLAST  technique, and we found that it was specific for C.parvum and not detect .C.homines  -The correct percentage values were re-calculated from a total of positives in the Table and changed throughout article  - The statistical analysis  section in the result as also shown in the table, and we add a subsection of total cases to Table 2,3,4 - We change the gender to sex distribution. - We have rewriten some sections in the text eg (Participants and sample storage) - We revised the discussion by removing repeated sentences in the result.
==== Body
pmcIntroduction

Diarrhea is defined as passing soft, loose, or watery feces three times or more in 24 hours; it is usually a result of the consumption of pathogen-contaminated water or food. 1 Diarrhea remains the leading cause of death and illness in children in third-world countries. 2 – 4 Around 1.7 billion cases of childhood diarrhea are reported each year, and diarrhea is estimated to have killed more than 500,000 children under the age of 5 worldwide in 2019. 1 , 5 Where diarrhea is considered the third most common cause for young children to visit health centers, some of the underlying conditions found in the community of most developing countries, including malnutrition and poor hygiene, may increase the risk of experiencing diarrheal disease. 6 In developed countries, the availability of modern technologies and suitable water supply has led to a decline in global death due to diarrhea; however, despite the substantial effort to supply modern technology and management practices, diarrhea in Africa is still unacceptably ranked as the second cause of death among young children. 7 – 10 Despite the high morbidity of childhood diarrhea in Sudan, the knowledge of the parasitic causative agents is scant. Parasitic protozoans that infect the intestinal tract in developing countries include Cryptosporidium spp. Giardia spp., and Entamoeba histolytica, respectively, the agents that cause cryptosporidiosis, giardiasis, and amoebiasis, which are considered prime for diarrheal diseases in children under 5 years old. 11 The limited specificity and sensitivity of the microscopic method commonly used in most Sudan laboratories decreased the parasitic infection detection rate. As a result, there is little information about the precise incidence of diarrhea and causative protozoan agents.

This study aimed to explore the incidence of some protozoan organisms ( Cryptosporidium parvum, Giardia spp., and Entamoeba histolytica) that produce acute diarrheal illness among young children using molecular techniques.

Methods

Ethical considerations

The study was approved by the ethical committee of the Sudan Academy of Sciences (Approval number 2367), and written permission was obtained from the registered child’s parents or guardian.

Design, area, and period of study

This cross-sectional study was co-conducted at the Central Laboratory, Ministry of Higher Education and Research, Sudan, and the National Institute for Viral Disease Control and Prevention, China Center for Disease Control and Prevention, China (CDC), Beijing, China, during two different Seasons (the hot, dry Season from April to June (Summer), and the rainy Season from August to December (Autumn) in the year 2014 at Khartoum teaching hospitals.

Participants (inclusion and exclusion criteria)

A total of 437 fecal samples (one per patient) were collected from children admitted to hospitals who had been clinically diagnosed with acute diarrhea from 1 to 4 days before the sample collection, were less than five years old, and mostly lived in a rural area.

Sample collection and storage

The stool sample was collected in a dry, clean plastic container. The specimens were kept at −20°C till tested in early 2015; frozen samples were sent via dry ice to the Center for Disease Control and Prevention in Beijing, China.

Data collection

Patient data including age, sex, and Season, were collected through a structured questionnaire.

Nucleic acid extraction

Per the manufacturer’s instructions, parasite DNA was extracted from 200 μL of 10% fecal suspension prepared in phosphate buffer saline using QIAamp ® Fast DNA Stool Mini Kit (Qiagen, Hilden, Germany). The extracts were eluted in 60 μL of DNase-free water, immediately aliquoted in 20 μL, and kept at −80°C.

PCR amplification and parasite detection

Primers and probes of multiplex real-time PCR

Three primer pairs and three probes were used for the simultaneous detection of E. histolytica, C. parvum, and Giardia spp. 11 Table 1 shows the oligonucleotide sequence of the primers, probes, and target genes.

Table 1. The nucleotide primers and probes for multiplex real-time PCR were used in this study.

Organism	Target gene a	Primer sequence (5′-3′) b	Probe (5′-3′)	
E. histolytica	SSU rRNA	F: ATTGTCGTGGCATCCTAACTCA
R: GCGGACGGCTCATTATAACA	VIC-TCATTGAATGAATTGGCCATTT 11	
Giardia spp.	SSU rRNA	F: GACGGCTCAGGACAACGGTT
R: TTGCCAGCGGTGTCCG	FAM-CCCGCGGCGGTCCCTGCTAG 11	
C. parvum	DNA-like	F: CGCTTCTCTAGCCTTTCATGA
R: CTTCACGTGTGTTTGCCAAT	Texas Red-CCAATCACAGAATCA 11
TCAGAATCGACTGGTATC 11	
a SSU rRNA, small subunit ribosomal RNA.

b F, forward; R, reverse.

Multiplex real-time PCR

Real-time PCR was performed with a Multiplex PCR kit (Qiagen, Hilden, Germany) in a 20 μL volume containing 6.25 pmol of each E. histolytica-specific primers, 6.25 pmol of each Giardia spp.-specific primers, 25 pmol of each C. parvum-specific primers, 1.75 pmol of E. histolytica-specific VIC-TaqMan probe, 2.5 pmol of G. lamblia-specific FAM-TaqMan probe, 8.75 pmol of C. parvum-specific Texas Red-TaqMan probe. Amplification consisted of 15 min at 95°C, 40 cycles of 15 s at 95°C, 30 s at 60°C, and 30 s at 72°C. The iCycler real-time detection system (Bio-Rad) performed amplification, detection, and data analysis.

Statistical analysis

The Chi-square test assessed differences in proportions. P values <0.05 were considered statistically significant.

Result

Demographic data on the population

A total of 437 children admitted to hospitals had been clinically diagnosed with acute diarrhea, Comprising 276 boys and 161 girls. The participants were aged ≤2 years (403, 92.2%), >2–≤4 years (32, 7.3%), and >4–˂5 years (2, 0.5%).

Prevalence of parasitic infections

Protozoal were diagnosed in 155/437 (35.5%) cases, among which the highest prevalence was Giardia spp. (82/437, 18.8%), followed by C. parvum (69/437, 15.8%), and E. histolytica (4/437, 0.9%). None of them were detected in 282 (64.5%) diarrheal cases ( Diagram 1).

Diagram 1. Overview of protozoal parasite infections.

Distribution of parasitic infections by age, sex, and seasonality

The highest rate of parasitic infection was seen in the ≤2 years group (92.3%) and much lower in the >2–≤4 years old group (7.7%) ( Table 2). In contrast, the protozoal parasite was not detected in the age group of >4–˂5 years. Among children with parasitic infections, 104(67.1%) were male, while 51(32.9%) were female ( Table 3). Diarrhea remains the leading cause of illness in children ≤2 years (403, 92.2%). The incidence of protozoan parasitic infection was higher in the rainy Season (August to December) than in the dry Season (April to June) (143(92.2%) and 12(7.8%), respectively) ( Table 4).

Table 2. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the age.

	Positive	Age in years	P-value	
N	0-2	2-4	4-5	
Giardia spp.	82 (18.8%) *	75 (48.4%)	7 (4.5%)	0 (0%)	0.715	
C. parvum	69 (15.8%) *	64 (41.3%)	5 (3.2%)	0 (0%)	0.828	
E. histolytica	4 (0.9%) *	4 (2.6%).	0 (0%)	0 (0%)	0.843	
Total	155 (35.5%) *	143 (92.3%)	12 (7.7%)	0%		
* Percent inside curly bracket found on the second row and column are % out of 437 patients.

Table 3. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the sex.

	Positive	Sex	P-value	
	N	M	F	
Giardia spp.	82 (18.8%) *	62 (40%)	20 (12.9%)	0.010	
C. parvum	69 (15.8%) *	41 (26.5%)	28 (18.1%)	0.483	
E. histolytica	4 (0.9%) *	1 (0.6%)	3 (1.9%)	0.112	
Total	155 (35.5%) *	104 (67.1%)	51 (32.9%)		
* Percent inside curly bracket found on the second row and column are % out of 437 patients.

Table 4. Frequency of protozoan pathogens in children with diarrhea in Khartoum among the Seasons.

	Positive	Season	P-value	
N	Autumn	Summer	
Giardia spp.	82 (18.8%) *	74 (47.7%)	8 (5.1%)	0.391	
C. parvum	69 (15.8%) *	65 (41.9%)	4 (2.6%)	0.064	
E. histolytica	4 (0.9%) *	4 (2.6)	0 (0%)	0.446	
Total	155 (35.5%) *	143 (92.2%)	12 (7.8%)		
* Percent inside curly bracket found on the second row and column are % out of 437 patients.

Parasitic mono- and co-infections

Infection with monoparasite was found in 139 cases (89.7%). In contrast, parasite co-infection was detected in 16 patients (10.3%), which involved E. histolytica and Giardia spp. in two cases, and Giardia spp. and C. parvum in 14 cases ( Table 5).

Table 5. Frequency of samples with co-infections.

Pathogen	No. of co-infections (%)	
Giardia spp. and C. parvum	14 (9%) *	
E. histolytica and Giardia spp.	2 (1.3%) *	
Total	16 (10.3%) *	
* Percent inside curly bracket found on the second row and column are % out of 155 patients.

Statistical analysis

The occurrence of Giardia spp. in male children was statistically significant than in females (P < 0.01); besides that, the comparisons between these variables were not relevant ( Tables 2, 3, 4).

Discussion

Gastrointestinal protozoan parasites still pose common health problems, mainly in children under five years worldwide. Rapid and accurate identification of protozoan parasites is a big challenge in many developing countries. The real-time multiplex PCR technique used herein, which provides concurrent detection of all protozoal parasites, is an exceedingly powerful laboratory system, enabling rapid, sensitive, precise, and inexpensive parasite detection.

The present study aimed to determine the prevalence of certain protozoan parasites linked with acute gastroenteritis in stool samples from children under five years old using a multiplex real-time PCR assay developed in a previous study. 11

As shown in Table 2, the sex distribution among the Giardia spp.-positive samples was 67.1% in males and 32.9% in females (P<0.01), indicating a statistically significant difference among the sex group that supports the statement of Khwam H. 12

The most significant number of samples were from the age group ≤2 years followed by >2–≤4 years and >4–˂5 years. The result of our study indicates the highest Prevalence of protozoal diarrhea was detected in the age group of ≤2 years followed by >2–≤4 years and no protozoan pathogen was found in the age group of >4–˂5 years; however, these results could be explained by the fact that most of our samples were collected from the age group ≤2 years in which the decline of the maternal immunity with an age risk factor of diarrhea infection. 13 , 14 The highest positivity was detected in the samples of boys less than two years old. The reason that the number of children with diarrhea (boys of ≤2 years) admitted to hospitals is not apparent, and more research is needed to determine whether this is the pattern of childhood diarrhea in Sudan. The contaminated hands and bad hygiene may contribute to the transmission of food-borne infection in these children, which was in agreement with the investigation in Nepal, where the highest Prevalence of parasitic diarrhea was found in the age group of fewer than two years. 15 However,our result differed from another study by Saeed et al. in Khartoum 16 in which the major group of infections was >4–˂5 years old, and this may again be due to statistical bias since most of the samples were collected from the age group of ≤2 years; This should be investigated in future studies by using larger sample size in different Season.

The result revealed a higher prevalence (35.5%) of protozoan capable of causing children diarrhea compared with other studies conducted in Khartoum state (16%). 16 and other developing countries, including Nepal and Ethiopia (0.7% and 15.6%, respectively). 15 , 17 In comparison, the incidence was lower than that in Tanzania and South Africa (55.6% and 68%, respectively) 18 , 19 and close to that reported in the Gaza Strip (39%). 20 Our study is the first to demonstrate a high Prevalence of Cryptosporidium parvum (15.8%) in Sudan. The diagnosis of Cryptosporidium used to depend on the Ziehl−Neelsen stain, and it was neglected mainly by our laboratories until we used a sensitive molecular assay that increased the detection rate of these agents.

The most prevalent protozoan detected in the present investigation was Giardia spp., with a prevalence of 18.8%, higher than in the study conducted in Khartoum State (15.8%). 16 Its Prevalence was followed by C. parvum (15.8%) and E. histolytica (0.9%). This result was consistent with previous findings in developing countries, including India, Gaza, and Nigeria. 13 , 20 , 21 Infection with mono protozoan parasite was found in 139 cases (89.7%) cases; co-infection was found in 16 cases (10.3%). The study of co-infection on clinical severity was not studied in these patients. However, it has been reported that no significant variation was reported in the clinical symptoms of patients with co-infections compared with those with single infections. 22 Our study showed that the incidence of a protozoan parasite is higher in autumn (wet) than with summer (dry) which was under the study conducted in Khartoum state. 16 It should be noted that no protozoan pathogen was detected in stool samples, which were likely due to infections with other pathogens like viruses and bacteria and also may be due to noninfectious reasons like hypersensitivity to certain food ingredients and weaning diarrhea that result from the inability of an underdeveloped child intestine to metabolize the food. Poor hygiene and sanitation and lack of proper toilets may facilitate these infections. 16

Conclusion

The current investigation provided some vital information about the protozoan source of diarrhea in children in the state of Khartoum.

These findings are valuable in developing measures to improve the health condition of the young. Furthermore, this study calls for establishment of sensitive and specific molecular methods, such as multiplex PCR, for detecting the protozoan pathogen in a clinical setting, which is essential.

Authors contributions

Mosab, Isam, and Xuejun designed the experiment; Mosab and Hong performed the lab experiment; Azza analyzed the data; Mosab, Khalid, and Abdel collected the samples; and Mosab Hong and Abdel wrote the article.

Data availability

Underlying data

Excel, https://doi.org/10.6084/m9.figshare.21201676.v3. 23

This project contains the following underlying data: • Data information.xlsx

The material is available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

10.5256/f1000research.167575.r291316
Reviewer response for version 3
Ponce-Gordo Francisco 1Referee https://orcid.org/0000-0001-9034-8606

1 Complutense University of Madrid, Madrid, Spain
9 9 2024 Copyright: © 2024 Ponce-Gordo F
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 3recommendationreject
The authors have improved the article, however there are some points that should be corrected. The new consideration as "not approved" is based on the errors in the calculation of the percentage values for statistical analyses.

1. Presentation. There are typographical and or grammar errors in the text. To mention only a few, in abstract: in introduction, please write "parvum" in italics; in methods, " spp. were examined" should not be in italics; in results, in the first line, place a space in "diarrheawere", write 'Prevalence' in lower case, correct "age less than ≤ 2 years" to "age less than 2 years" or "age ≤ 2 years", correct the number (403,92.2%) or indicate what is each number, ...

In other cases, expressions are incorrect or have no sense; i.e., in discusion, paragraph #6: "infection with mono protozoan parasite was found ...", In this case, "single protozoan infections" would best be used.

There are many small corrections to do.

2. Content.

In abstract-results, "the incidence of protozoan infection ...". Change to "the number of positive cases ...". Incidence is the number of new cases in the population, and prevalence the number of infected persons in the population. In both cases, the population should be known (the total population, not the total number of symptomatic patients included in the study).

In methods-participants (inclusion and excllusion criteria): say only the conditions for inclusion/exclusion; the number of patients accepted will be provided in results. Also, "mostly lived" is not a criterion for inclusion/exclusion (the criterion for acceptance/rejection should be 'lived' or 'not lived' in a rural area)

In methods - table 1: what is target gene: DNA-like? "DNA-like" is not a gene.

Methods-statistical analysis: please indicate which variables were included in the analysis. As proportions were in some cases incorrectly calculated (see below), please revise the analysis and re-do.

In results-distribution of parastic infections by age, sex and seasonality: in order to keep consistency with the data provided in the previous subsection, please use the same format for each group: positive number/total number of samples (%)

In this same section, the fourth sentence ("Diarrhea remains ..." has no sense.The samples were collected from symptomatic patients, so all of them were diarrheic or, at least, the patients had diarrhea in the previous days. It cannot be said that "diarrhea remains the leading cause of illness in children", the data presented do not support this. This might be a comment for the discusion section, if adequate references are provided.

In diagram 1: "no pathogen" is not correct, please use "no protozoa". In those patients, diarrhea could have been caused by other pathogens as viruses or bacteria.

In tables 2-4: the percentages seem to be incorrectly calculated. For each category (i.e., for 0-2 years, 2-4 years, 4-5 years; for male and for females; and for autumn and summer), the percentage should be calculated as the number of positive cases/total number of cases in THE CATEGORY, not in the total. That is, for example in Giardia and the values in the 0-2 years category: 75 positive samples (in that category) respect to 403 samples (the number of 0-2 years samples analyzed), is 18.6% (not 48.4%, which has been calculated as the percentage of positive samples at that category, respect to the total number of positive samples for all categories and all parasites). All the percentages are incorrect, and the statistical results are also incorrect, this affecting the results and the discusion sections. Please provide the number of total cases for each category, and re-calculate the percentages accordingly.

In statistical analysis: it should be re-done. In the revised version, please indicate the results for all protozoa, not only one of them (as in the present case, only for Giardia). The sentence that it is now in the text is also incorrect, it should be something like "the occurrence of Giardia respect to sex is statistically signifcant, being greater in males than in females" or as "the occurrence of Giardia in male children was higher and statistically significant than in females".

In discusion, ending of the first paragraph, "sensitive": what about false negatives? Please provide references to support the statements.

Also in discusion: avoid paragraphs consisting on single sentences. Place the second paragraph at the end of the first one.

Discusion should be redone according to the new results from the statistical analysis. The geneal structure of the section followed now can be kept. Avoid repeating results (i.e., in the third paragraph, "As shown in table 2, ..." ); also, this paragraph would be best moved and included with the text dealing with Giardia.

In discusion, paragraph #6, "It should be noted that no protozoan pathogen was detected in stool samples". If this sentence applies to the reference just cited in the previous sentence (a study conducted in Khartoum state), please clearly state it. In the present study, some positive protozoan infections were detected in summer samples.

In conclusion: "the current investigation provided some vital information ...". The information provided in the manuscript is not of vital importance, please moderate the tone. The study focuses on the parasites that cause diarrhea, and these parasites are well-known pathogens. If the data were on the source of the infections (water or food), it would be very important as it will allow adopting preventive measures to avoid further infections.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Parasitology - Protozoology - molecular taxonomy

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

10.5256/f1000research.167575.r291313
Reviewer response for version 3
Sarmin Monira 1Referee
1 International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh
14 8 2024 Copyright: © 2024 Sarmin M
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 3recommendationapprove
The authors did the necessary revision. This version is more acceptable. Statistical section under methodology needs more elaboration.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

No

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

NA

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

10.5256/f1000research.167575.r291317
Reviewer response for version 3
R. Schiller Lawrence 1Referee
1 Baylor Scott & White Health, Dallas, Texas, USA
2 7 2024 Copyright: © 2024 R. Schiller L
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 3recommendationreject
This paper reviews data collected 10 years ago. The patient sample was a convenience sample--patients admitted to hospital with acute diarrhea. This sample may not reflect prevalence of protozoal diarrhea in the larger population in Sudan. It only reflects the findings in patients so sick as to require hospitalization because of volume depletion or other complications of diarrhea. The discussion needs to be modified to mention this; the prevalence of protozoal diseases as a proportion of all diarrheal diseases may be impacted by the occurrence of outbreaks of other diarrheal diseases. Were there any concurrent outbreaks (e.g., cholera, E.coli, etc.) in 2014?

If the authors want to assess the prevalence of protozoal diarrhea in children in Sudan as the title indicates, the background carriage in asymptomatic children and the prevalence in children with diarrhea who are not hospitalized should be checked.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Diarrheal disease

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

10.5256/f1000research.161677.r271108
Reviewer response for version 2
Boughattas Sonia 1Referee https://orcid.org/0000-0001-7216-7852

1 Qatar University, Doha, Doha, Qatar
6 6 2024 Copyright: © 2024 Boughattas S
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 2recommendationapprove-with-reservations
This work is of interest in the field with clear workflow and understandable impact.

However, several points need to be taken in consideration

-Language editing is required especially for the abstract and introduction parts

-G. lamblia name is no longer frequently used, please replace by G. intestinalis

-Within the Results section, different points need to be addressed:

i) I don’t believe the mention of “undiagnosed cases” is right. Same with the statement “No protozoan pathogen was detected in 282 (64.5%) diarrheal cases (Diagram 1).”

These cases can be due to other protozoan pathogens not screened in the current study as Blastocystis sp. Dientamoeba fragilis or even other Cryptosporidium and Entamoeba species.

I would suggest removing Diagram 1 and report only to the targeted protozoa prevalence.

ii) The statically significant p-value should be mentioned in Bold in the tables

-The discussion part lacks some sections: the difference in prevalence between genders within Giardia is statistically significant so this factor needs further comparisons and discussion.

Same for the season factor, an explanation should be provided according to t the literature on why high prevalences of protozoa are observed within the Wet season compared to the Dry season.

Once the different points are amended, the manuscript quality will be improved and thus be indexed.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Molecular epidemiologu, Protozoa, Zoonosis

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Adam Mosab Central laboratory -Sudan, Sudan

7 6 2024 Thanks for the valuable comments. That will surely increase the quality of our manuscript, so for now, I have submitted version 3, which is being processed with a typesetter and will be available online soon. Fortunately, in this version, we addressed most of the points you mentioned( G.lamblia, “undiagnosed cases statement.) Which was also recommended by a past reviewer. Later, we will change the others. I wish to recheck it when it becomes available online 

Best regards 

Mosab adam

10.5256/f1000research.161677.r271112
Reviewer response for version 2
R. Schiller Lawrence 1Referee
1 Baylor Scott & White Health, Dallas, Texas, USA
10 5 2024 Copyright: © 2024 R. Schiller L
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 2recommendationreject
This paper reviews data collected 10 years ago. The patient sample was a convenience sample--patients admitted to hospital with acute diarrhea. This sample may not reflect prevalence of protozoal diarrhea in the larger population in Sudan. It only reflects the findings in patients so sick as to require hospitalization because of volume depletion or other complications of diarrhea. The discussion needs to be modified to mention this; the prevalence of protozoal diseases as a proportion of all diarrheal diseases may be impacted by the occurrence of outbreaks of other diarrheal diseases. Were there any concurrent outbreaks (e.g., cholera, E.coli, etc.) in 2014?

If the authors want to assess the prevalence of protozoal diarrhea in children in Sudan as the title indicates, the background carriage in asymptomatic children and the prevalence in children with diarrhea who are not hospitalized should be checked.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Diarrheal disease

I confirm that I have read this submission and believe that I have an appropriate level of expertise to state that I do not consider it to be of an acceptable scientific standard, for reasons outlined above.

10.5256/f1000research.161677.r251189
Reviewer response for version 2
Sarmin Monira 1Referee
1 International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh
7 5 2024 Copyright: © 2024 Sarmin M
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 2recommendationapprove-with-reservations
The manuscript needs a few corrections.

The following things should be addressed before finalization.

1.Abstract: Results section needs revision:       

1st line- 437 acute children were included, what does acute children mean?

2.The parasite infection rate was highest and lowest in the under 2-year-old group (32.7%), and in the 2–4-year-old group (2.7%), the infection rate was higher was higher in boys (23.7%) than in girls (11.7%). The incidence of protozoan infection was higher (37.7%) in the rainy season (August to December) (32.7%), corresponding with that in the dry Season (April to June). (2.7%).

This section needs revision, difficult to apprehend it.

3.Data collection: Patient data including age, biological gender, and Season, were collected through a structured questionnaire.

Actually, we record sex of the child not the gender.

4.Results: Table 3- probably the authors assessed sex not the gender.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

No

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

NA

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Adam Mosab Central laboratory -Sudan, Sudan

9 6 2024 I appreciate your efforts and comments that sure will increase the quality of my manuscript 

we corrected the points you mentioned in your review

- we change gender to sex in the text and table 

-We corrected the sentence you said in the abstract. (This section needs revision; it is difficult to comprehend.)

10.5256/f1000research.161677.r255630
Reviewer response for version 2
Ponce-Gordo Francisco 1Referee https://orcid.org/0000-0001-9034-8606

1 Complutense University of Madrid, Madrid, Spain
10 4 2024 Copyright: © 2024 Ponce-Gordo F
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 2recommendationapprove-with-reservations
General comments

Please correct the names of parasite species throughout the text. For the amoeba, it should be Entamoeba (not Entameobia). While the name Giardia lamblia is commonly used in medical literature, it is a synonym of either Giardia duodenalis, Giardia intestinalis, or Giardia enterica. Please refer to the taxonomic revision made by Wielinga et al. (2023)[Ref 1]. Even in the GenBank database, the entries identified as G. lamblia by different authors are identified in the source organism field as G. intestinalis.

In this study, the methodology (multiplex real-time PCR)

is based on a previous paper in which the human species were identified as monotypic, as G. intestinalis (= G. lamblia) and C. parvum; however, now these species have been separated into G. duodenalis/G. intestinalis/G. enterica and C. parvum/C. hominis, and all of which can infect humans; Since precise identification ...". What I want to say is that only G. intestinalis and C. parvum were considered in the study where the multiplex PCR was described because at that time these species were the only ones accepted.Most likely, if the study were carried out now, the authors would have said Giardia spp. and Cryptosporidium spp., because the methodology they developed does not allow to differentiate between G. duodenalis-

G. intestinalis-G. enterica, or between C. parvum-

C. hominis; all these species are now accepted as different but are morphologically indistinguishable.

When first mentioned, the species name should be indicated in full. As the abstract and the main text are usually considered different texts, please mention the species' full name in the main text when first mentioned, even if the species have been mentioned in the abstract.

Sometimes, the text is hard to understand. Please revise typographical errors (words, parentheses, spaces, punctuation signs), and grammar errors (e.g., the use of prepositions). A sentence should not start with an abbreviation or with a number in digits; in such cases, the number should be written in text. For example, in the Abstract-results section, it should start: "Four hundred and thirty-seven children with acute diarrhea ...". In the same paragraph, there is a sentence that should not start as "G. lamblia" but as "Giardia spp. (18.8%) and ...".

Comments on each section:

In keywords, I suggest including at least the genus names of the parasites: Giardia, Cryptosporidium, Entamoeba (or Giardia spp., Cryptosporidium spp., Entamoeba histolytica).

In the Introduction, it sounds strange to indicate "diarrhea is estimated to have killed 500,667 children". Such a level of precision seems to be not an estimation but a precise count. As there are probably cases that are not reported, I suggest rounding the number to "more than 500,000 children".

In the methods, please rewrite the paragraph about participants; it is hardly understandable.

In the results, in the "prevalence of parasitic infections" section, the genetic analysis is supposed to unambiguously diagnose E. histolytica, Giardia spp., and Cryptosporidium spp.; then, "A potential protozoal parasite was diagnosed ..." would be incorrect; it would be better to say "Protozoa were diagnosed in 166/437 (35.5%) cases, among which ... . None of them were detected in 282 (64.5%) diarrheal cases".

In the "Distribution of parasitic infection by age, sex, and seasonality" subsection, please add the number of positive/total samples where appropriate, to keep uniformity and clarify if the percentages were calculated as positive/total cases within each age range, or as positive/total number of cases. For example, if there were 143 positive cases in the <2 yo group, and 12 in the 2-4 yo group, the correct percentages would not be 143/437 (32.7%) and 12/437 (2.7%), but 143/155 (92.2%) and 12/32 (37.5%). Also, add the numbers to tables 2-5.

In this same subsection, the sentence "Diarrhea remains the leading cause and illness in children <2 years" is not a valid statement, as all samples considered were from symptomatic (diarrheic) patients, but no info is provided about the total number of persons (symptomatic and asymptomatic) in each age group in the population from which this group of patients was investigated.

In the results, nothing is said about the results of the statistical analysis (apart from the sentence "the comparisons between these variables were not relevant"). It seems that there are clear differences at least between the age groups. There are some comments in discussion (paragraph #4), but the data should be given in results.

In the discussion, please avoid repetition of data already provided. For example, paragraph #2 says the same thing already mentioned in the introduction and methods sections; paragraph #3 is a repetition of results. In paragraph #5, it is not necessary to repeat the numbers of samples and percentages; they are already given in results. There are texts that can be reduced in extension and/or removed.

In the paragraph starting "The result revealed a higher prevalence ...", please modify it to something like "... revealed a higher prevalence (35.5%) of protozoa capable of causing diarrhea disease in children under 5 years old".

In the paragraph before the last one, the sentence "It should be noted that no protozoan pathogen was detected in stool samples, ..." is it supposed to refer to the study (16) carried out in Khartoum state?

Expanding comments on the review form.

1. The literature is correct, however the text is sometimes hard to read and confuse. Results should be better presented. The name of the organisms should be revised and corrected.

2. The results of the statistical analysis should be provided in the text of the results section, or in a table. The correct percentage values should be re-calculated.

3. There is not a specific conclusions section. About the comments In the last paragraph of discussion, the authors stated:

- "The present study furnished some crucial insights into the protozoan cause of child diarrhea in Khartoum State". What are those "crucial insights"?

- "Findings will help us understand the importance of parasitic diarrhea in children younger than five years". What are this importance? (please note that only about one third of the diarrheal samples were positive to protozoa; what about the other two thirds?).

- "This study calls for the establishment of sensitive and specific molecular techniques". There are no comparative data on parasite diagnosis using non-molecular methods. It would be of great help to support this statement, the availablity of data from microscopical observations in stained/unstained preparations of the same samples, to make comparisons and draw conclusions.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Parasitology - Protozoology - molecular taxonomy

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Adam Mosab Central laboratory -Sudan, Sudan

4 6 2024 Thanks for the valuable comment, which raised the quality of the article. I revised your comment throughout the article as follows. 

We made revisions throughout the text with a valuable comment throughout the article with a tracker change, as follows

- we revised the typographical errors and grammar throughout the article

- we made the change of name of the pathogen text (giardia lamblia to giardia spp and intestinalis as the reviewer suggested, which was precise; however, for C.parvum, I checked the primer that was used in the study through the BLAST  technique, and we found that it was specific for C.parvum and not detect .C.hominis, 

-The correct percentage values were re-calculated from a total of positives in the table and changed in all article  section 

we add a section on statistical analysis  in the result, as also presented  in the tables, and we add a subsection of total cases to each of Tables 2,3,4

- we revised the discussion by removing repeated sentences, and we removed the points you mention 

-we add conclusion suction

-regarding the two-thirds of the samples were negative, I already mentioned in the discussion by proven 

that infections with other pathogens like viruses and bacteria also may be due to noninfectious reasons like hypersensitivity to certain food ingredients; besides that, we conducted another study to detect other causes of viral and bacteria in Khartoum state in the flowing link (https://pubmed.ncbi.nlm.nih.gov/29487571/)

All our study samples were collected from symptomatic children with diarrhea admitted to the hospital for 1 to 4 days.

Unfortunately, we could not investigate using a non-molecular technique; hence, we collected it in Sudan and tested it in China. There, the laboratory has to use only facility-molecular techn

10.5256/f1000research.135782.r179577
Reviewer response for version 1
Lekana-Douki Jean Bernard 12Referee
1 University of Health Sciences, Owendo, Gabon
2 Université Des Sciences de La Santé, Libreville, Gabon
1 8 2023 Copyright: © 2023 Lekana-Douki JB
2023
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 1recommendationapprove-with-reservations
The article titled ‘ Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan” by Mosab Adam et al. described the identification of three main intestinal protozoan parasite ( Cyptosprodium parvum, Giardia lamblia and Entamoeba histolytica) in Sudan. While the paper has merit, there are a few major challenges with the paper in the current format:

Page 1 (of the pdf version of the article):

Abstract

Introduction: Changed ‘’aged less than five years” by ‘’children”. Changed “ Cryptosporidium spp.” by “ Cryptosporidium parvum” and “ Giardia lambelia” by “ Giardia lamblia”.

Methods: This section isn’t sufficiently clear and precise. Please make the necessary changes. For example, you might say: “We conducted a cross-sectional survey among children under five years of age hospitalized with acute diarrhea between April to December 2014. Diarrheal stool samples were collected and examined for E. histolytica, C. parvum and G. lamblia using a multiplex real-time PCR method”.

The number of children included in the study must appear in the results section.

Results: Please make the necessary changes. For example, you might say: “A total of the 434 acute diarrheal children were included in this study”, following by average mean ± Standard deviation, median age and sex-ratio of this children, before presented global prevalence of parasitic infections, frequency of co-infection and more…

Discussion? I think the made a mistake in the title section of the abstract. Please write “conclusion” instead of “discussion”.

Page 3:

Introduction

Sentence 1: The two references cited are old and inappropriate. I recommend citing the WHO online document (Diarrhoeal disease: key facts, May 2, 2017) which is recent and, in my opinion, suitable for this affirmation.

Sentence 2: You say that diarrhea remains a major problem in terms of morbidity and mortality in children, which is true, but the references cited are not appropriate for this affirmation. I therefore recommend that you replace them with the following articles: Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016 (Christopher Troeger et al., 2018);

Mapping geographical inequalities in childhood diarrhoeal morbidity and mortality in low-income and middle-income countries, 2000-17: analysis for the Global Burden of Disease Study 2017. Lancet. 2020 Jun 6;395(10239):1779-1801. doi: 10.1016/S0140-6736(20)30114-8.

GBD 2017 Causes of Death Collaborators. Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980-2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018 Nov 10;392(10159):1736-1788. doi: 10.1016/S0140-6736(18)32203-7.

Sentence 3: You claim: “More than 1 billion episodes occur […] than 5 years in developing countries”. This assertion is out of date, because thanks to advances in vaccination (e.g., the extension of rotavirus vaccination) and treatment (e.g., ORS), the burden of diarrheal disease has fallen considerably. Studies show that, over the last three decades, children under 5 years of age have accounted for the majority of deaths from diarrhoeal diseases, with around 1.7 million children in this age group dying in 1990. Your figure of 2.5 million deaths among children under 5 in developing countries is incorrect. Today, interesting data on mortality linked to diarrheal diseases in children are shown by: WHO, title: Diarrheal diseases: highlights, posted online May 2, 2017.

This online document shows that there are around 1.7 billion cases of childhood diarrhea each year worldwide, and that diarrhea kills 525,000 children under the age of 5 each year). Bernadeta Dadonaite, Hannah Ritchie and Max Roser (2018) - "Diarrheal diseases". Published online at OurWorldInData.org. Retrieved from: 'https://ourworldindata.org/diarrheal-diseases' [Online Resource].

According to this article available online, diarrhea killed 500,667 children under 5 worldwide in 2019. Alternatively, you could say: “There are around 1.7 billion cases of childhood diarrhea each year, and diarrhea is estimated to have killed 500,667 children under the age of 5 worldwide in 2019”. (In this case, you'll need to cite the two online articles above).

I recommend that you modify sentence 3 according to one of the three choices I've indicated above.

Sentence 7: There's an error in the reference numbering; instead of reference number 10, you've written reference number 15. Please correct this error.

Overall, the introductory section needs to be revised, focusing on the most relevant references related to the topic and the most recent, preferably less than 5 years old, as I demonstrated above.

Methods

For greater clarity, please organize the following additional sections: Ethical considerations ;

Design, area and period of study

Participants (inclusion and exclusion criteria), sample collection and storage

Nucleic acid extraction (already present)

PCR amplification and parasite detection (already present)

Statistical analysis (this is currently missing entirely).

Data on the total number of samples collected, as well as frequencies of hospitalized diarrheic children can be presented in the "results" section (below) in a section entitled "demographic data on the study population".

Section “PCR amplification and parasite detection”:

In the last sentence, the authors state that "Table 1 shows the sequences of the primers, probes and targeted genes, as well as the expected sizes", which is partially true as the expected sizes are not shown in Table 1. Please make the necessary corrections.

Table 1 also contains several references, both for organisms (reference number 5) and probes (reference numbers 16 and 19). I think this is a mistake! If not, please formulate appropriate sentences citing these references in the text before putting them in Table 1.

Results

There is some confusion between Cryptosporidium spp and Cryptosporidium parvum in this section. Cryptosporidium spp. refers to the genus Cryptosporidium, which includes over 30 species identified in mammals ( C. parvum and C. hominis followed by C. mealegridis are the main species identified in humans), while C. parvum refers to a species of the genus Cryptoporidium, which is a so-called zoonotic species, unlike C. hominis, which is anthroponotic. I think you mean C. parvum, since according to the Verweij et al article first quoted in the methods section, the Cryptosporidium primers used were specific to C. parvum. Modifications therefore need to be made to this part of the work, in particular to the text and Tables 3, 4 and 5, as well as to the discussion.

For greater clarity, please organize the following additional sections: Demographic data

Prevalence of parasitic infections (modify figure 1 into diagram)

Parasitic mono- and co-infections (modify table 5)

Distribution of mono- and co-infections by sex, age and seasonality.

Discussion

Paragraph 5: the last quotation (reference number 13) does not correspond to the penultimate sentence (But our result differed [...] from the age of the group by ≤ 2 years;).

Overall, the research results are not sufficiently valued. Limitations or weaknesses are not sufficiently highlighted.

Is the work clearly and accurately presented and does it cite the current literature?

No. Some of the bibliographical references cited are not appropriate to the assertion or argument put forward. In addition, there is an error in the numbering of the references cited by the authors.

Is the study design appropriate and is the work technically sound?

Partly. Although the work may have academic value, the study design is a little confusing, as some of the results on the demographic characteristics of the children included in the study are mixed with information on the study design. Inclusion and exclusion criteria for hospitalized children are not clearly presented. The study design needs to be properly reformulated.

Are sufficient details of methods and analysis provided to allow replication by others?

Partly.

If applicable, is the statistical analysis and its interpretation appropriate?

No. The statistical analyses carried out have not been set out in the "Methods" section, making interpretation of the results inappropriate. Furthermore, when percentages are mentioned, it is preferable to provide the figures used to calculate the prevalence or percentage, enabling the reader to interpret and evaluate the results more clearly.

Are all the source data underlying the results available to ensure full reproducibility?

Partly.

Are the conclusions drawn adequately supported by the results?

Partly.

Is the work clearly and accurately presented and does it cite the current literature?

No

If applicable, is the statistical analysis and its interpretation appropriate?

Partly

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Epidemiology of Infectious diseases

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Adam Mosab Central laboratory -Sudan, Sudan

27 1 2024 Thanks for these informative comments. I found it precise and increased the quality of our manuscript. 

We took all reviewer comments, made corrections throughout the paper, and updated this version.

1. rewrote the abstract section and updated it according to the reviewer's suggesting 

2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones

3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments 

4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram 

5. update the discussion section and address the reviewer's comments

Adam Mosab Central laboratory -Sudan, Sudan

4 6 2024 Thanks for your valuable comments 

I corrected that point you mentioned as I changed gender to sex, then rewrote the sentence  in a clear way and corrected the sentence in the text that you commented on it

10.5256/f1000research.135782.r179572
Reviewer response for version 1
Sarmin Monira 1Referee
1 International Centre for Diarrhoeal Disease Research, Dhaka, Bangladesh
26 7 2023 Copyright: © 2023 Sarmin M
2023
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 1recommendationapprove-with-reservations
This is an important study,

Write up needs a lot of improvement. Introduction is well written. However other sections need care especially the discussion, results were repeated many a times.

I am adding my observations:

Methods: Duration of the study?

How the sample size 437 were fixed? Did you calculate the sample size?

What was the sampling methods?

Did you enroll all children? Please add a study flow diagram.

What were the eligibility criteria?

Description of the study site might help the reader to gasp the scenario.

Is Jan- March winter season? Why excluded?

Methods section also need a description of the statistical analysis. Which analytical tools were used for data analysis?

Needs discussion with a statistician.

Results: Usually a pie chart consists of 100%, though there is a label of 18.8, visually it is >50%, So, the figure 1 needs to corrected. You can build a pie of pie or bar of pie instead.

Table 4 indicates season as Autumn and summer, there is no elaboration in the method. Rather, it was labelled as dry and rainy seasons. Do they differ?

Did you collect only data on age, sex, season?

Their nutritional status, socio-economic condition, vaccination, housing, water supply Presence/absence of comorbidities, other laboratory analysis, outcome of this admission also needs to be incorporated.

Patient data were collected through a structured questionnaire, including age, gender, and season. This statement needs modification. We collect data on biological sex, not on gender. There is difference between sex and gender.

As much more samples were collected from boys (276) than from girls (161) in the age group ≤2 years (403, 92.2%), the comparisons between these variables were not relevant.—This statement is not correct, proportion is the most important indicator. And in the result section, we should only present the results. We have discussion section to accept or refute the results.

Did your facility receive more male child, or you have included more male children? What is the national proportion?

Table 2,3,4 could be merged to a single table- column containing the name of parasite and rows containing the distribution of age, sex, season and etc.

Discussion: The highest rate of parasitic infection was seen in the ≤2 years group (32.7%) and much lower in the >2–≤4 years old group (2.7%) (Table 2). In contrast, the protozoal parasite was not detected in the age group of >4–<5. Why it happened? What is your explanation?

This study was conducted during two seasons (autumn and summer), from April to December 2014, however, in methods, July was not included.

male-to-female ratio of 1:1.7, this result first appeared in the discussion section, but it should be come in the result section first.

If maternal immunity is an important factor against parasitic infection, then it is assumed that older children had more parasitic infection than younger children, but this study did not find that.

A limitation section should be added.

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

No

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

NA

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Adam Mosab Central laboratory -Sudan, Sudan

27 1 2024 Thanks for these informative comments ts really raise up our manuscript 

We took all reviewer comments, made corrections throughout the paper, and updated this version.

1. rewrote the abstract section and updated it according to the reviewer's suggesting 

2. we update the introduction section by rewriting the updated information, adding new updated references, and deleting the old ones

3. rewrote the method section, added the missing information, and updated carefully with the help of reviewers' comments 

4. rewrote the result section, updated and classified it as the subtitle, added the statistical part, updated the tables and the diagram 

5. update the discussion section and address the reviewer's comments

10.5256/f1000research.135782.r160656
Reviewer response for version 1
Bartelt Luther A 1Referee https://orcid.org/0000-0002-7596-4272

Ngobeni Renay 2Co-referee
1 Division of Infectious Diseases, University of North Carolina at Chapel Hill, Chapel Hill, NC, USA
2 University of North Carolina at Chapel Hill, Chapel Hill, NC, USA
15 2 2023 Copyright: © 2023 Bartelt LA and Ngobeni R
2023
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 1recommendationreject
The investigators report on the findings of 3 protozoans in children under 5 that were hospitalized for acute diarrhea. It is always helpful to have surveillance data for difficult to detect pathogens using molecular methods from a wide range of global sites. The report is therefore helpful in contributing data to improved understanding of local patterns of these globally distributed parasites. 

The limitations, which the authors need to better explain, include a limited number of demographics variables (resulting in an inability to control for possible confounders that lead to a finding of a difference between M vs F Giardia status for example), the lack of reporting of statistical methods, the lack of reporting of PCR validation steps and whether any biomass or molecular method was used to standardize the DNA extraction, and the lack of a comparator of conventional-based diagnostics that would greatly enhance the differential sensitivity of the molecular methods (as it is one cannot discern if the difference in Cryptosporidium spp. reported in this study compared with others in Sudan as raised in the discussion is due to difference in diagnostic tools or difference in study population).

Also, the title is misleading. The study population appears to be children who were hospitalized for acute diarrhea. This population is different from a population consisting of diarrhea of any severity. We recommend the title be modified to better reflect the population studied: Molecular prevalence of three intestinal protozoa in young children hospitalized for acute diarrhea in rural Sudan. If this is a population of children with moderate-to-severe diarrhea (was there any tool to assess diarrhea severity other than hospitalization?), then the discussion should address and cite other studies specific to this acutely ill population. 

General:

Spelling and grammar need to be reviewed throughout. For example, "lambelia" and Entameobia are wrong. For example, in the results section, should 'the comparisons between these variables were not relevant' read 'the comparisons...were not statistically significant'? It is not accurate to claim a comparison is irrelevant. Please clarify, or change all references to specific Cryptosporidium species to Cryptosporidium spp. (or show specific sequencing results that were used to determine the specific species). 

Abstract:

Please provide consistent reporting in the results section. The N (%) notation as in the first sentence should be reported for all. 

Methods:

Please include validation methods for the triple-plex PCR (eg. were there positive controls)? Is there conventional diagnostic data to accompany the PCR results? How did the team decide to dilute all fecal specimens into 10% saline? Was anything done to normalize the amount of fecal material at baseline (some diarrheal samples may already me more 'dilute' than others). QIAmp DNA stool extraction kits may be suboptimal for DNA extraction. Were any steps taken to enrich DNA from parasite (oo)cysts (for example, freeze-thaw and/or bead beating)?

For improved clarity, please organize with the following additional sections:  Ethical consideration

Study area and participants

Sample collection and storage

Nucleic acid extraction ( already present)

PCR amplification and parasite detection ( already present). 

Statistical analysis (this is currently missing entirely)

Results:

Please provide a table with the demographics data for all variables recorded from the questionnaire.  As in the abstract, please include N (%) notations for all reported results for consistency. Please apply consistent use of a) gender-specific terms (male and female rather than flipping to 'boys and girls'), b) seasonality (hot-dry vs rainy rather than flipping to summer vs autumn in the discussion). The PCR reported does not appear to be specific for Cryptosporidium parvum (as claimed in the abstract). Please clarify what "1" and "2" mean in the source data and why some columns are incomplete and why some text is red and other text is black.

Discussion: 

Please expand on the importance of the finding of M vs F differences in G lamblia positivity, and in context with other published literature. Only one citation is used here, and little is articulated about the statement of "Kwam H." Important questions here would relate to exposure risks versus some other reason why male and female children would have different susceptibilities to infection. Please clarify this statement: "due to noninfectious reasons like hypersensitivity to certain food ingredients and weaning diarrhea that result of the inability of an underdeveloped child intestine to metabolize the food". What are the clinical/treatment implications of finding 35% prevalence of these 3 protozoa in children hospitalized in rural Sudan?

Is the work clearly and accurately presented and does it cite the current literature?

Partly

If applicable, is the statistical analysis and its interpretation appropriate?

No

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Infectious diseases, intestinal protozoa epidemiology and pathogenesis, malnutrition, microbiota

We confirm that we have read this submission and believe that we have an appropriate level of expertise to state that we do not consider it to be of an acceptable scientific standard, for reasons outlined above.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: I disclose that no competing interests might be construed to influence your judgment of the article's or peer review report's validity or importance.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: I disclose there are no types of competing interests

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: Funding from the NIH, Authorships with UpToDate and Elsevier.
==== Refs
References

1 WHO : Diarrhoeal disease: key facts. May 2,2017.
2 Troeger C Blacker B Khalil I : Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016. Lancet Infect. Dis. 2018;18 (11 ):1211–1228. 10.1016/S1473-3099(18)30362-1 30243583
3 Reiner R Wiens K Deshpande A : Mapping geographical inequalities in childhood diarrhoeal morbidity and mortality in low-income and middle-income countries, 2000–17: analysis for the Global Burden of Disease Study 2017. Lancet. 2020;395 (10239 ):1779–1801. 10.1016/S0140-6736(20)30114-8 32513411
4 Roth G Abate D Abate K : Global, regional, and national age-sex-specific mortality for 282 causes of death in 195 countries and territories, 1980–2017: a systematic analysis for the Global Burden of Disease Study 2017. Lancet. 2018;392 (10159 ):1736–1788. 10.1016/S0140-6736(18)32203-7 30496103
5 Dadonaite B Spooner F Ritchi H : “Diarrheal diseases”. Published online at OurWorldInData.org;2018. https://ourworldindata.org/diarrheal-diseases
6 Vargas M Gascon J Casals C : Etiology of diarrhea in children less than five years of age in Ifakara, Tanzania. Am. J. Trop. Med. Hyg. 2004;70 (5 ):536–539. 10.4269/ajtmh.2004.70.536 15155987
7 Khalil I Colombara D Forouzanfar M : Burden of Diarrhea in the Eastern Mediterranean Region, 1990 2013: Findings from the Global Burden of Disease Study 2013. Am. J. Trop. Med. Hyg. 2016;6 (95 ):1319–1132.
8 A Quin: Diarrhea likelihood in Ghanaian children: A Study of the Association between Diarrhea and Water and Sanitation Infrastructure. Master thesis of Public Policy in the Georgetown Institute. 2009: p.74.
9 Michael HMM Cleveland C : Water pollution. National Council for Science and the Environment: Encyclopedia of Earth;2010.
10 Organization WH : The world health report 2005—Make every mother and child count. Geneva, Switzerland: WHO Press;2013.
11 Verweij JJ Blange RA Templeton K : Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J. Clin. Microbiol. 2004;42 (3 ):1220–1223. 10.1128/JCM.42.3.1220-1223.2004 15004079
12 Khwam H Hayat D Abdul M : Parasitic infections causing diarrhoea among children less than six years at Al-Nasiriya province. J. Uni. Thi-Qar. 2016;4 (11 ):134–142.
13 Gupta1 DA: Study of the Prevalence of diarrhea in children under the age of five years: its association with wasting. Indian J. Sci. Res. 2014;7 (1 ):1315–1318.
14 Sherchand B Yokoo M Sherchand O : Burden of Enteropathogens Associated Diarrheal Diseases in Children Hospital, Nepal. Scientific World. 7 (7 ):71–75. 10.3126/sw.v7i7.3830
15 Shamshul A Keshab P Bharat Mani P : Pattern of Acute Parasitic Diarrhea in Children Under Five Years of Age in Kathmandu, Nepal. Open J. Med. Microbiol. 2012;02 :95–100. 10.4236/ojmm.2012.23014
16 Saeed A Abd H Sandstrom G : Microbial etiology of acute diarrhea in children under five years of age in Khartoum. Sudan. J. Med. Microbil. 2015;64 (4 ):432–437. 10.1099/jmm.0.000043 25713206
17 Firdu T Abunna F Girma M : Intestinal Protozoal Parasites in Diarrheal Children and Associated Risk Factors at Yirgalem Hospital, Ethiopia: A Case-Control Study. Int. Sch. Res. Notices. 2014;2014 : 357126. 10.1155/2014/357126
18 Ngosso BEN : G.2 Namkinga L.A.1: Identification of Pathogenic Intestinal Parasitic Protozoa Associated with Diarrhea among Under-fives Children in Dar Es Salaam, Tanzania. Int. J. Med. Med. Sci. 2015;2 (4 ):49–55.
19 Samie A Guerrant RL Barrett L : Prevalence of intestinal parasitic and bacterial pathogens in diarrhoeal and non-diarrhoeal human stools from Vhembe district, South Africa. J. Health Popul. Nutr. 2009;27 (6 ):739–745. 20099757
20 Mezeid N Shaldoum F Al-Hindi AI : Prevalence of intestinal parasites among the population of the Gaza Strip, Palestine. Ann. Parasitol. 2014;60 (4 ):281–289. 25706427
21 C.M.U1 A, OAN, CUN. : Etiology of Acute Diarrhoea Among Children In Owerri, Imo State Nigeria. App. Sci. Report. 2015;10 (3 ):128.
22 Saikruang W Khamrin P Suantai B : detection of diarrheal viruses circulating in adult patients in Thailand. Arch. Virol. 2014;159 (12 ):3371–3375. 10.1007/s00705-014-2191-3 25078389
23 Adam M Du H Enan KA : Molecular survey of certain protozoan agents that cause diarrhea in children in Sudan. figshare. 2022. 10.6084/m9.figshare.21201676.v3
