
==== Front
J Cell Mol Med
J Cell Mol Med
10.1111/(ISSN)1582-4934
JCMM
Journal of Cellular and Molecular Medicine
1582-1838
1582-4934
John Wiley and Sons Inc. Hoboken

10.1111/jcmm.18578
JCMM18578
JCMM-04-2024-047.R1
Original Article
Original Article
Effect of Kruppel‐like factor 4 on PTZ‐induced acute seizure mice
Li et al.
Li Bingjin https://orcid.org/0000-0002-2612-4285
1 2 libingjin@jlu.edu.cn

Piao Jingjing 1 2
Piao Xinmiao 1 2
Geng Zihui 1 2
Cheng Ziqian 1 2
Zou Xiaohan https://orcid.org/0000-0001-9283-4843
1 2
Jiang Huiyi 3 hyjiang@jlu.edu.cn

1 Jilin Provincial Key Laboratory on Molecular and Chemical Genetics Second Hospital of Jilin University Changchun People's Republic of China
2 Department of Medical Research Centar Second Hospital of Jilin University Changchun People's Republic of China
3 Department of Pediatrics The First Hospital of Jilin University Changchun People's Republic of China
* Correspondence
Bingjin Li, Jilin Provincial Key Laboratory on Molecular and Chemical Genetics, Second Hospital of Jilin University, 218 Ziqiang Street, Changchun 130041, People's Republic of China.
Email: libingjin@jlu.edu.cn
Huiyi Jiang, Department of Pediatrics, The First Hospital of Jilin University, Changchun, People's Republic of China.
Email: hyjiang@jlu.edu.cn

05 9 2024
9 2024
28 17 10.1111/jcmm.v28.17 e1857813 6 2024
08 4 2024
16 7 2024
© 2024 The Author(s). Journal of Cellular and Molecular Medicine published by Foundation for Cellular and Molecular Medicine and John Wiley & Sons Ltd.
https://creativecommons.org/licenses/by/4.0/ This is an open access article under the terms of the http://creativecommons.org/licenses/by/4.0/ License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Abstract

Kruppel‐like factor 4 (Klf4) is a transcription factor that is involved in neuronal regeneration and the development of glutamatergic systems. However, it is unknown whether Klf4 is involved in acute seizure. To investigate the potential role of Klf4 in pentylenetetrazol (PTZ)‐induced seizure, western blotting, immunofluorescence, behaviour test and electrophysiology were conducted in this study. We found that Klf4 protein and mRNA expression were increased in both the hippocampus (HP) and prefrontal cortex (PFC) after PTZ‐induced seizure in mice. HP‐specific knockout (KO) of Klf4 in mice decreased protein expression of Klf4 and the down‐stream Klf4 target tumour protein 53 (TP53/P53). These molecular changes are accompanied by increased seizure latency, reduced immobility time in the forced swimming test and tail suspension test. Reduced hippocampal protein levels for synaptic proteins, including glutamate receptor 1 (GRIA1/GLUA1) and postsynaptic density protein 95 (DLG4/PSD95), were also observed after Klf4‐KO, while increased mRNA levels of complement proteins were observed for complement component 1q subcomponent A (C1qa), complement component 1q subcomponent B (C1qb), complement component 1q subcomponent C (C1qc), complement component 3 (C3), complement component 4A (C4a) and complement component 4B (C4b). Moreover, c‐Fos expression induced by PTZ was reduced by hippocampal conditional KO of Klf4. Electrophysiology showed that PTZ‐induced action potential frequency was decreased by overexpression of Klf4. In conclusion, these findings suggest that Klf4 plays an important role in regulating PTZ‐induced seizures and therefore constitutes a new molecular target that should be explored for the development of antiepileptic drugs.

anticonvulsants
c‐Fos
Klf4
P53
PTZ
seizures
Department of Science and Technology of Jilin Province 10.13039/501100011789 20200201504JC Project of Jilin University Education and Teaching Reform & Research2022JGY021 The National Natural Science Foundation of China82371540 source-schema-version-number2.0
cover-dateSeptember 2024
details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_JATSPMC version:6.4.8 mode:remove_FC converted:05.09.2024
Li B , Piao J , Piao X , et al. Effect of Kruppel‐like factor 4 on PTZ‐induced acute seizure mice. J Cell Mol Med. 2024;28 :e18578. doi:10.1111/jcmm.18578
==== Body
pmc1 INTRODUCTION

Seizure disorders are common, chronic and serious neurological disorders throughout the world. 1 Although there are many therapeutic methods to treat seizure disorders, they are not effective in many patients, and some patients are completely resistant to all current treatments. Moreover, most anticonvulsants present a variety of side effects that limit the effective use in many patients. Additionally, these conditions often present early in life and early exposure to anticonvulsants may be associated with the increased risk of developing psychiatric disorders, including autism spectrum disorder. 2 Some anticonvulsants may also worsen other psychiatric symptoms, inducing manic symptoms. 3 , 4 Consequently, the development of new molecular targets for antiepileptic drugs is a critical need in the treatment of seizure disorders.

It is well known that Klf4 induces pluripotency in stem cells (iPSCs). 5 Klf4, a zinc finger‐containing transcription factor, has been reported to play roles in stem cell differentiation, 6 cancer 7 , 8 and atherosclerosis. 9 Klf4 is highly expressed in the cerebral cortex, hippocampus (HP) and hypothalamus 10 , 11 and has important developmental roles in regulating glutamatergic function. 12 In the central nervous system (CNS), Klf4 has been implicated in neuron regeneration, 13 , 14 brain tumour formation, 15 neuronal apoptosis, 16 and the pathophysiology of traumatic brain injury 17 and Alzheimer's disease. 18 , 19 Given the apparent broad role of Klf4 in brain plasticity 20 and neurodegenerative disorders, it might also be thought that Klf4 would influence general brain excitability and therefore have a role in seizure disorders. Nonetheless, our understanding of the involvement of Klf4 in seizure disorders remains unclear.

P53 is a downstream mediator of Klf4 actions that are important in amyloid β‐protein 19 or Traumatic brain injury (TBI)‐induced neuroinflammation. 21 Whether a result of this neuroinflammatory cascade or other actions of Klf4, changes in brain excitability involving p53 are unclear. Activated p53 occurs in pilocarpine‐induced drug resistant epilepsy, 22 pentylenetetrazol (PTZ)‐induced seizures 23 and post‐traumatic epilepsy (PTE) animal brains. 24 PTZ‐induced seizures in rats. 23 This likely results from increased neuronal activity as the neuronal marker (NeuN) c‐Fos is also increased by PTZ, while anticonvulsant treatments decrease this elevation in c‐Fos expression. 16 , 25 , 26 HP is an important brain region related to seizures. c‐Fos expression is increased by convulsants, and decreased by anticonvulsants, in the HP and PFC. 25 In this study, we investigated the anticonvulsant effect of Klf4 in PTZ‐induced acute seizures in mice, along with behavioural and molecular characterization of the effect of conditional hippocampal Klf4‐KO on PTZ‐induced seizures. The effect of overexpression of the Klf4 on PTZ‐treated hippocampal neuronal excitability was also determined using whole‐cell current‐clamp recordings.

2 RESULTS

2.1 Expression of KLF4 after PTZ‐induced acute seizure in mice brain

Figures 1 and 2 show hippocampal protein expression levels of Klf4 after PTZ‐induced acute seizure. Klf4 protein expression was significantly increased after a single PTZ administration both in HP (Figure 1A,B: p < 0.01) and PFC (Figure 1C,D: p < 0.01) of mice. PCR results for Klf4 mRNA expression are shown in Figure 2. Klf4 mRNA expression was also significantly increased after single PTZ administration both in HP (Figure 2A: p < 0.01) and PFC (Figure 2B: p < 0.01) of mice.

FIGURE 1 Protein expression levels of transcription factors in in acute PTZ‐induced seizure. (A, B) HP Klf4 protein expression in the acute PTZ‐treated mice; (C, D) FC Klf4 protein expression in the acute PTZ‐treated mice. PTZ, Pentylenetetrazole (70 mg/kg, ip). Columns represent the mean ± S.E.M. n = 6. **p < 0.01 versus PTZ group.

FIGURE 2 Brain mRNA expression of transcription factors in acute PTZ‐induced seizure. (A) HP Klf4 mRNA expression level in the acute PTZ‐treated mice; (B) FC Klf4 mRNA expression in the acute PTZ‐treated mice. PTZ, Pentylenetetrazole (70 mg/kg, ip). Columns represent the mean ± S.E.M. n = 5–6. **p < 0.01 versus PTZ group.

2.2 Behaviour characterization of conditional hippocampal knockout of Klf4 in mice

Figure 3 shows genotyping results for conditional hippocampal knockout (KO) of Klf4 in mice. Figure 3A,B show the genotype identification of Elovl4 floxed mice. Figure 3C shows the hippocampal injection site of the pAAV‐CaMKIIa‐EGFP‐P2A‐Cre‐WPRE. PCR results show decreased hippocampal mRNA expression in conditional hippocampal Klf4‐KO mice (Figure 3D,E). Figure 4 shows behavioural results in conditional hippocampal Klf4‐KO mice compared to wild‐type mice. There were no significant behavioural differences between wild‐type and conditional hippocampal knockout of Klf4‐KO mice in the Y‐maze test and open field test (OFT). The only behavioural differences were in the forced swimming test (FST) and tail suspension test (TST), where immobility time was significantly decreased after conditional hippocampal Klf4‐KO (Figure 4C FST: p < 0.05; Figure 4D TST: p < 0.01).

FIGURE 3 Generation of conditional hippocampal Klf4‐KO mice. (A) Genotyping results of 3′loxp Klf4 +/+ mice; (B) genotyping results of 5'loxp Klf4+/+ mice; (C) HP injection of virus pAAV‐CaMKIIa‐EGFP‐P2A‐Cre‐WPRE; (D) genotyping results of conditional hippocampal Klf4‐KO mice; (E) MRNA identification of conditional hippocampal Klf4‐KO mice. Columns represent the mean ± S.E.M. n = 6. *p < 0.05.

FIGURE 4 Behaviour characterization of conditional hippocampal Klf4‐KO mice. (A) Alteration rate in Y‐maze test; (B) number of line crossings in open field test; (C) number of rears in open field test; (D) time spent in the centre of an open field. Columns represent the mean ± S.E.M. n = 6. *p < 0.05 and ***p < 0.001 versus WT.

2.3 Molecular characterization of conditional hippocampal Klf4‐KO mice

Figure 5A–F shows the molecular changes after conditional hippocampal Klf4‐KO in the HP of mice using a NeuN, a marker of astrocytes (GFAP), a microglial marker (Iba1), and markers for synaptic proteins (GluA1, PSD95 and Synapsin1) comparing wild‐type and conditional hippocampal Klf4‐KO using western blot. Klf4‐KO mice had increased protein expression of GFAP (p < 0.001) and Iba1 (p < 0.001) compared to wild‐type mice. Decreased expression of the synaptic proteins GluA1 (p < 0.001) and PSD95 (p < 0.01) were observed. There were no differences in the expression of NeuN or synapsin 1. Figure 5G–L shows complement changes between WT and Klf4‐KO mice by PCR. mRNA levels of all complement proteins were very low in WT mice and substantially and significantly increased after conditional hippocampal Klf4‐KO (c1qa and c1qb, p < 0.001, Figure 5G,H; c1qc, p < 0.05, Figure 5I; c3, c4a and c4b, p < 0.001, Figure 5J–L).

FIGURE 5 Molecular characterization of conditional hippocampal Klf4‐KOmice. (A) HP NeuN protein expression; (B) HP GFAP protein expression; (C) HP Iba1 protein expression; (D) HP GluA1 protein expression; (E) HP PSD95 protein expression; (F) HP Synapsin1 protein expression; (G–L), mRNA level of HP complement (C1: C1qa, C1qb and C1qc; C4: C4a and C4b) expressions. Columns represent the mean ± S.E.M. n = 6–8. *p < 0.05, **p < 0.01, ***p < 0.001 versus WT.

2.4 Effects of conditional hippocampal Klf4‐ KO on PTZ‐induced acute seizure and the expression of Klf4, P53 and c‐Fos

As shown in Figure 6, conditional hippocampal Klf4‐KO increased the PTZ‐induced seizure score (Figure 6B, p < 0.01), but had no effect on seizure latency (Figure 6A). Figure 6C,D shows the results of western blotting examining the expression of Klf4 and its downstream target protein, P53. Conditional hippocampal Klf4‐KO decreased protein levels of Klf4 in both PTZ and saline treatment groups (two‐way ANOVA, genotype: F(1, 20) = 7.401, p < 0.05; PTZ treatment: F(1, 20) = 35.13, p < 0.0001, Figure 6C,D). Post hoc Tukey comparisons showed that PTZ increased Klf4 protein expression (p < 0.05), while Klf4‐KO reduced Klf4 protein levels p < 0.001, protein levels of p53 were also decreased by conditional hippocampal Klf4‐KO in both saline and PTZ‐treated mice (two‐way ANOVA, genotype: F(1, 28) = 6.146; PTZ treatment; F(1, 28) = 43.16, post hoc Tukey test, p < 0.01, Figure 6E,F). Post hoc Tukey comparisons showed that PTZ increased p53 protein expression (p < 0.05), the effect was reversed by conditional hippocampal Klf4‐KO (p < 0.01). To explore the effect of PTZ on the interaction between proteins in the HP, co‐immunoprecipitation was performed. Figure 6G shows co‐immunoprecipitation results for Klf4 and p53. There was a direct interaction between Klf4 and p53 in the HP, which was increased by PTZ. Figure 6H,I shows c‐Fos expression in the dentate gyrus of the HP. There were significant differences across treatment groups in the dentate gyrus of HP (PTZ treatment and genotype interaction F(1, 36) = 6.583, p < 0.05; PTZ treatment, F(1, 36) = 69.53; p < 0.0001; genotype, F(1, 36) = 17.38, p < 0.0001, Figure 6H,I). PTZ treatment increased c‐Fos expression slightly in the HP of control mice and Klf4‐KO mice (control mice: p < 0.00001; Klf4‐KO mice: p < 0.00001). Klf4‐KO decreased PTZ‐induced c‐Fos expression in the dentate gyrus of the HP (p < 0.01).

FIGURE 6 Effects of conditional hippocampal Klf4‐KO on PTZ‐induced acute seizure. (A, B) Seizure latency and score; (C, D) hippocampal protein expression of Klf4; (E, F) hippocampal protein expression of p53; (G) co‐immunoprecipitation of Klf4 and P53; (H, I) The expression of c‐Fos was assessed in the dentate gyrus (DG) region of the hippocampus. Columns represent the mean ± S.E.M. n = 6–8. *p < 0.05, **p < 0.01, and ***p < 0.001.

2.5 Effects of overexpression of Klf4 on action potential frequency of hippocampal pyramidal neurons

As Figure 7A–C shows that viral over‐expression of Klf4 alone had no effect on action potential (AP) frequency. PTZ increased AP frequency in cells from control (LV‐EGFP) mice (two‐way ANOVA: F (3, 36) = 31.166, p < 0.001; p < 0.001 vs. saline) and this effect was reduced by overexpression of Klf4 (p < 0.01 vs. LV‐EGFP mice treated with PTZ). There was no significant difference between saline‐treated LV‐EGFP cells and PTZ‐treated LV‐Klf4 treated cells on AP frequency.

FIGURE 7 Effects of overexpression of Klf4 on action potential (AP) frequency in hippocampal pyramidal neurons. (A) Visualization of the primary cultured hippocampal neuron. (B) The representative recording shows that action potentials were inhibited by Klf4 overexpression. (C) The mean frequency plots showing changes in AP frequency between groups. Columns represent the mean ± S.E.M. n = 10. *p < 0.05, **p < 0.01, and ***p < 0.001.

3 DISCUSSION

This study revealed that the transcription factor Klf4 was regulated following PTZ‐induced acute seizures in mice. Glutamatergic stimulation induces swift upregulation of Klf4 expression in cultured neurons and Klf4 overexpression activated caspase‐3 after treatment with NMDA (10 μM). 12 Consistent with these overall roles, the present experiments demonstrate that Klf4 plays a protective role in the acute seizure. In addition, viral‐mediated over‐expression of Klf4 gene expression in vitro also increased seizure latency. Thus, both approaches are consistent with the role of Klf4 in reducing seizure susceptibility.

To further explore the role of the Klf4 in the epilepsy, conditional hippocampal Klf4‐KO mice were constructed, and behaviour and molecular characterization were performed. Klf4‐KO mice did not affect the behaviours in the Y‐maze and OFT. There was a selective effect upon depressive‐like behaviour where Klf4‐KO mice exhibited reduced immobility time in the FST and TST. The reason may be related to changes in neural excitability in Klf4‐KO mice under some conditions. Repeated electroconvulsive therapy decreases immobility time in the FST, 27 , 28 so that a similar change in hippocampal excitability may occur here. Although there were no differences at baseline, PTZ‐induced seizure activity was reduced. Supporting this relationship between depressive phenotypes and hippocampal excitability, in a genetic absence epilepsy model in Wistar Albino Glaxo/Rijswijk (WAG/Rij) rats decreases in immobility time in the FST are observed. 29

Protein expression levels of neuronal and glial markers including NeuN, GFAP and Iba1 in HP were detected through western blotting. GFAP and Iba1 were increased in the Klf4‐KO mice. Activated glia also produce cytokines, produce neuronal hyperexcitability and inflammation that may contribute to the pathogenesis of epilepsy. 30 , 31 A recent study reported that overexpression of Klf4 confers vascular protection via reducing cerebral vascular endothelial inflammation. 32 Although some evidence has shown that Klf4 plays a critical role in CNS function and susceptibility to some neurological disorders, the specific mechanisms are still obscure. Importantly, Klf4 contributes to microglia‐mediated neuroinflammation in Alzheimer's disease. 19 , 33 However, another study reported that LPS stimulation increased Klf4 expression in microglial cells in a time and dose‐dependent manner. Klf4 resulted in decreased levels of the pro‐inflammatory cytokines such as TNF‐α, MCP‐1, IL‐6 and IFN‐gamma. 34 , 35 The apparent inconsistency of these results may relate to different roles of Klf4 under different conditions. Further work needs to be done to show if changes in Klf4 are a cause or result of some of these inflammatory changes.

In the present study, synaptic proteins including GluA1, PSD95 and Synapsin1 were also detected by western blotting in the Klf4‐KO mice. GluA1 and PSD95 were decreased in PTZ‐treated mice, as in a previous study. 36 That study reported that ICV injection of the four reprogramming factors Oct4, Sox2 c‐MYC and Klf4 increases protein expression of PSD95, thereby reversing brain damage‐induced synapse plasticity. 37 These results indicated that Klf4 may play an important role in synaptic plasticity. Protein levels of synapsin are not changed after Klf4‐KO. Similar to what was observed here, activated microglia and complement cascade C1q signalling in the HP may contribute to synaptic loss in a mouse model of neuroinflammation induced by repeated LPS injections. 38 Inflammation also decreases PSD95 in the HP. 39 Moreover, complement mRNA expression was also tested by PCR here. These complement factors are mediators of inflammation, and also involved in the molecular mechanisms of epilepsy. 40 In this study complement 1q (a, b and c), 1q3 and 1q4 (a and b) all were increased in Klf4‐KO mice. The complement C3‐C3aR pathway mediates microglia‐astrocyte interactions following status epilepticus (SE) 41 , 42 reported that C4B (but not C3)‐deficient mice exhibited increased susceptibility to seizures induced by PTZ and failed to upregulate the expression of multiple immediate early genes (IEGs) including Egrs1‐4 and c‐Fos. These findings suggest that seizure behaviour may be related to inflammation‐related microglial and astrocytic activation and further affects synaptic protein changes.

In this study, conditional hippocampal Klf4‐KO did not affect seizure latency. Viral‐mediated overexpression of Klf4 in vitro did increase seizure latency. This may have to do with differences in circumstances. An acute seizure may increase Klf4 protein expression, 43 but chronic seizure may decrease Klf4 protein expression. Decreased Klf4 protein levels were found in a PTZ‐kindling mouse model of epilepsy. 20 In addition, in a small sample size clinical study expression of Oct4, Sox2, c‐MYC and Klf4 genes was increased after initial electroconvulsive stimulation. Gene expression levels after treatment were significantly different from the initial gene expression. 44 Our recent work found that Klf4 can exert sedative effects in pentobarbital‐treated mice through modulation of p53 and the Stat3 pathway in the hypothalamus. 45 Further study is needed to evaluate potential biphasic changes in Klf4 expression in the development of the seizure.

The western blotting study indicated that PTZ increased Klf4 expression, and the effect was reversed by Klf4‐KO. Further examination of a potential downstream mediator of these effects showed that p53 was also increased by PTZ, and the effect was reversed by Klf4‐KO. These results are consistent with a previous study which found that P53 was increased by PTZ treatment. 23 P53 as a downstream mediator of Klf4 is well studied in inhibition of proliferation and tumour suppression. 46 , 47 Elevated P53 levels have been reported in epilepsy animal models and the hippocampuis of epilespsy patients. 22 , 48 In the present study, Klf4‐KO regulated the Klf4‐p53 pathway and increased seizure scores. Recently, some evidence showed a regulatory role of p53 in neuronal activity. Deletion of p53 protects neurons from stress and damage. 49 , 50 It was also found that depletion of p53 attenuated cocaine‐induced kindling behaviours and associated c‐Fos immunoreactivity in the HP. 51 In addition, consistent with this hypothesis, we found that Klf4‐KO mice had increased p53 protein levels after PTZ treatment and PTZ increased interactions between Klf4 and p53 in the HP. These findings align with the results that the downregulation of p53 induced by Klf4 overexpression attenuated PTZ‐induced excessive neuronal activities.

To a certain extent, all of these effects involve alterations in brain excitability, which were consistent with both the immunohistochemistry and electrophysiology experiments. In the c‐Fos immunofluorescence study, in the DG of the HP and piriform cortex, PTZ was associated with increases in c‐Fos positive neurons. These effects were reversed by overexpression of Klf4. Consistent with the above findings, these results indicate that alterations in neuronal activity (and neuronal excitability) in the HP may contribute to the anticonvulsant effects of Klf4 overexpression. These results are consistent with a previous report showing that PTZ affects the HP, 25 and that Klf4 is involved in the inhibition of c‐Fos expression in the regions. Consistent with the Western blotting and immunohistochemical studies, the electrophysiological study found that overexpression of Klf4 reverses the increases in AP frequency in hippocampal pyramidal cells produced by PTZ.

Reprogramming factors (Klf4) might be potential molecular targets for neurogenesis. Febrile seizures or SE may lead to transient upregulation of adult neurogenesis in the HP 52 , 53 and may have a role in later epileptogenesis. Moreover, acute PTZ‐induced generalized tonic–clonic seizures were increased the number of proliferating cells in both the dentate gyrus and the subventricular zone. Therefore, increased Klf4 after a single PTZ administration may be related to neurogenesis and neuroprotection. In terms of its relationship to chronic seizure, Klf4 protein expression and neurogenesis may involve more complex mechanisms. Further study is needed to evaluate the detailed mechanisms.

In summary, the results of this study suggest that Klf4 is increased in PTZ‐induced seizures, and the mechanisms Klf4‐p53 pathway may be involved in the observed behavioural outcomes. Inhibition of this pathway by hippocampal Klf4‐KO exhibits proconvulsant effects. Similarly, overexpression of Klf4 in vitro showed anticonvulsant effects as shown by reduced action potential frequencies. These findings suggest that Klf4 may constitute a novel molecular target for the development of anticonvulsive agents. However, this study has some limitations that should be addressed in future research. First, the effects of Klf4 manipulation were only examined in the HP. Considering the potential impact of Klf4 in different neuronal populations or brain regions, future studies should explore its role in other areas of the brain. Additionally, investigating the function of Klf4 in other seizure models, such as genetic models or chronic epilepsy models, could provide a broader understanding of its role in epilepsy pathophysiology. The specific molecular mechanisms of the Klf4 anticonvulsant effects need to be further investigated, particularly under more chronic circumstances.

4 MATERIALS AND METHODS

4.1 Animals

Imprinting Control Region (ICR) strain male ICR mice (age: 6–8 weeks) were purchased from Jilin University (Changchun, China). Animals were housed in plastic cages (mice: 25.5 × 15 × 14 cm) and maintained in standard laboratory conditions (temperature: 23 ± 1°C, lights on and off: 07:00 and 19:00), with ad libitum access to food and water. All experiments were carried out in accordance with the Guide for Animal Experimentation of Jilin University and every effort was made to minimize any potential suffering experienced by the animals.

4.2 Drugs

PTZ was purchased from Sigma‐Aldrich (St. Louis, MO, USA). The drug was dissolved in sterile, pyrogen‐free saline. Doses of PTZ (70 mg/kg) were selected based on previous studies. 7 , 25

4.3 Experimental design

To investigate the effects of PTZ on Klf4 in mice and its related mechanisms, mice were divided into two groups: a control group (n = 6) and PTZ group (n = 6). To investigate the behaviour and molecular characterization of conditional hippocampal KO of Klf4 in mice, mice were divided into two groups: control mice (behaviour test: n = 6–8; molecular test: n = 6–9) and Klf4‐KO mice (behaviour test: n = 6–8; molecular test: n = 6–9). To examine the effects of conditional hippocampal Klf4‐KO on PTZ‐treated mice, mice were divided four groups: WT + saline (n = 8), WT + Klf4‐KO (n = 9), PTZ + WT (n = 6) and PTZ + Klf4‐KO (n = 9). Behavioural tests were conducted immediately after the onset of seizures. The mice were monitored for 30 min post‐seizure induction, and samples for molecular analysis were collected immediately after the behavioural tests. In addition, the effects of Klf4 overexpression on PTZ‐treated neurons, four groups: WT + saline (n = 10), LV‐Klf4 + saline (n = 10), PTZ + WT (n = 10) and PTZ + LV‐Klf4 (n = 10) were used in in vitro study. Figure 8 outlines the timeline and procedures for the experiments.

FIGURE 8 Experimental design and procedures. Experimental design and procedures. (A) In vivo study: Behavioral assessment following single PTZ injection and collection of brain tissue. (B) In vivo study: upper: Behavior and molecular characterization of conditional hippocampal Klf4‐KO mice; lower: The effect of conditional hippocampal Klf4‐KO on PTZ‐induced acute seizure mice behavior and brain tissue collection. (C) In vitro study: Electrophysiological recordings from hippocampal neurons.

4.4 Seizure latency after PTZ injection

Behavioural changes in the test subjects were monitored for 30 min after PTZ injection (65 mg/kg, ip). Seizure behaviour was categorized following the classification method outlined in our previous study 54 : Mice were taken from their home cages and placed individually into Plexiglas cages (25.5 × 15 × 14 cm) after PTZ injection and observed for 30 min. PTZ seizure scale: Stage 0, characterized by no response; Stage 1, exhibiting eating behaviour and facial twitching; Stage 2, displaying myoclonic body jerks; Stage 3, demonstrating forelimb clonus and rearing behaviour; Stage 4, experiencing clonic convulsions and turning onto the side; and Stage 5, showing generalized clonic convulsions and loss of righting. Additionally, the latencies for the onset of myoclonic jerks and clonic seizures were measured, with a maximum observation period of 30 min following the PTZ injection. 54 Mice were survived 30 min after PTZ injection.

4.5 Behaviour study

4.5.1 Y‐maze test

Y‐maze test was performed following a previously outlined protocol. 55 In summary, individual mice were introduced to one of the arms and given 8 min for unrestricted exploration. The alternation score (%) was computed using the following formula [(number of consecutive sets of three arm choices, each including all three arms)/(total arm entriesa−2)] × 100. An arm entry was recorded when all four limbs of the mouse were inside an arm.

4.5.2 Open field test

OFT was employed to assess locomotor and exploratory behaviours. Mice were individually placed in a black acrylic cylinder (diameter: 48.8 cm; height: 16 cm) divided into 19 equal squares by black lines. The horizontal and vertical locomotor activities of mice were recorded using a camera for a 6‐min duration. Each animal was tested only once. Following the trial, the chamber was cleaned to avoid any impact on the results of subsequent experiments. Detailed experimental procedures can be found in previous reports. 56 , 57

4.5.3 Forced swimming test

FST was carried out following the previously described method. 58 Mice were placed in a cylindrical transparent plastic tank with a diameter of 11 cm and a depth of 25 cm, filled with water to a depth of approximately 10 cm, and maintained at a temperature of 25 ± 1°C. After a 2‐min adaptation period, the observation was initiated in an environment free from external disturbances. The immobility time of mice were observed during the last 4 min. The FST was conducted in a quiet environment with no significant changes in lighting conditions. After each trial, mice were removed from the water and returned to their cages, and the water in the tank was replaced.

4.5.4 Tail suspension test

TST was also carried out following the previously described method. 59 The posterior one‐third of the tail of each mouse was taped and suspended approximately 40 cm above the ground for 6 min. Immobility time during the last 4 min was measured. Immobility was defined as a lack of active escape movements and maintaining a vertical position during suspension. To prevent mutual interference between mice during the experiment, opaque black partitions were used to separate individual mice, ensuring they did not come into contact with each other.

4.6 Klf4 conditional hippocampal KO mice and Klf4 overexpression

Conditional hippocampal Klf4‐KO mice were generated from Klf4 flox+ mice by hippocampal virus injection. Klf4 flox+ mice were constructed based on CRISPR/Cas9 by Biocytogen Pharmaceuticals (Beijing) Co., Ltd. All mice (6–8 weeks) shared the same C57/BL6J genetic background (Jackson Laboratory stock). Klf4 flox/flox mice were obtained by crossing Klf4 flox+ mice. Conditional hippocampal Klf4‐KO mice were generated by injection of pAAV‐CAMKIIa‐EGFP‐P2A‐Cre‐WPRE virus in the HP (AP: −2 mm; ML: +1.8 mm, DV: −2 mm) of Klf4 flox/flox mice. Viral‐mediated gene transfer of a Klf4 vector to over‐express Klf4 in the dorsal HP was studied using a lentivirus expression vector synthesized by Obio Technology (Shanghai, P.R. China). Klf4 was also constructed to a pLenti‐Ubc‐EGFP‐2A‐MCS‐3FLAG vector. Packages of pLenti viruses were provided by Obio Technology, Shanghai, China. Viral titers were 1×10E8 particles/mL for pLenti‐Ubc‐EGFP‐2A‐Klf4‐3FLAG, 1×10E9 particles/mL for pLenti‐Ubc‐EGFP‐2A‐MCS‐3FLAG‐control. Stereotaxic intra‐hippocampal injection was performed as described. Mice were deeply anaesthetised by intraperitoneal injection of pentobarbital (65 mg/kg). A volume of 0.5 μL pLenti‐Ubc‐EGFP‐2A‐Klf4‐3FLAG or pLenti‐Ubc‐EGFP‐2A‐MCS‐3FLAG was infused through a glass pipette (0.2 μL/min) bilaterally in the dorsal HP (1.5 mm ventral to skull surface, ±1.6 mm from the midline, and −1.8 mm anterior to bregma). The pipette was left in place for a minimum of 5 min following the injection to prevent backflow. Subsequent to the lentivirus injection, all animals were housed in a standard environment for 3 weeks for recovery before experiments began.

4.7 RNA extraction, reverse transcription PCR and real‐time PCR

Each mouse brain tissue (HP or PFC) sample was placed in 1 mL TRIzon reagent (CWBIO, China) following the manufacturer's instructions. cDNA synthesis was conducted according to the instructions of the reverse transcription kit (GenStar, China). Quantitative real‐time PCR was performed according to the instructions provided with the qPCR kit, utilizing the Genious 2X SYBR Green Fast qPCR Mix (Abclonal, China). GAPDH was used as an internal control. The primers used in qPCR were synthesized by Beijing Genomics Institution.

Primers used in qPCR were as follows:

Klf4‐forward sequence (5′‐TACACTGAGTCCCGAGGAACT‐3′).

Klf4‐reserve sequence (5′‐TACACTGAGTCCCGAGGAACT‐3′).

GAPDH‐forward sequence (5′‐AATGTGTCCGTCGTGGATCTG‐3′).

GAPDH‐reserve sequence (5′‐AGCCCAAGATGCCCTTCAGTG‐3′).

Primers used in genotyping were as follows:

3LoxP‐forward sequence (5′‐ATGGTTCCCATTGCAGGGATTCTGG‐3′).

3LoxP‐reserve sequence (5′‐AGTTGGCTCTGTTGAAACCCAAAGGA‐3′).

5'LoxP‐forward sequence (5′‐TGGGCGCACTCAGTCCACTATATT‐3′).

5LoxP‐reserve sequence (5′‐GGAACTGGACAGAACAGGAAGGCAG‐3′).

Klf4‐forward sequence (5′‐GAAGGGAGAAGACACTGCGTCCAG‐3′).

Klf4‐reserve sequence (5′‐TGTCACACTTCTGGCACTGAAAGGG‐3′).

4.8 Co‐immunoprecipitation

Brain tissue collection and protein extraction were the same as western blotting. Co‐immunoprecipitation was quantified using a Co‐IP kit (abs995, Absin, Shanghai, China) according to the manufacturer's instructions. Initially, 5 μL of Protein A and 5 μL of Protein G were integrated into the 500 μL sample and incubated at 4°C for 60 min, followed by centrifugation at 12,000g for 1 min at 4°C. One microgram of primary antibody (p53, mouse monoclonal antibody, ab26, Abcam, Shanghai, China; or Mouse IgG, A7028, Beyotime; as appropriate) was added to the supernatant and incubated overnight at 4°C with gentle mixing. The samples were then washed with 500 μL wash buffer (1×) and centrifuged at 12,000g for 1 min. Forty microlitres of SDS sample buffer (1×) was added to the precipitate, and the samples were added and incubated in a water bath at 95–100°C for 5 min. Followed by centrifugation at 14,000g for 1‐min, primary antibodies p53 (1:800, ab26, mouse monoclonal antibody, Abcam) and Klf4 (1:1000, ab129473, rabbit polyclonal antibody, Abcam, Shanghai, China) were added.

4.9 Western blotting for Klf4 and p53

Fresh bilateral whole HP was removed 30 min after PTZ administration. The tissue was homogenized by gently crushing the tissue 20–30 times in a glass tissue grinder in lysis buffer (137 mM NaCl, 20 mM TRIS, 1% NP40, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride (PMSF), 10 μg/mL aprotinin, 1 μg/mL leupeptin, 0.5 mM sodiumvanadate, and 0.5 mM sodium flouride) on ice. The homogenate was centrifuged at 10,000 rpm for 20 min at 4°C. Protein extracts were separated on 10% SDS‐PAGE gels and transferred to polyvinylidene difluoride membranes. Membranes were incubated overnight in Tris Buffered Saline/0.1% Tween‐20 with anti‐Klf4 (ab72543; 1:600; Abcam), p53 (sc6243;1:1000; Santa Cruz), and beta‐actin (ZB2301;1:8000). After multiple washes with Tris‐buffered saline containing Tween 20, the membranes were incubated with the respective peroxidase‐labelled secondary antibody (goat anti‐rabbit IgG‐HRP ZB‐2301; 1:500 for Klf4, 1:1500 for p53 and 1:5000 for beta‐actin; ZSGB‐BIO).

4.10 C‐Fos immunofluorescence

Two hours after the PTZ injection, mice were deeply anaesthetised with 65 mg/kg pentobarbital and perfused transcardially with 0.1 M phosphate buffered saline (PBS), followed by 4% paraformaldehyde in PB (pH 7.4). The brains were carefully extracted from the skull and post‐fixed with 4% paraformaldehyde for 24 h, followed by 30% sucrose in PBS for 3 days. The HP was sectioned into 15‐μm coronal slices with a cryostat (Leica CM1860; Leica Microsystems, Germany). The sections were rinsed in PBS and then blocked by 10% goat serum for 60 min and then rinsed in 0.1 M PBS. Primary c‐Fos antibodies (sc253; 1:1000; Santa Cruz Biotechnology) were diluted to 1:1000 and incubated overnight at 4°C on a rotating shaker. Following the three washes with 0.1 M PBS, the sections were incubated in Alexa Fluor 594‐conjugated goat anti‐rabbit secondary antibody (A11012; 1:1000; Zhongshan) for 1 h at room temperature. Subsequently, the slices were imaged using an Olympus microscope (BX51).

4.11 Electrophysiology

4.11.1 Cell culture

Primary HP neurons were cultured from embryonic Day 17–18 C57BL/6J mice on plates coated with poly‐L‐lysine (Sigma; molecular weight 300,000). The neurons were maintained in Neurobasal A media (Invitrogen) supplemented with B27 (Invitrogen), Glutamax™ (Thermo Fisher Scientific) and Antibiotic‐AntiMYCotic (Thermo Fisher Scientific). Hippocampal neurons were cultured for 12 days, and then the constructed Klf4 overexpression vectors were transfected for 24 h. The neurons were treated with 10 mM PTZ for 24 h, and then cells were used for electrophysiological recordings.

4.11.2 Patch clamp recordings

Neuronal membrane potentials were assessed via whole‐cell current‐clamp recordings by using a MultiClamp 700B amplifier (Molecular Devices, USA). A culture dish containing cells was positioned on the stage of an inverted microscope (BX51WI; Olympus, Japan), while patch pipettes, filled with an intracellular solution comprising 130 K‐gluconate, 20 KCl, 10 HEPES, 4 Mg‐ATP, 0.5 Na3‐GTP and 0.2 EGTA. The pH was adjusted to 7.3 with 10 M KOH and the osmolarity was set between 280 and 300 mOsm. Resistance of the pipette ranged between 3 and 5 MΩ. Recordings were performed only when the series resistance was below 20 MΩ. To enhance the quality of recording from pyramidal neurons, phase‐bright cells with noticeably large, pyramidal soma were preferentially selected. Cultured neurons featuring modest dendritic arborizations, elongated axons, and soma diameters ranging from 15 to 25 μm were chosen for electrophysiological assessments. Monitoring of whole‐cell resistance and resting membrane potential were used as an index, ensuring stability in these parameters during the experiment. Data acquisition and analysis were facilitated using Clamp‐fit 10.3 software (Axon, USA).

4.11.3 Statistical analyses

All data are expressed as mean ± SEM. Statistical analyses were conducted using SPSS Statistics for Windows, Version 20.0 (Armonk, NY, USA). Differences between the experimental groups were compared using one‐way or two‐way analysis of variance (ANOVA) with factor 1 (PTZ treatment) and factor 2 treatment (Klf4‐KO or overexpression), and Tukey's HSD post hoc test for comparisons between means. A significance level of p < 0.05 was considered statistically significant.

AUTHOR CONTRIBUTIONS

Bingjin Li: Conceptualization (equal); investigation (equal); writing – original draft (equal); writing – review and editing (equal). Jingjing Piao: Methodology (equal); writing – review and editing (equal). Xinmiao Piao: Data curation (equal); formal analysis (equal); methodology (equal); project administration (equal). Zihui Geng: Data curation (equal); formal analysis (equal); methodology (equal). Ziqian Cheng: Supervision (equal); validation (equal); visualization (equal). Xiaohan Zou: Methodology (equal); resources (equal); software (equal). Huiyi Jiang: Funding acquisition (equal); investigation (equal); writing – review and editing (equal).

FUNDING INFORMATION

This work was supported by NSFC [The National Natural Science Foundation of China, grant number 82371540], Project of Jilin University Education and Teaching Reform & Research (No. 2022JGY021), Department of Science and Technology of Jilin Province (No. 20200201504JC). Thank you so much for Song Qin for providing valuable comments on the construction of Klf4‐KO mice.

CONFLICT OF INTEREST STATEMENT

Not applicable.

DATA AVAILABILITY STATEMENT

Not applicable.
==== Refs
REFERENCES

1 Hauser WA , Annegers JF , Rocca WA . Descriptive epidemiology of epilepsy: contributions of population‐based studies from Rochester, Minnesota. Mayo Clin Proc. 1996;71 :576‐586. doi:10.4065/71.6.576 8642887
2 Sabers A , Bertelsen FC , Scheel‐Kruger J , Nyengaard JR , Moller A . Long‐term valproic acid exposure increases the number of neocortical neurons in the developing rat brain. A possible new animal model of autism. Neurosci Lett. 2014;580 :12‐16. doi:10.1016/j.neulet.2014.07.036 25079904
3 Goodman WK , Charney DS , Price LH , Woods SW , Heninger GR . Ineffectiveness of clonidine in the treatment of the benzodiazepine withdrawal syndrome: report of three cases. Am J Psychiatry. 1986;143 :900‐903. doi:10.1176/ajp.143.7.900 2872826
4 Su JA , Cheng BH , Huang YC , et al. Bipolar disorder and the risk of fracture: a nationwide population‐based cohort study. J Affect Disord. 2017;218 :246‐252. doi:10.1016/j.jad.2017.04.037 28477503
5 Ghaleb AM , Yang VW . Krüppel‐like factor 4 (KLF4): what we currently know. Gene. 2017;611 :27‐37. doi:10.1016/j.gene.2017.02.025 28237823
6 Takahashi K , Yamanaka S . Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell. 2006;126 :663‐676. doi:10.1016/j.cell.2006.07.024 16904174
7 Akaogi K , Nakajima Y , Ito I , et al. KLF4 suppresses estrogen‐dependent breast cancer growth by inhibiting the transcriptional activity of ERalpha. Oncogene. 2009;28 :2894‐2902. doi:10.1038/onc.2009.151 19503094
8 Cho YG , Song JH , Kim CJ , et al. Genetic and epigenetic analysis of the KLF4 gene in gastric cancer. APMIS. 2007;115 :802‐808. doi:10.1111/j.1600-0463.2007.apm_643.x 17614846
9 Dong HM , Huang L . Role of the transcription factor Krüppel‐like factor 4 (KLF4) in the pathogenesis of atherosclerosis. Zhonghua Xin Xue Guan Bing Za Zhi. 2009;37 :950‐952.20137554
10 Pérez‐Monter C , Martínez‐Armenta M , Miquelajauregui A , et al. The Kruppel‐like factor 4 controls biosynthesis of thyrotropin‐releasing hormone during hypothalamus development. Mol Cell Endocrinol. 2011;333 :127‐133. doi:10.1016/j.mce.2010.12.020 21182892
11 Qin S , Zhang CL . Role of Kruppel‐like factor 4 in neurogenesis and radial neuronal migration in the developing cerebral cortex. Mol Cell Biol. 2012;32 :4297‐4305. doi:10.1128/MCB.00838-12 22907754
12 Zhu S , Tai C , MacVicar BA , Jia W , Cynader MS . Glutamatergic stimulation triggers rapid Krupple‐like factor 4 expression in neurons and the overexpression of KLF4 sensitizes neurons to NMDA‐induced caspase‐3 activity. Brain Res. 2009;1250 :49‐62. doi:10.1016/j.brainres.2008.11.013 19041854
13 Moore DL , Blackmore MG , Hu Y , et al. KLF family members regulate intrinsic axon regeneration ability. Science. 2009;326 :298‐301. doi:10.1126/science.1175737 19815778
14 Xu JH , Qin XZ , Zhang HN , et al. Deletion of Krüppel‐like factor‐4 promotes axonal regeneration in mammals. Neural Regen Res. 2021;16 :166‐171. doi:10.4103/1673-5374.286978 32788472
15 Nakahara Y , Northcott PA , Li M , et al. Genetic and epigenetic inactivation of Kruppel‐like factor 4 in medulloblastoma. Neoplasia. 2010;12 :20‐27. doi:10.1593/neo.91122 20072650
16 Su C , Sun F , Cunningham RL , Rybalchenko N , Singh M . ERK5/KLF4 signaling as a common mediator of the neuroprotective effects of both nerve growth factor and hydrogen peroxide preconditioning. Age (Dordr). 2014;36 :9685. doi:10.1007/s11357-014-9685-5 25015774
17 Cui DM , Zeng T , Ren J , et al. KLF4 knockdown attenuates TBI‐induced neuronal damage through p53 and JAK‐STAT3 signaling. CNS Neurosci Ther. 2017;23 :106‐118. doi:10.1111/cns.12633 27671232
18 Cheng Z , Zou X , Jin Y , et al. The role of KLF(4) in Alzheimer's disease. Front Cell Neurosci. 2018;12 :325. doi:10.3389/fncel.2018.00325 30297986
19 Li L , Zi X , Hou D , Tu Q . Kruppel‐like factor 4 regulates amyloid‐beta (Abeta)‐induced neuroinflammation in Alzheimer's disease. Neurosci Lett. 2017;643 :131‐137. doi:10.1016/j.neulet.2017.02.017 28189744
20 Chen Y , Chen J , Chen Y , Li Y . miR‐146a/KLF4 axis in epileptic mice: a novel regulator of synaptic plasticity involving STAT3 signaling. Brain Res. 2022;1790 :147988. doi:10.1016/j.brainres.2022.147988 35728661
21 Amit M , Anastasaki C , Dantzer R , et al. Next directions in the neuroscience of cancers arising outside the CNS. Cancer Discov. 2024;14 :669‐673. doi:10.1158/2159-8290.Cd-23-1495 38571430
22 Wang K , Wu J , Wang J , Jiang K . miR‐485's anti‐drug resistant epilepsy effects by regulating SV2A/PSD‐95 and targeting ABCC1 and neuronal signaling‐transduction proteins in hippocampus of rats. Brain Behav. 2021;11 :e2247. doi:10.1002/brb3.2247 34291586
23 Ding DX , Tian FF , Guo JL , et al. Dynamic expression patterns of ATF3 and p53 in the hippocampus of a pentylenetetrazole‐induced kindling model. Mol Med Rep. 2014;10 :645‐651. doi:10.3892/mmr.2014.2256 24859284
24 Wang W , Ma YM , Jiang ZL , Gao ZW , Chen WG . Apoptosis‐antagonizing transcription factor is involved in rat post‐traumatic epilepsy pathogenesis. Exp Ther Med. 2021;21 :290. doi:10.3892/etm.2021.9721 33717233
25 Li B , Tang F , Wang L , et al. Anticonvulsant effects of Fuzi total alkaloid on pentylenetetrazole‐induced seizure in mice. J Pharmacol Sci. 2013;123 :195‐198. doi:10.1254/jphs.13057sc 24096829
26 Vendrell M , Tusell JM , Serratosa J . Effect of gamma‐hexachlorocyclohexane and its isomers on proto‐oncogene c‐fos expression in brain. Neurotoxicology. 1992;13 :301‐308.1380685
27 Li B , Suemaru K , Cui R , Kitamura Y , Gomita Y , Araki H . Repeated electroconvulsive stimuli increase brain‐derived neurotrophic factor in ACTH‐treated rats. Eur J Pharmacol. 2006;529 :114‐121. doi:10.1016/j.ejphar.2005.11.009 16330021
28 Li B , Suemaru K , Cui R , Araki H . Repeated electroconvulsive stimuli have long‐lasting effects on hippocampal BDNF and decrease immobility time in the rat forced swim test. Life Sci. 2007;80 :1539‐1543. doi:10.1016/j.lfs.2007.01.032 17306836
29 Aygun H . Trazodone increases seizures in a genetic WAG/Rij rat model of absence epilepsy while decreasing them in penicillin‐evoked focal seizure model. Epilepsy Behav. 2020;103 :106847. doi:10.1016/j.yebeh.2019.106847 31864946
30 Devinsky O , Vezzani A , Najjar S , De Lanerolle NC , Rogawski MA . Glia and epilepsy: excitability and inflammation. Trends Neurosci. 2013;36 :174‐184. doi:10.1016/j.tins.2012.11.008 23298414
31 Yang QQ , Zhou JW . Neuroinflammation in the central nervous system: symphony of glial cells. Glia. 2019;67 :1017‐1035. doi:10.1002/glia.23571 30548343
32 Zhang X , Wang L , Han Z , et al. KLF4 alleviates cerebral vascular injury by ameliorating vascular endothelial inflammation and regulating tight junction protein expression following ischemic stroke. J Neuroinflammation. 2020;17 :107. doi:10.1186/s12974-020-01780-x 32264912
33 Zhao K , Liu J , Sun T , et al. The miR‐25802/KLF4/NF‐κB signaling axis regulates microglia‐mediated neuroinflammation in Alzheimer's disease. Brain Behav Immun. 2024;118 :31‐48. doi:10.1016/j.bbi.2024.02.016 38360375
34 Feinberg MW , Cao Z , Wara AK , Lebedeva MA , SenBanerjee S , Jain MK . Kruppel‐like factor 4 is a mediator of proinflammatory signaling in macrophages. J Biol Chem. 2005;280 :38247‐38258. doi:10.1074/jbc.M509378200 16169848
35 Kaushik DK , Gupta M , Das S , Basu A . Krüppel‐like factor 4, a novel transcription factor regulates microglial activation and subsequent neuroinflammation. J Neuroinflammation. 2010;7 :68. doi:10.1186/1742-2094-7-68 20946687
36 Lin XY , Cui Y , Wang L , Chen W . Chronic exercise buffers the cognitive dysfunction and decreases the susceptibility to seizures in PTZ‐treated rats. Epilepsy Behav. 2019;98 :173‐187. doi:10.1016/j.yebeh.2019.07.032 31377659
37 Wi S , Yu JH , Kim M , Cho SR . In vivo expression of reprogramming factors increases hippocampal neurogenesis and synaptic plasticity in chronic hypoxic‐ischemic brain injury. Neural Plast. 2016;2016 :2580837. doi:10.1155/2016/2580837 27900211
38 Wu X , Gao Y , Shi C , et al. Complement C1q drives microglia‐dependent synaptic loss and cognitive impairments in a mouse model of lipopolysaccharide‐induced neuroinflammation. Neuropharmacology. 2023;237 :109646. doi:10.1016/j.neuropharm.2023.109646 37356797
39 Tao X , Yan M , Wang L , et al. Homeostasis imbalance of microglia and astrocytes leads to alteration in the metabolites of the kynurenine pathway in LPS‐induced depressive‐like mice. Int J Mol Sci. 2020;21 (4 ):1460. doi:10.3390/ijms21041460 32098023
40 During MJ , Ryder KM , Spencer DD . Hippocampal GABA transporter function in temporal‐lobe epilepsy. Nature. 1995;376 :174‐177. doi:10.1038/376174a0 7603569
41 Veremeyko T , Jiang R , He M , Ponomarev ED . Complement C4‐deficient mice have a high mortality rate during PTZ‐induced epileptic seizures, which correlates with cognitive problems and the deficiency in the expression of Egr1 and other immediate early genes. Front Cell Neurosci. 2023;17 :1170031. doi:10.3389/fncel.2023.1170031 37234916
42 Wei Y , Chen T , Bosco DB , et al. The complement C3‐C3aR pathway mediates microglia‐astrocyte interaction following status epilepticus. Glia. 2021;69 :1155‐1169. doi:10.1002/glia.23955 33314324
43 Zhuo Z , Wang Y , Kong H , Fu T . GKLF, a transcriptional activator of Txnip, drives microglia activation in kainic acid‐induced murine models of epileptic seizures. Int Immunopharmacol. 2023;121 :110426. doi:10.1016/j.intimp.2023.110426 37295029
44 Nishiguchi M , Kikuyama H , Kanazawa T , et al. Increases in iPS transcription factor (Oct4, Sox2, c‐Myc, and Klf4) gene expression after modified electroconvulsive therapy. Psychiatry Investig. 2015;12 :532‐537. doi:10.4306/pi.2015.12.4.532
45 Cheng Z , Yang W , Li B , Cui R . KLF4 exerts sedative effects in pentobarbital‐treated mice. J Mol Neurosci. 2021;71 :596‐606. doi:10.1007/s12031-020-01680-y 32789565
46 Farrugia MK , Vanderbilt DB , Salkeni MA , Ruppert JM . Kruppel‐like pluripotency factors as modulators of cancer cell therapeutic responses. Cancer Res. 2016;76 :1677‐1682. doi:10.1158/0008-5472.Can-15-1806 26964625
47 Li P , Sun X , Ma Z , et al. Transcriptional reactivation of OTX2, RX1 and SIX3 during reprogramming contributes to the generation of RPE cells from human iPSCs. Int J Biol Sci. 2016;12 :505‐517. doi:10.7150/ijbs.14212 27019633
48 Morrison RS , Wenzel HJ , Kinoshita Y , Robbins CA , Donehower LA , Schwartzkroin PA . Loss of the p53 tumor suppressor gene protects neurons from kainate‐induced cell death. J Neurosci. 1996;16 :1337‐1345. doi:10.1523/jneurosci.16-04-01337.1996 8778285
49 Liu T , Wang F , LePochat P , et al. Cofilin‐mediated neuronal apoptosis via p53 translocation and PLD1 regulation. Sci Rep. 2017;7 :11532. doi:10.1038/s41598-017-09996-3 28912445
50 Lu Z , Miao Y , Muhammad I , et al. Colistin‐induced autophagy and apoptosis involves the JNK‐Bcl2‐Bax signaling pathway and JNK‐p53‐ROS positive feedback loop in PC‐12 cells. Chem Biol Interact. 2017;277 :62‐73. doi:10.1016/j.cbi.2017.08.011 28842171
51 Mai HN , Sharma N , Jeong JH , et al. P53 knockout mice are protected from cocaine‐induced kindling behaviors via inhibiting mitochondrial oxidative burdens, mitochondrial dysfunction, and proapoptotic changes. Neurochem Int. 2019;124 :68‐81. doi:10.1016/j.neuint.2018.12.017 30597180
52 Parent JM , Yu TW , Leibowitz RT , Geschwind DH , Sloviter RS , Lowenstein DH . Dentate granule cell neurogenesis is increased by seizures and contributes to aberrant network reorganization in the adult rat hippocampus. J Neurosci. 1997;17 :3727‐3738. doi:10.1523/jneurosci.17-10-03727.1997 9133393
53 Jessberger S , Zhao C , Toni N , Clemenson GD Jr , Li Y , Gage FH . Seizure‐associated, aberrant neurogenesis in adult rats characterized with retrovirus‐mediated cell labeling. J Neurosci. 2007;27 :9400‐9407. doi:10.1523/jneurosci.2002-07.2007 17728453
54 Li B , Wang L , Sun Z , et al. The anticonvulsant effects of SR 57227 on pentylenetetrazole‐induced seizure in mice. PLoS One. 2014;9 :e93158. doi:10.1371/journal.pone.0093158 24690630
55 Meng L , Zou L , Xiong M , et al. A synapsin I cleavage fragment contributes to synaptic dysfunction in Alzheimer's disease. Aging Cell. 2022;21 :e13619. doi:10.1111/acel.13619 35443102
56 Fan J , Li B , Ge T , et al. Berberine produces antidepressant‐like effects in ovariectomized mice. Sci Rep. 2017;7 :1310. doi:10.1038/s41598-017-01035-5 28465511
57 Cheng Z‐Q , Fan J , Zhao FY , et al. Fasting produces antidepressant‐like effects via activating mammalian target of rapamycin complex 1 signaling pathway in ovariectomized mice. Neural Regen Res. 2023;18 :2075‐2081. doi:10.4103/1673-5374.367928 36926734
58 Jin Y , Pang H , Zhao L , et al. Ginseng total saponins and Fuzi total alkaloids exert antidepressant‐like effects in ovariectomized mice through BDNF‐mTORC1, autophagy and peripheral metabolic pathways. Phytomedicine. 2022;107 :154425. doi:10.1016/j.phymed.2022.154425 36137328
59 Iyer KA , Alix K , Eltit JM , et al. Multi‐modal antidepressant‐like action of 6‐ and 7‐chloro‐2‐aminodihydroquinazolines in the mouse tail suspension test. Psychopharmacology. 2019;236 :2093‐2104. doi:10.1007/s00213-019-05203-5 30805668
