
==== Front
J Toxicol
J Toxicol
jt
Journal of Toxicology
1687-8191
1687-8205
Wiley

10.1155/2024/5261994
Research Article
In Vivo Exposure of Deltamethrin Dysregulates the NFAT Signalling Pathway and Induces Lung Damage
https://orcid.org/0009-0003-5033-1115
Sharma Prakriti prakriti.sh10@gmail.com

https://orcid.org/0000-0003-0416-8946
Sethi R. S.
Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India
Academic Editor: Brad Upham

2024
29 8 2024
2024 526199419 2 2024
23 7 2024
10 8 2024
Copyright © 2024 Prakriti Sharma and R. S. Sethi.
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Deltamethrin is an insecticide used to control harmful agricultural insects that otherwise damage crops and to control vector-borne diseases. Long-term exposure to deltamethrin results in the inflammation of the lungs. The present study elucidates the molecular mechanism underlying the deltamethrin-induced lung damage. The lung samples were extracted from the Swiss albino mice following the treatment of low (2.5 mg/kg) and high (5 mg/kg) doses of deltamethrin. The mRNA expression of TCR, IL-4, and IL-13 showed upregulation, while the expression of NFAT and FOS was downregulated following a low dose of deltamethrin. Moreover, the expression of TCR was downregulated with the exposure of a high dose of deltamethrin. Furthermore, the immunohistochemistry data confirmed the pattern of protein expression for TCR, FOS, IL-4, and IL-13 following a low dose of deltamethrin exposure. However, no change was seen in the TCR, NFAT, FOS, JUN, IL-4, and IL-13 immunopositive cells of the high-dose treatment group. Also, ELISA results showed increased expression of IL-13 in the BAL fluid of animals exposed to low doses of deltamethrin. Overall, the present study showed that deltamethrin exposure induces lung damage and immune dysregulation via dysregulating the NFAT signalling pathway.

Guru Angad Dev Veterinary and Animal Sciences University
==== Body
pmc1. Introduction

Several pesticides and fertilizers are being used by the farmers to increase productivity as well as to upgrade their economic condition. Pesticides are the chemicals that are mainly used in agriculture or in public health protection programs to protect plants from pests and humans from vector-borne diseases such as malaria, dengue fever, and schistosomiasis [1]. Among different insecticides, pyrethroids are commonly used around the home and in agricultural production to control insects [2]. Pyrethroids are synthetic insecticides derived from natural insecticides pyrethrins of the composite family. These are of two types according to the presence of the alpha-cyano group: type I and type II. Natural pyrethroids are not toxic to mammals; however, synthetically prepared pyrethroids are toxic to mammals [3].

Deltamethrin is frequently used as type II pyrethroid as compared to other pesticides and works even in low concentrations [4]. Pyrethroids change the nerve function of insects by increasing the sodium permeability through acting on voltage-gated sodium channels which results in the destruction of the nervous system [5, 6]. Pyrethroid poisoning results in paralysis and death [7].

Absorption of deltamethrin occurs rapidly through the oral route than the skin [8]. Deltamethrin is readily absorbed from the gastrointestinal tract after oral administration in rats and mice and rapidly metabolized by tissue esterases and liver microsomal oxidases [9]. Studies showed that metabolites of deltamethrin are more toxic than the parent compound deltamethrin. The authors in [10, 11] found that male Wistar rats exposed to deltamethrin for 45 days developed lung inflammation with the increase in macrophages gathering and reactive oxygen species (ROS) concentration.

The nuclear factor of activated T-cells' (NFATs) signalling pathway is responsible for the expression of interferon gamma (IFN-γ), interleukin 4 (IL-4), IL-17, and tumor necrosis factor (TNF) in T helper (Th) 1, Th2, and Th17 cells [12] and also controls the morphological maturation of lungs [13]. Pesticide exposure leads to Th2 cell expression related to asthma and allergy [14]. Exposure to deltamethrin causes multiorgan toxicity as well as toxicity to the immune system. Deltamethrin is an immune dysregulator as it has a strong affinity for cluster of differentiation (CD) 4 and CD8 receptors [15]. Deltamethrin exposures decrease splenic T-cell and B-cell populations and suppress cytokines such as IFN-γ, IL-2, and IL-4 [16]. Deltamethrin induces brain-derived neurotrophic factor (BDNF) expression by elevating calcium+2 (Ca+2) influx in neurons and by phosphorylating extracellular signal-regulated kinases that affect neuronal activity in culture and in the rat brain, indicating the possibility of neuronal hyperexcitation if deltamethrin enters the brain [17]. In quail, deltamethrin impacts antioxidant defense which results in cerebrum injury by downregulating nuclear factor erythroid-2-related factor 2 (Nrf2). Deltamethrin exposure also downregulates B-cell lymphoma gene 2 (Bcl-2) level and elevates Jun N-terminal kinase-3, caspase-3, and Bcl-2-associated X expression along with the upregulation of toll-like receptor 4 (TLR4) following inflammation-associated genes inducing inflammation and apoptosis by inhibiting the Nrf2/TLR4 signalling pathway [18]. Moreover, deltamethrin exposure in quails dysregulates Nrf2/TGF-β1/SMAD3 pathway and results in liver fibrosis through Nrf2 expression inhibition, inflammation and apoptosis mediated oxidative stress [19].

T-cell receptor (TCR) plays an important role in generating an immune response against disease caused by organisms, cancer cells, and altered self- antigens. It recognizes and binds to the specific protein antigen fragments presented by major histocompatibility complex (MHC) that appeared on the antigen-presenting cells' (APCs) surface further resulting in the intracellular signal activation and triggering an immune response [20]. TCR performs both antigen identification and signal transduction. TCR cohesion is critical for the production of optimal and coordinated immune responses [21].

Pesticide exposures result in the death of immature T-cells [22] and suppress T-cell- and B-cell-facilitated immune response [23] that lead to immune dysregulation [24]. Pesticide exposure reduces cell proliferation and induces apoptosis as well as the activity of cytotoxic T-lymphocytes (CTLs) [25]. A study by the authors in [16] on the deltamethrin-mediated humoral and cell-mediated immunotoxicity showed that exposure to deltamethrin inhibits the expression of cytokines and therefore modifies the functioning of the immune system. A study of differential genes in deltamethrin-exposed zebrafish showed that dysregulation of genes results in cell signalling pathways and nervous system imbalance [26]. Furthermore, an immunotoxin study of deltamethrin in fish showed a decline in lymphocytes and an increase in neutrophil number. Key components (complement (C3), antibodies, and lysozymes) of the immune were decreased, while the enzyme activity of alkaline phosphatase (ALP) was increased along with the dysregulation of TLR signalling genes resulting in suppression of the immune system [27].

Recent studies revealed that NFAT regulates sepsis-induced lung injury via endothelial cell inflammation mediating the development of lung injury [28–30]. Upon T-cell activation, NFAT (transcription factor) present in the cytoplasm gets dephosphorylated and imported to the nucleus where it binds to the promoter resulting in the expression of responsive genes. NFAT plays an important role in the T-cell and B-cell functioning [31]. Out of all 5 members of the NFAT family, NFATc1 plays an important role in the T-lymphocyte development and differentiation of Th2 response and production of its specific cytokines, i.e., IL-4, IL-5, and IL-13. This results in stimulation of IgE production, mucosal mastocytosis, and eosinophils, which are the main cause of lung inflammation [32, 33]. Transcription-factor NFATc1 is important for the differentiation and development of T-cells, cardiac valves, and osteoclasts [34]. Mutation in NFATc1 results in a decrease in T-cells and also a flaw in cardiac growth [35].

cJUN and cFOS are proto-oncogenes [36] form homodimer (cJUN-cJUN and cFOS-cFOS) or heterodimer (cFOS – cJUN) by binding through basic Leucine zipper (bZIP) ([37] and form complex having different DNA binding capacities known as transcriptional factor activator protein 1 (AP-1) [38]. AP-1 cooperates with NFAT for the expression of cytokines and chemokines required for the regulation and functioning of the immune system [39].

IL-4 is an anti as well as anti-inflammatory cytokine [40] that plays a key role in cellular inflammation responsible for the migration of T-lymphocytes, monocytes, basophils, and eosinophils to inflammatory loci by interacting with vascular cell adhesion molecule-1 (VCAM-1) in asthmatic lungs. IL-4 induces an allergic immune response by inhibiting the T-cell apoptosis through the downregulation of Fas expression on the cell which by binding to the Fas ligand induces apoptosis [41]. Pesticide exposure results in various allergic diseases marked by CD4+ T-lymphocytes-mediated type 2 inflammation [42]. Rats exposed to carbyl showed repressed lymphocyte proliferation with the Th1/Th2 imbalance. It decreases the expression of Th1 cytokines (IL-2, IFN-γ, IL-1, and TNF-α), while the expression of Th2 cytokines (IL-4 and IL-10) is increased which may result in the carbyl-induced allergic, autoimmune, tumor, and infectious disease development [43]. IL-13 is secreted by Th2 cells. The authors in [44, 45] reported that IL-13 overexpression in the lungs induces increased production of mucus, goblet cell hyperplasia, eosinophilic tissue inflammation, fibrosis in the airway, crystal deposition, eotaxin production, atopic diseases, and asthma.

Previous studies show that chronic exposure to various pesticides through the oral route even affects the nontargeted organs such as the lungs and alters the pulmonary transcripts [46–58]. Recently, we reported the dysregulation of the planar cell polarity (PCP) pathway [59], apoptosis pathway [60], Wnt signalling pathway [61], and small lung cancer pathway [62] in mice lung following exposures to fipronil, chlorpyrifos, cypermethrin and 2,4-dichlorophenoxyacetic acid (2, 4-D). Carp exposed to chlorpyrifos results in TCR dysfunctioning with the development of tissue inflammation and oxidative stress [63].

Earlier research has shown that oral exposure to deltamethrin causes lung inflammation and affects the immune system by impairment of proinflammatory cytokines in the Swiss albino mice [64]. TCR plays an important role in the activation of T-cells. For the adaptive immune system against the various encountered antigen there is diversity in the T-cell population [65, 66]. In the current study, the role of TCR, NFAT, FOS, JUN, IL-4, and IL-13 in immune-dysregulation-mediated lung damage was studied by transcriptomic and translational analyses of the lung sections following low and high doses of deltamethrin.

Deltamethrin exposure results in lung damage but the molecular mechanism for deltamethrin-induced lung damage is unknown. Therefore, we hypothesized that deltamethrin induced lung damage by dysregulating the immune system and the NFAT signalling pathway plays an important role in T-cell proliferation [34]. So, we selected the genes (TCR, NFAT, FOS, JUN, IL-4, and IL-13) of the NFAT signalling pathway to study the role of the immune system in the deltamethrin-induced pulmonary damage and we present the maiden data on the NFAT signalling pathway and gene expression in the lungs of mice following exposure to deltamethrin.

2. Materials and Methods

2.1. Molecular Docking

The docking was performed by using the SwissDock tool [67]. The native ligand for protein structures was deltamethrin whose structure was available in the Zinc database [68]. The proteins selected for the docking were TCR (1TCR) and FOS (2WT7) whose structures were retrieved from the Protein Data Bank (PDB) [69]. Furthermore, the energy minimization of the PDB protein structures was performed by using the online tool ModRefiner [70]. The 2D structure of protein-ligand interaction was analysed using the chimera tool [71]. After docking analysis, further study has been performed to investigate the transcription and quantification of genes of the NFAT signalling pathway in lungs following the exposure to low and high doses of deltamethrin.

2.2. Chemicals

Deltamethrin ((s)-α-cyano-3-phenoxybenzyl-cis-(lR)-cis-3-(2,2- dibromovinyl)-2,2-dimethylcyclopropanecarboxylate) PESTANAL® (catalogue no. 45423) purity 98.6% and corn oil (catalogue no. C8267) were obtained from Sigma Aldrich, Bangalore. cDNA kit (catalogue no. 205313) and the reverse transcription kit were the QuantiTect®Reverse Transcription kit. Antibody: primary antibodies were raised in rabbits viz. TCR β (catalogue no. 5651-30T) from BioVision. NFAT2 (catalogue no. ITT0446), cFOS (catalogue no. ITT00132), cJUN (catalogue no. ITT06090), IL-4 (catalogue no. ITT05142), and IL-13 (catalogue no. ITT06813) were purchased from Immunotag, and secondary antibody (anti-rabbit) from SIGMA. The DAB substrate kit (catalogue no. SK4100) was from the Vector Lab.

2.3. Experimental Animals

The experiments were carried out at Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana as per guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA) with reference number: GADVASU/2020/IAEC/56/06. Swiss albino healthy male mice (n = 18) aged 6–8 weeks were purchased from the Paradise Rabbit Farm, Kurukshetra, Haryana. Before treatment, mice were kept for a week in the experimental facility for adaptation. Mice were kept under controlled conditions with 12 h light and dark cycles in polypropylene cages at institutional small animal houses. Mice were fed synthetic pelleted mice feed obtained from Rodent Research India Pvt. Ltd., Jind, Haryana.

2.4. Experimental Design

Animals were weighed before treatment and then randomly divided into three groups, one control group served as negative control and received solvent (corn oil) and two treatment groups received 1/20th LD50, i.e., 2.5 mg/kg body weight (low dose) dose and 1/10th LD50, i.e., 5 mg/kg body weight (high dose) of deltamethrin dissolved in corn oil orally for 90 days. LD50 of deltamethrin is 50 mg/kg body weight [72]. Immediately on 91 days of trial, each group was anaesthetized with 1/10th of the actual dose of xylazine and ketamine combination [62] and sacrificed for sample collection.

2.5. Body Weight

The body weights of all the mice groups were measured on 0th day, 45th day, and 90th day.

2.6. Sample Collection

Blood was collected by cardiac puncture for serum isolation and bronchioalveolar lavage (BAL) fluid was collected from the left lung. Both serum and BAL fluid samples were stored at −80°C for further analysis. The right lung is chopped into small sections and kept at −80°C in RNA solution till further use. The left lung was fixed in the 4% paraformaldehyde and stored at 4°C for 12 hours prior to immunohistochemical analysis.

2.7. Quantitative Real-Time PCR

The total RNA was extracted from the lung samples by using the TRIzol method (Ambion, Life Technologies, USA). After that, the quality and quantity of RNA were checked using an ultraviolet light nanodrop spectrophotometer (Thermo, USA), which was further used for a cDNA synthesis using a cDNA synthesis kit (QIAGEN) according to the given protocol in the kit. The concentration of RNA used for cDNA synthesis was 1000 ng/μl. For real-time PCR, already published primers were used (Table 1). Then, the fold change was calculated using the ∆∆CT method [80].

2.8. Immunohistochemistry

Immunohistochemistry was performed to check the protein expression of TCRβ, NFATc1, FOS, JUN, IL-4, and IL-13 in the lung. Paraffin blocks were prepared to get 5 μm thick sections. The protocol for immunohistochemistry was described previously [81]. In brief, the procedure is as follows. The tissue sections were deparaffinized in xylene followed with the rehydration by using gradient ethanol. Tissue sections were incubated with 3% H2O2 in the dark chamber to inhibit the cell's own peroxidase and proceeded with the boiling in Tris EDTA and 1X PBS for antigen retrieval. Then, the slides were incubated with 1% BSA in the dark chamber for 1 hour followed by incubation of slides at 4°C with primary anti-TCR, NFATc1, cFOS, JUN, IL-4, and IL-13 antibodies raised in rabbit for overnight. On the next day, after washing with 1X PBS, slides were incubated with secondary HRP-tagged anti-rabbit antibody for half an hour in the dark chamber. The immunopositive reaction was observed with the color development step using chromogen (Vector laboratories, cat no. SK-4100) followed by counterstaining with hematoxylin which specifically stained the nuclei of the cell. IHC control was stained without primary or secondary antibodies or both.

2.9. Immunopositive Scoring for Immunohistochemistry

Immunohistochemical-stained slides were used for the quantification of TCR, NFAT, JUN, FOS, IL-4, and IL-13 immunopositive cells. To ensure the regularity mentioned previously, the cells were physically counted using the microscope's 40x objective lens in 10 fields/slide. Immunopositive cells from six animals per group were calculated. Furthermore, the cells were compared between the control and treatment groups [59].

2.10. ELISA

The comparison for the presence of AP-1, IL-4, and IL-13 in the serum and BAL fluid samples after the long-term exposure of deltamethrin by using sandwich Enzyme Linked Immunosorbent Assay (ELISA) was performed according to the manufacturer's protocol. Furthermore, the absorbance of the samples was recorded and used to calculate the concentration of the target protein and further compared between the control and treatment samples.

2.11. Statistical Analysis

One-way ANOVA (one-way analysis of variance) was performed to find the statistical difference (p < 0.05) for the immunopositive scoring and fold change (mRNA expression) between the groups following exposure to low and high doses of deltamethrin by using GraphPad Prism 8 software.

3. Results

3.1. Protein and Ligand Interaction

The primary molecular docking analysis was performed using the SwissDock online server and further analysis was performed with the Discovery Studio tool [82] to identify the interactions between the target proteins and the deltamethrin ligand.

Van der Waals contacts were seen at the following residues for the TCR (T-cell receptor) following molecular docking with deltamethrin: PRO 231, LYS 231, THR 234, LEU 219, GLY 21, HIS 217, ILE 237, VAL 157, ASN 236, GLY 151, PHE 153, and ARG 150. Furthermore, at the PRO 230 residue, an alkyl interaction was observed (Figure 1(a)). 37 clusters in total were found by docking analysis with binding free energy (ΔG) of −8.76253 kcal/mol at the first cluster rank (Table 2).

ARG 158, THR 162, LEU 161, GLN 166, and LEU 165 amino acid positions were the sites of molecular interactions revealed by the SwissDock analysis of the cFOS protein and deltamethrin ligand with an estimated binding free energy (ΔG) of −6.6688457 kcal/mol (Figure 1(b)). A total of 31 clusters were found by the docking analysis for deltamethrin and cFOS (Table 2).

The structural analysis provided evidence for the presence of molecular interactions between the target protein molecules and respective deltamethrin ligand molecules. The significance of the interacting amino acid residues in the molecular recognition process is shown by the way in which these interactions together influence deltamethrin's binding affinity and specificity for the TCR and cFOS proteins which provide light on functional implications of the deltamethrin binding with these protein molecules.

3.2. Body Weight

The body weight of the animal was decreased following the high dose of deltamethrin, while there was no change in the weight of the control group animal and animals treated with a low dose of deltamethrin (Figure 2).

3.3. mRNA Expression of Genes of the NFAT Signalling Pathway

The pulmonary mRNA expression of TCR, IL-4, and IL-13 was significantly increased by 2.8 (p < 0.05), 1.48, and 1.25 folds (p < 0.05) following a low dose of deltamethrin as compared to the control. However, high-dose treatment decreases the expression of TCR by −1.2. The expression of NFAT and FOS was also downregulated by −1.49 and −1.6 folds following a low dose of deltamethrin (Figure 3).

3.4. Protein Expression of the Genes of the NFAT Signalling Pathway

The protein expression of TCR, NFAT, FOS, JUN, IL-4, and IL-13 was analysed and quantified by immunohistochemistry. A low dose of deltamethrin exposure showed strong TCR immunopositive reaction in the airway epithelial (Figure 4(a), G, H, I) and IL-4 (Figure 4(e), G-I) and IL-13 (Figure 4(f), G, H, I) immunopositive reaction in the alveolar epithelium, septal cells and macrophages along with the significant increase in the number of TCR, IL-4 and IL-13 immunopositive cells as compared to the control group (Figure 5). Furthermore, the NFAT (Figure 4(b), G, H, I) and FOS (Figure 4(c) G, H, I) immunopositive cells also showed a strong immunopositive reaction in alveolar epithelial cells, septal cells, and macrophages but the immunopositive scoring of the FOS and NFAT immunopositive cells showed significant decreases only in the FOS immunopositive cells as compared to the control following a low dose of deltamethrin. Moreover, low dose as well as high dose of deltamethrin exposure showed strong JUN immunopositive reaction in the airway epithelial, septal cells, and macrophages (Figure 4(d), D, E, F, G, H, I, J, K, L). But there was no change in the JUN immunopositive cells in both dosage groups (Figure 5). However, the high-dose treatment group showed no change in the TCR, NFAT, FOS, JUN, IL-4, and IL-13 immunopositive cells (Figure 5).

3.5. ELISA

The ELISA was employed to contrast the AP-1, IL-4, and IL-13 concentrations in the serum and BAL fluid of the control and treated mice. There was no difference in the concentration of AP-1 and IL-4 in both sera as well as in the BAL fluid samples between the control and deltamethrin-treated mice (Figure 6). However, an increase in the concentration of IL-13 was observed in the BAL fluid samples of the low-dose deltamethrin-treated mice (Figure 6) but no change in the concentration of IL-13 was observed in the serum following low- and high-dose treatment of deltamethrin (Figure 6).

4. Discussion

Deltamethrin exposure stimulates the formation of extracellular traps by elevating the levels of myeloperoxidase (MPO) and reactive oxygen species (ROS) along with mitochondrial dysfunctioning leading to immunotoxicity in Manila clam (Ruditapes philippinarum) hemocytes [83]. Acute exposure to deltamethrin induces ROS production which results in DNA damage, immune and neurotoxicity in the DM induces DNA damage, immunotoxicity, and neurotoxicity into brown trout brain tissue [84]. Deltamethrin treatment in male albino rats decreases various blood cells and antioxidant enzymes in different tissues of rats along with uric acid levels and increases transaminase and lactate dehydrogenase enzyme activity in serum, along with the extent of liver, kidney, and brain thiobarbituric acid reactive substances. Also, the level of systemic inflammatory and systemic immune-inflammatory markers was increased and the histological lesion was observed in the liver, kidney, and brain drawing attention to the possible negative effects of deltamethrin [85, 86] found that deltamethrin induces cardiotoxicity and hepatotoxicity by a complex mechanism. It was initially discovered that the NFAT regulated the transcription of activated T-cells [87].

NFAT signalling pathway is regulated by the intracellular concentration of Ca2+ coupled with TCR activation [88]. Our results showed that a low dose of deltamethrin upregulated the expression of TCR, while a high dose of deltamethrin decreases the mRNA expression of TCR (Figure 1). A high number of TCRs results in the activation of T-cells and makes T-cells more sensitive toward the antigen. T-cells with less number of TCRs fail to activate because less number of TCRs means insufficient signals for activation of the antigen, but T-cells expressing a high number of TCRs result in the activation of T-cells and make T-cells more sensitive toward the antigen [89]. A constitutive TCR expression decreases TCR efficiency [43] and decreased TCR efficiency favored Th2 differentiation and IL4 expression [90]. TCR is required for T-cell activation but a downregulation in the components of the TCR complex inhibits T-cell activation [91]. TCR downregulation may be for the protection of cells from excessive T-cell activation [92]. Downregulation and defects in TCR signalling are associated with dysfunctioning and hyporesponsiveness in T-cells suggesting immune modulations [93].

NFAT plays an important role in the differentiation and development of T-cells [34, 94] and induces the expression of cytokines such as IL-4, IL-5, and IL-13 upon TCR stimulation [95]. The NFAT transcription factor is an oncogene [96]. A low dose of deltamethrin downregulated the NFAT as well as FOS expression (Figure 1) which may suggest that there may be alternative NFAT-activation pathways mediated by some other pathways such as IL-7 as IL-7-dependent activation of JAK3 led to tyrosine phosphorylation and activation of NFATc1 [97]. Adrenal corticosteroids are used to decrease the expression of cFOS during asthma which is desired to overcome lung inflammation [98]. In the present study, a decrease in the mRNA expression of FOS suggests that there will be a limited formation of the AP-1 complex which will dysregulate the NFAT signalling pathway. A decrease in the JUN/AP-1 expression alters the target cytokines (IL-4, IL-5, and GM-CSF) expression by the posttranscriptional and translational modifications [99]. Taken together, data suggest dysregulation of the NFAT signalling pathway following exposure to a low dose of deltamethrin. Also, a decrease in the expression of NFATc1 and FOS might be a compensatory mechanism for the cytokine expression and inflammatory response during low doses of deltamethrin-induced lung damage.

IL-4 acts as an anti-inflammatory as well as proinflammatory cytokine [40] which plays an important role in the production of Th2-specific cytokines (IL-4, IL-5, and IL-13) by the differentiation of CD4+ T-cells/Th cells to Th2 cells [100]. In the current study, IL-4 expression was upregulated following exposure to a low dose of deltamethrin (Figures 1 and 4(e)). IL-4 upregulation induces lung inflammation characterized by BAL fluid eosinophilia, airway hyperresponsiveness (AHR), and an increase in the number of goblet cells in mouse lungs [101]. The data suggest that IL-4 upregulation might be a protective mechanism during deltamethrin-induced damage.

A study with environmental pesticides on pregnant women showed that upregulation of IL-13 is associated with tissue repair [102]. Moreover, the expression of IL-13 was also upregulated following low dose of deltamethrin (Figures 1 and 4(f)) that might result in the normalization of damage lung due to enhanced activity of tissue repair enzyme, while the high dose did not alter the expression of IL-13 which may suggest the suppression of tissue repair process following exposure to high dose. IL-13 is a hallmark of the pulmonary allergic diseases and is a crucial factor for the allergen-mediated Th2 immune response that results in the various proinflammatory conditions [103]. Overexpression of IL-13 in the lungs elevates the production of mucus, goblet cell hyperplasia, eosinophilic tissue inflammation, fibrosis in the airway, crystal deposition, eotaxin production, atopic diseases, and asthma [44, 45]. The abovementioned study suggested that a low dose of deltamethrin dysregulates the expression of genes to overcome and cure the deltamethrin-induced lung damage but a high dose shuts down the pathway and there was no responsive or repair mechanism to overcome the lung inflammation. Also, it was seen with the animal's body weight which showed that with the high dose, the body weight of the animal decreased. However, with the treatment of low doses, there was no change in body weight.

5. Conclusion

The abovementioned study showed that chronic exposure to a low (2.5 mg/kg) dose of deltamethrin altered TCR, NFATc1, FOS, IL-4, and IL-13 expression results in the dysregulation of the NFAT signalling pathway. Along with this, an increase in the IL-13 concentration was observed in the low-dose-treated mice BAL fluid samples. However, a high dose (5 mg/kg) of deltamethrin did not alter the expression of genes. The mice' body weight decreases with high-dose treatment, which may suggest that at the high dose of deltamethrin, repair mechanism of the animal did not work to cure damage resulting in lung inflammation. The immune dysregulation at low-dose and high-dose treatment might be the reason behind lung inflammation. Furthermore, this can be studied in the targeted organs such as the liver and kidney. Also, a knockout study can be performed to study the correlation between the NFAT signalling pathway and lung damage.

Acknowledgments

The funding and resources for the research was provided by Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab, India.

Data Availability

The data used to support the findings of this study are included within the article. There is no additional source of data.

Ethical Approval

The study and experiment protocols were approved by the Institutional Animal Ethics Committee of the University (GADVASU/2020/IAEC/56/06).

Conflicts of Interest

The authors declare that they have no conflicts of interest with respect to the research, authorship, and/or publication of this article.

Authors' Contributions

Prakriti Sharma executed the experiments. RS Sethi conceptualized and reviewed the study and edited the manuscript. All authors have read and agreed to the published version of the manuscript.

Figure 1 Molecular docking analysis to identify the interactions between the target proteins and the deltamethrin ligand: (a) molecular docking showing molecular interactions between deltamethrin and TCR and (b) molecular docking analysis showing the interaction between cFOS and deltamethrin using SwissDock tool.

Figure 2 Body weight (grams) of mice following exposure to low (2.5 mg/kg) and high doses (5 mg/kg) of deltamethrin (n = 6) (mean ± SD). SD: standard deviation.

Figure 3 Relative mRNA expression of TCR, NFAT, FOS, JUN, IL-4, and IL-13 following the exposure to low (2.5 mg/kg) and high doses (5 mg/kg) of deltamethrin. ∗p < 0.05 (significant), ∗∗p < 0.01 (moderately significant), and ∗∗∗∗p < 0.0001 (highly significant). p value: probability value.

Figure 4 Lung sections stained with (a) TCR, (b) NFAT, (c) FOS, (d) JUN, (e) IL-4, and (f) IL-13 primary antibodies. Sections without primary antibodies (A, B, C) resulted in no color development. Immunopositive cells in airway epithelium (pentagon), alveolar epithelium (star), alveolar septal cells (arrow), and macrophages (double) in the control group (D, E, F) and low-dose (2.5 mg/kg) (G, H, I) and high-dose (5 mg/kg) (J, K, L) groups. Original magnification A, D, G, J: 10x; B, E, H, K: 40x; C, F, I, L: 100x.

Figure 5 Immunopositive scoring of TCR, NFAT, FOS, JUN, IL-4, and IL-13 (mean ± SD) for immunohistochemical-stained lung tissue sections in control and treatment groups. ∗∗p < 0.01 (moderately significant) and ∗∗∗∗p < 0.0001 (highly significant). p value: probability value; SD: standard deviation.

Figure 6 AP-1, IL-4, and IL-13 concentrations in serum and bronchial lavage fluid (BAL) (mean ± SD) of mice following exposure to low (2.5 mg/kg) and high doses (5 mg/kg) of deltamethrin. SD: standard deviation.

Table 1 Primer sequences used in real-time PCR analysis.

Name	Primer sequence	Reference	
TCRβ	F: GAGACGGCTGTTTTCCAGAC
R: GGCCCAGAGTTTGCTTACAA	[73]	
	
NFATc1	F: GTGGCAGCCATCAACGCCCT
R: TACGAGGCCTGTGGCACCGA	[74]	
	
cFOS	F: ACCATGATGTTCTCGGGTTTCAA
R: GCTGGTGGAGATGGCTGTCAC	[75]	
	
JUN	F: ACTCGGACCTTCTCACGTCG
R: TAGACCGGAGGCTCACTGTG	[76]	
	
IL-4	F: CCAGCTAGTTGTCATCCTGCTCTTCTTTCTCG
R: CAGTGATGTGGACTTGGACTCATTCATGGTGC	[77]	
	
IL-13	F: TGAGCAACATCACACAAGACC
R: AGGCCATGCAATATCCTCTG	[78]	
	
β-actin (mouse)	F: CTGTCCCTGTATGCCTCTG
R: ATGTCACGCACGATTTCC	[79]	

Table 2 Binding energy and full-fitness value of the docked complex.

 	Number of SwissDock cluster	Full fitness (kcal mol) (−)	Estimated δG (kcal mol) (−)	Cluster rank	
TCR	37	1859.4634	8.76253	1	0	
1858.1428	8.670424	1	1	
1854.614	8.506084	1	2	
1850.9839	8.171686	1	3	
1849.8317	8.743343	1	4	
1849.752	8.736348	1	5	
1849.5947	8.714316	1	6	
1848.4362	8.760416	1	7	
	
cFOS	31	756.971	6.6688457	0	0	
756.971	6.6688457	0	1	
756.956	6.668018	0	2	
756.956	6.668018	0	3	
756.8105	6.6408553	0	4	
756.8105	6.6408553	0	5	
756.8105	6.6408553	0	6	
756.8105	6.6408553	0	7
==== Refs
1 Nicolopoulou-Stamati P. Maipas S. Kotampasi C. Stamatis P. Hens L. Chemical pesticides and human health: the urgent need for a new concept in agriculture Frontiers in Public Health 2016 4 p. 148 10.3389/fpubh.2016.00148
2 Burns C. J. Pastoor T. P. Pyrethroid epidemiology: a quality-based review Critical Reviews in Toxicology 2018 48 4 297 311 10.1080/10408444.2017.1423463 2-s2.0-85043576564 29389244
3 Feo M. L. Eljarrat E. Barceló D. Barceló D. Determination of pyrethroid insecticides in environmental samples TrAC, Trends in Analytical Chemistry 2010 29 7 692 705 10.1016/j.trac.2010.03.011 2-s2.0-77955092022
4 Mestres R. Mestres G. Deltamethrin: uses and environmental safety Reviews of Environmental Contamination & Toxicology 1992 124 1 18 10.1007/978-1-4612-2864-6_1 1732993
5 Soderlund D. M. Clark J. M. Sheets L. P. Mechanisms of pyrethroid neurotoxicity: implications for cumulative risk assessment Toxicology 2002 171 1 3 59 10.1016/s0300-483x(01)00569-8 2-s2.0-0036467941 11812616
6 Rehman H. Aziz A.-T. Saggu S. Abbas Z. K. Mohan A. Ansari A. A. Systematic review on pyrethroid toxicity with special reference to deltamethrin Journal of entomology and zoology studies 2014 2 6 60 70
7 Wouters W. van den Bercken J. Action of pyrethroids General Pharmacology: The Vascular System 1978 9 6 387 398 10.1016/0306-3623(78)90023-x 2-s2.0-0018107718 365673
8 Organization Deltamethrin 1990 World Health Organization
9 He F. Deng H. Ji X. Zhang Z. Sung J. Yao P. Changes of nerve excitability and urinary deltamethrin in sprayers International Archives of Occupational and Environmental Health 1991 62 8 587 590 10.1007/bf00381112 2-s2.0-0026101402 1856014
10 Samiei S. Pourbabaki R. Khadem M. Alefi M. Yarandi M. S. Shahtaheri S. J. Antioxidant and Protective Effects of Plant Extract against Deltamethrin-Induced Oxidative Stress in Liver and Kidney: A Review 2022
11 Erdogan S. Handan Zeren E. Emre M. Aydin O. Gumurdulu D. Pulmonary effects of deltamethrin inhalation: an experimental study in rats Ecotoxicology and Environmental Safety 2006 63 2 318 323 10.1016/j.ecoenv.2004.10.007 2-s2.0-33646132749 16677916
12 Pan M.-G. Xiong Y. Chen F. NFAT gene family in inflammation and cancer Current Molecular Medicine 2013 13 4 543 554 10.2174/1566524011313040007 2-s2.0-84876737068 22950383
13 Davé V. Childs T. Xu Y. Calcineurin/Nfat signaling is required for perinatal lung maturation and function Journal of Clinical Investigation 2006 116 10 2597 2609 10.1172/jci27331 2-s2.0-33749440900 16998587
14 Bast A. Semen K. O. Drent M. Pulmonary toxicity associated with occupational and environmental exposure to pesticides and herbicides Current Opinion in Pulmonary Medicine 2021 27 4 278 283 10.1097/mcp.0000000000000777 33882510
15 Kumar A. Sasmal D. Sharma N. Deltamethrin induced an apoptogenic signalling pathway in murine thymocytes: exploring the molecular mechanism Journal of Applied Toxicology 2014 34 12 1303 1310 10.1002/jat.2948 2-s2.0-84911808224 24217896
16 Kumar A. Sharma N. Comparative efficacy of piperine and curcumin in deltamethrin induced splenic apoptosis and altered immune functions Pesticide Biochemistry and Physiology 2015 119 16 27 10.1016/j.pestbp.2015.03.003 2-s2.0-84933182938 25868812
17 Imamura L. Yasuda M. Kuramitsu K. Hara D. Tabuchi A. Tsuda M. Deltamethrin, a pyrethroid insecticide, is a potent inducer for the activity-dependent gene expression of brain-derived neurotrophic factor in neurons Journal of Pharmacology and Experimental Therapeutics 2006 316 1 136 143 10.1124/jpet.105.092478 2-s2.0-29244478874 16166269
18 Li J. Jiang H. Wu P. Toxicological effects of deltamethrin on quail cerebrum: weakened antioxidant defense and enhanced apoptosis Environmental Pollution 2021 286 10.1016/j.envpol.2021.117319 117319
19 Li S. Zheng X. Zhang X. Exploring the liver fibrosis induced by deltamethrin exposure in quails and elucidating the protective mechanism of resveratrol Ecotoxicology and Environmental Safety 2021 207 10.1016/j.ecoenv.2020.111501 111501
20 Chaplin D. D. Overview of the immune response The Journal of Allergy and Clinical Immunology 2010 125 2 S3 S23 10.1016/j.jaci.2009.12.980 2-s2.0-76749098737 20176265
21 Baniyash M. TCR ζ-chain downregulation: curtailing an excessive inflammatory immune response Nature Reviews Immunology 2004 4 9 675 687 10.1038/nri1434 2-s2.0-4544309074
22 Fukuyama T. Tajima Y. Ueda H. Apoptosis in immunocytes induced by several types of pesticides Journal of Immunotoxicology 2010 7 1 39 56 10.3109/15476910903321704 2-s2.0-77649155238 19911945
23 Łukowicz-Ratajczak J. Krechniak J. Effects of deltamethrin on the immune system in mice Environmental Research 1992 59 2 467 475 10.1016/s0013-9351(05)80049-0 2-s2.0-0027078127 1464294
24 Corsini E. Sokooti M. Galli C. Moretto A. Colosio C. Pesticide induced immunotoxicity in humans: a comprehensive review of the existing evidence Toxicology 2013 307 123 135 10.1016/j.tox.2012.10.009 2-s2.0-84880059218 23116691
25 Lee G.-H. Choi K.-C. Adverse effects of pesticides on the functions of immune system Comparative Biochemistry and Physiology-Part C: Toxicology & Pharmacology 2020 235 10.1016/j.cbpc.2020.108789 108789
26 Chueh T. C. Hsu L. S. Kao C. M. Transcriptome analysis of zebrafish embryos exposed to deltamethrin Environmental Toxicology 2017 32 5 1548 1557 10.1002/tox.22376 2-s2.0-85000949482 27785895
27 Zhang L. Hong X. Zhao X. Yan S. Ma X. Zha J. Exposure to environmentally relevant concentrations of deltamethrin renders the Chinese rare minnow (Gobiocypris rarus) vulnerable to Pseudomonas fluorescens infection Science of the Total Environment 2020 715 10.1016/j.scitotenv.2020.136943 136943
28 Li M. Fang X.-Z. Zheng Y.-F. Transient receptor potential vanilloid 4 is a critical mediator in LPS mediated inflammation by mediating calcineurin/NFATc3 signaling Biochemical and Biophysical Research Communications 2019 513 4 1005 1012 10.1016/j.bbrc.2019.04.020 2-s2.0-85065774234 31005256
29 Yu B.-X. Yuan J.-N. Zhang F.-R. Inhibition of Orai1-mediated Ca2+ entry limits endothelial cell inflammation by suppressing calcineurin-NFATc4 signaling pathway Biochemical and Biophysical Research Communications 2018 495 2 1864 1870 10.1016/j.bbrc.2017.12.034 2-s2.0-85039070437 29225169
30 Karpurapu M. Lee Y. G. Qian Z. Inhibition of nuclear factor of activated T cells (NFAT) c3 activation attenuates acute lung injury and pulmonary edema in murine models of sepsis Oncotarget 2018 9 12 10606 10620 10.18632/oncotarget.24320 2-s2.0-85041950447 29535830
31 Pan M. Winslow M. M. Chen L. Kuo A. Felsher D. Crabtree G. R. Enhanced NFATc1 nuclear occupancy causes T cell activation independent of CD28 costimulation The Journal of Immunology 2007 178 7 4315 4321 10.4049/jimmunol.178.7.4315 2-s2.0-33947669503 17371988
32 Yoshida H. Nishina H. Takimoto H. The transcription factor NF-ATc1 regulates lymphocyte proliferation and Th2 cytokine production Immunity 1998 8 1 115 124 10.1016/s1074-7613(00)80464-1 2-s2.0-0031951071 9462517
33 Wills-Karp M. Immunologic basis of antigen-induced airway hyperresponsiveness Annual Review of Immunology 1999 17 1 255 281 10.1146/annurev.immunol.17.1.255 2-s2.0-0032968706
34 Zhao Q. Wang X. Liu Y. He A. Jia R. NFATc1: functions in osteoclasts The International Journal of Biochemistry & Cell Biology 2010 42 5 576 579 10.1016/j.biocel.2009.12.018 2-s2.0-77649191328 20035895
35 Zhou P. Sun L. J. Dötsch V. Wagner G. Verdine G. L. Solution structure of the core NFATC1/DNA complex Cell 1998 92 5 687 696 10.1016/s0092-8674(00)81136-8 2-s2.0-0032489431 9506523
36 Eferl R. Wagner E. F. AP-1: a double-edged sword in tumorigenesis Nature Reviews Cancer 2003 3 11 859 868 10.1038/nrc1209 2-s2.0-0242691046 14668816
37 Neuberg M. Adamkiewicz J. Hunter J. B. Müller R. A Fos protein containing the Jun leucine zipper forms a homodimer which binds to the AP1 binding site Nature 1989 341 6239 243 245 10.1038/341243a0 2-s2.0-0024975788 2506451
38 Halazonetis T. D. Georgopoulos K. Greenberg M. E. Leder P. c-Jun dimerizes with itself and with c-Fos, forming complexes of different DNA binding affinities Cell 1988 55 5 917 924 10.1016/0092-8674(88)90147-x 2-s2.0-0023771685 3142692
39 Macián F. García‐Rodríguez C. Rao A. Gene expression elicited by NFAT in the presence or absence of cooperative recruitment of Fos and Jun EMBO Journal 2000 19 17 4783 4795 10.1093/emboj/19.17.4783 10970869
40 Dong C. Fu T. Ji J. Li Z. Gu Z. The role of interleukin‐4 in rheumatic diseases Clinical and Experimental Pharmacology and Physiology 2018 45 8 747 754 10.1111/1440-1681.12946 2-s2.0-85047483066 29655253
41 Steinke J. W. Borish L. Th2 cytokines and asthma—interleukin-4: its role in the pathogenesis of asthma, and targeting it for asthma treatment with interleukin-4 receptor antagonists Respiratory Research 2001 2 2 66 75 10.1186/rr40 2-s2.0-0035719975 11686867
42 Rodrigues M. d B. Carvalho D. S. d Chong-Silva D. C. Association between exposure to pesticides and allergic diseases in children and adolescents: a systematic review with meta-analysis Jornal de Pediatria 2022 98 6 551 564 10.1016/j.jped.2021.10.007 34982974
43 Jorritsma P. J. Brogdon J. L. Bottomly K. Role of TCR-induced extracellular signal-regulated kinase activation in the regulation of early IL-4 expression in naive CD4+ T cells The Journal of Immunology 2003 170 5 2427 2434 10.4049/jimmunol.170.5.2427 12594266
44 Zhu Z. Homer R. J. Wang Z. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion, subepithelial fibrosis, physiologic abnormalities, and eotaxin production Journal of Clinical Investigation 1999 103 6 779 788 10.1172/jci5909 2-s2.0-0033560126 10079098
45 Lee C. G. Homer R. J. Zhu Z. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor β1 Journal of Experimental Medicine 2001 194 6 809 822 10.1084/jem.194.6.809 2-s2.0-0035903306 11560996
46 Pandit A. A. Choudhary S. Singh B. Singh B. Sethi R. Imidacloprid induced histomorphological changes and expression of TLR-4 and TNFα in lung Pesticide Biochemistry and Physiology 2016 131 9 17 10.1016/j.pestbp.2016.02.004 2-s2.0-84960352059 27265821
47 Kaur S. Mukhopadhyay C. Sethi R. Chronic exposure to indoxacarb and pulmonary expression of toll-like receptor-9 in mice Veterinary World 2016 9 11 1282 1286 10.14202/vetworld.2016.1282-1286 2-s2.0-84998693277 27956782
48 Sandeep K. Mukhopadhyay C. S. Arora J. S. Sethi R. S. Indoxacarb interaction alters immunotoxic and genotoxic potential of endotoxin Journal of Pesticide Science 2016 41 3 65 70 10.1584/jpestics.d16-012 2-s2.0-84991045100 30363127
49 Verma G. Ramneek M. C. Sethi R. Acute ethion exposure alters expression of TLR9 in lungs of mice Indian Journal of Veterinary Anatomy 2016 28 1 40 43
50 Merkowsky K. Sethi R. S. Gill J. P. Singh B. Fipronil induces lung inflammation in vivo and cell death in vitro Journal of occupational medicine and toxicology 2016 11 1 1 10 10.1186/s12995-016-0102-0 2-s2.0-84963722434 26759602
51 Pandit A. A. Mukhopadhyay C. S. Sethi R. S. Expression of TLR-9 and IL-1 following concomitant exposure to Imidacloprid and endotoxin Pesticide Research Journal 2017 29 2 243 250
52 Tewari A. Sethi R. Banga H. Singh B. Gill J. Concomitant effect of low dose of lindane and intranasal lipopolysaccharide on respiratory system of mice Human & Experimental Toxicology 2017 36 11 1201 1211 10.1177/0960327116685889 2-s2.0-85031103497 28177269
53 Verma G. Mukhopadhyay C. S. Verma R. Singh B. Sethi R. Long-term exposures to ethion and endotoxin cause lung inflammation and induce genotoxicity in mice Cell and Tissue Research 2019 375 2 493 505 10.1007/s00441-018-2912-0 2-s2.0-85053661851 30225615
54 Geetika G. Sodhi S. Mukhopadhyay C. Ramneek R. Sethi R. Pulmonary expression of MYCN mRNA following exposure to 2, 4-D with or without endotoxin challenge Indian Journal of Animal Sciences 2019 89 11 1217 1220 10.56093/ijans.v89i11.95863
55 Geetika S. B. Mukhopadhyay C. Verma R. Sethi R. Chronic dietary exposures of 2, 4-D alter the pulmonary expression of MYC-N Indian Journal of Veterinary Anatomy 2019 31 1 59 61
56 Verma G. Sethi R. Study of ethion and lipopolysaccharide interaction on lung in a mouse model Laboratory Animal Research 2020 36 1 22 10 10.1186/s42826-020-00055-z 32742976
57 Shaikh N. I. Sethi R. Exposure to chlorpyrifos and cypermethrin alone or in combination induces developmental abnormalities and lung damage in animal models: a review Journal of Entomology and Zoology Studies 2020 8 5 1923 1928 10.22271/j.ento.2020.v8.i5aa.7769
58 Pandher U. S. Kirychuk S. Schneberger D. Lung Inflammation from Single and Repetitive Exposure to Glyphosate 2021
59 Pandit A. A. Gandham R. K. Mukhopadhyay C. Verma R. Sethi R. Transcriptome analysis reveals the role of the PCP pathway in fipronil and endotoxin-induced lung damage Respiratory Research 2019 20 24 16 10.1186/s12931-019-0986-1 2-s2.0-85060941594 30709343
60 Shaikh N. I. Sethi R. Impairment of apoptosis pathway via Apaf1 downregulation during chlorpyrifos and/or cypermethrin induced lung damage Animal Biotechnology 2023 34 3 738 745 10.1080/10495398.2021.1981918 34559034
61 Kaur G. Verma R. Mukhopadhyay C. S. Sethi R. Elevated pulmonary levels of Axin2 in mice exposed to herbicide 2, 4‐D with or without endotoxin Journal of Biochemical and Molecular Toxicology 2021 35 12 p. e22912 10.1002/jbt.22912
62 Kaur G. Kumar B. V. S. Singh B. Sethi R. Exposures to 2, 4-Dichlorophenoxyacetic acid with or without endotoxin upregulate small cell lung cancer pathway Journal of Occupational Medicine and Toxicology 2021 16 14 13 10.1186/s12995-021-00304-4 33865415
63 Yang J. Gong Y. Cai J. Zheng Y. Liu H. Zhang Z. Chlorpyrifos induces redox imbalance‐dependent inflammation in common carp lymphocyte through dysfunction of T‐cell receptor γ Journal of Fish Diseases 2020 43 4 423 430 10.1111/jfd.13138 32048311
64 Tewari A. Bedi J. Singh B. Gill J. P. S. Oral exposure of deltamethrin and/or lipopolysaccharide (LPS) induced activation of the pulmonary immune system in Swiss albino mice Environmental Science and Pollution Research 2018 25 16 15436 15448 10.1007/s11356-018-1702-2 2-s2.0-85044203628 29564709
65 Glanville J. Huang H. Nau A. Identifying specificity groups in the T cell receptor repertoire Nature 2017 547 7661 94 98 10.1038/nature22976 2-s2.0-85022229481 28636589
66 Shugay M. Bagaev D. V. Zvyagin I. V. VDJdb: a curated database of T-cell receptor sequences with known antigen specificity Nucleic Acids Research 2018 46 D1 D419 D427 10.1093/nar/gkx760 2-s2.0-85040922139 28977646
67 Grosdidier A. Zoete V. Michielin O. SwissDock, a protein-small molecule docking web service based on EADock DSS Nucleic Acids Research 2011 39 suppl W270 W277 10.1093/nar/gkr366 2-s2.0-79960029361 21624888
68 Irwin J. J. Shoichet B. K. ZINC− a free database of commercially available compounds for virtual screening Journal of Chemical Information and Modeling 2005 45 1 177 182 15667143
69 Li S. Shui K. Zhang Y. CGDB: a database of circadian genes in eukaryotes Nucleic Acids Research 2017 45 D1 D397 D403 10.1093/nar/gkw1028 2-s2.0-85016023951 gkw1028 27789706
70 Xu D. Zhang Y. Improving the physical realism and structural accuracy of protein models by a two-step atomic-level energy minimization Biophysical Journal 2011 101 10 2525 2534 10.1016/j.bpj.2011.10.024 2-s2.0-81255123286 22098752
71 Pettersen E. F. Goddard T. D. Huang C. C. UCSF Chimera—a visualization system for exploratory research and analysis Journal of Computational Chemistry 2004 25 13 1605 1612 10.1002/jcc.20084 2-s2.0-4444221565 15264254
72 Tos-Luty S. Haratym-Maj A. Latuszynska J. Obuchowska-Przebirowska D. Tokarska-Rodak M. Oral toxicity of deltamethrin and fenvalerate in Swiss mice Annals of Agricultural and Environmental Medicine: AAEM 2001 8 2 245 254 11748884
73 Serwold T. Hochedlinger K. Inlay M. A. Jaenisch R. Weissman I. L. Early TCR expression and aberrant T cell development in mice with endogenous prerearranged T cell receptor genes The Journal of Immunology 2007 179 2 928 938 10.4049/jimmunol.179.2.928 2-s2.0-34548803645 17617584
74 Yan J. Su H. Xu L. Wang C. OX40-OX40L interaction promotes proliferation and activation of lymphocytes via NFATc1 in ApoE-deficient mice PLoS One 2013 8 4 10.1371/journal.pone.0060854 2-s2.0-84876048587 e60854
75 King-Himmelreich T. S. Möser C. V. Wolters M. C. AMP-activated kinase and the endogenous endocannabinoid system might contribute to antinociceptive effects of prolonged moderate caloric restriction in mice Molecular Pain 2017 13 10.1177/1744806917703111 2-s2.0-85026407726 1744806917703111
76 Kong L. Zhao Q. Wang X. Zhu J. Hao D. Yang C. Angelica sinensis extract inhibits RANKL-mediated osteoclastogenesis by down-regulated the expression of NFATc1 in mouse bone marrow cells BMC Complementary and Alternative Medicine 2014 14 1 481 487 10.1186/1472-6882-14-481 2-s2.0-84924286256 25496242
77 Chan L. S. Robinson N. Xu L. Expression of interleukin-4 in the epidermis of transgenic mice results in a pruritic inflammatory skin disease: an experimental animal model to study atopic dermatitis Journal of Investigative Dermatology 2001 117 4 977 983 10.1046/j.0022-202x.2001.01484.x 2-s2.0-0034783801 11676841
78 Zhang M. Wan J. Xu Y. Simultaneously increased expression of glucocorticoid-induced tumor necrosis factor receptor and its ligand contributes to increased interleukin-5/13-producing group 2 innate lymphocytes in murine asthma Molecular Medicine Reports 2017 15 6 4291 4299 10.3892/mmr.2017.6500 2-s2.0-85019576519 28440511
79 Rao W. Xie G. Zhang Y. OVA66, a tumor associated protein, induces oncogenic transformation of NIH3T3 cells PLoS One 2014 9 3 p. e85705 10.1371/journal.pone.0085705 2-s2.0-84898479366 e85705 24633332
80 Livak K. J. Schmittgen T. D. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method Methods 2001 25 4 402 408 10.1006/meth.2001.1262 2-s2.0-0035710746 11846609
81 Sethi R. Brar R. Singh O. Singh B. Immunolocalization of pulmonary intravascular macrophages, TLR4, TLR9 and IL-8 in normal and Pasteurella multocida-infected lungs of water buffalo (Bubalus bubalis) Journal of Comparative Pathology 2011 144 2-3 135 144 10.1016/j.jcpa.2010.08.003 2-s2.0-79551497454 20880542
82 Biovia D. S. Discovery Studio Modeling Environment 2016 San Diego DassaultSystèmes
83 Han Y. Zhang Q. Chen L. Zhao J. Yang D. In vitro study of deltamethrin-induced extracellular traps in hemocytes of Ruditapes philippinarum Ecotoxicology and Environmental Safety 2023 256 10.1016/j.ecoenv.2023.114909 114909
84 Karatas T. Cakir M. Assessment of deltamethrin-induced DNA damage, neurotoxic and neuroimmune effects in the brain tissue of brown trout (Salmo trutta fario) Veterinarni Medicina 2024 69 3 77 83 10.17221/115/2023-vetmed 38623154
85 Elbanna R. Osman K. A. Salama M. S. Biomarkers of oral subacute toxicity of deltamethrin in exposed male Albino rats Toxicology and Industrial Health 2023 39 12 735 753 10.1177/07482337231209360 37877786
86 Wang J. Li H. Liu Y. Contribution of immune responses to the cardiotoxicity and hepatotoxicity of deltamethrin in early Life stage zebrafish (Danio rerio) Environmental Science and Technology 2024 58 22 9515 9524 10.1021/acs.est.3c10682 38687472
87 Lin Y. Song Y. Zhang Y. Shi M. Hou A. Han S. NFAT signaling dysregulation in cancer: emerging roles in cancer stem cells Biomedicine & Pharmacotherapy 2023 165 10.1016/j.biopha.2023.115167 115167
88 Huse M. The T-cell-receptor signaling network Journal of Cell Science 2009 122 9 1269 1273 10.1242/jcs.042762 2-s2.0-67650547454 19386893
89 Viola A. Lanzavecchia A. T cell activation determined by T cell receptor number and tunable thresholds Science 1996 273 5271 104 106 10.1126/science.273.5271.104 2-s2.0-0030057218 8658175
90 Brogdon J. L. Leitenberg D. Bottomly K. The potency of TCR signaling differentially regulates NFATc/p activity and early IL-4 transcription in naive CD4+ T cells The Journal of Immunology 2002 168 8 3825 3832 10.4049/jimmunol.168.8.3825 2-s2.0-0037090336 11937535
91 Sullivan B. M. Coscoy L. Downregulation of the T-cell receptor complex and impairment of T-cell activation by human herpesvirus 6 u24 protein Journal of Virology 2008 82 2 602 608 10.1128/jvi.01571-07 2-s2.0-37849017715 17977973
92 Cai Z. Kishimoto H. Brunmark A. Jackson M. R. Peterson P. A. Sprent J. Requirements for peptide-induced T cell receptor downregulation on naive CD8+ T cells Journal of Experimental Medicine 1997 185 4 641 652 10.1084/jem.185.4.641 2-s2.0-0031037183 9034143
93 Grundy S. Plumb J. Lea S. Kaur M. Ray D. Singh D. Down regulation of T cell receptor expression in COPD pulmonary CD8 cells PLoS One 2013 8 8 10.1371/journal.pone.0071629 2-s2.0-84897920121 e71629
94 Peng S. L. Gerth A. J. Ranger A. M. Glimcher L. H. NFATc1 and NFATc2 together control both T and B cell activation and differentiation Immunity 2001 14 1 13 20 10.1016/s1074-7613(01)00085-1 2-s2.0-0035129248 11163226
95 Ansel K. M. Djuretic I. Tanasa B. Rao A. REGULATION OF TH2 DIFFERENTIATION AND Il4 LOCUS ACCESSIBILITY Annual Review of Immunology 2006 24 1 607 656 10.1146/annurev.immunol.23.021704.115821 2-s2.0-33646196946
96 Robbs B. K. Cruz A. L. Werneck M. B. Mognol G. P. Viola J. P. Dual roles for NFAT transcription factor genes as oncogenes and tumor suppressors Molecular and Cellular Biology 2008 28 23 7168 7181 10.1128/mcb.00256-08 2-s2.0-57349133026 18809576
97 Patra A. K. Avots A. Zahedi R. P. An alternative NFAT-activation pathway mediated by IL-7 is critical for early thymocyte development Nature Immunology 2013 14 2 127 135 10.1038/ni.2507 2-s2.0-84872685452 23263556
98 Lane S. J. Adcock I. M. Richards D. Hawrylowicz C. Barnes P. J. Lee T. H. Corticosteroid-resistant bronchial asthma is associated with increased c-fos expression in monocytes and T lymphocytes Journal of Clinical Investigation 1998 102 12 2156 2164 10.1172/jci2680 2-s2.0-0032535369 9854051
99 Schonthaler H. B. Guinea-Viniegra J. Wagner E. F. Targeting inflammation by modulating the Jun/AP-1 pathway Annals of the Rheumatic Diseases 2011 70 Suppl 1 i109 i112 10.1136/ard.2010.140533 2-s2.0-79953014066 i109 21339212
100 Chen L. Grabowski K. A. Xin J.-p IL-4 induces differentiation and expansion of Th2 cytokine-producing eosinophils The Journal of Immunology 2004 172 4 2059 2066 10.4049/jimmunol.172.4.2059 2-s2.0-10744227439 14764670
101 Perkins C. Wills-Karp M. Finkelman F. D. IL-4 induces IL-13–independent allergic airway inflammation The Journal of Allergy and Clinical Immunology 2006 118 2 410 419 10.1016/j.jaci.2006.06.004 2-s2.0-33746495728 16890766
102 Bulgaroni V. Lombardo P. Rivero-Osimani V. Environmental pesticide exposure modulates cytokines, arginase and ornithine decarboxylase expression in human placenta Reproductive Toxicology 2013 39 23 32 10.1016/j.reprotox.2013.03.010 2-s2.0-84876737356 23557688
103 Yang M. Hogan S. P. Mahalingam S. Eotaxin-2 and IL-5 cooperate in the lung to regulate IL-13 production and airway eosinophilia and hyperreactivity The Journal of Allergy and Clinical Immunology 2003 112 5 935 943 10.1016/j.jaci.2003.08.010 2-s2.0-0242467200 14610483
