
==== Front
Food Nutr Res
Food Nutr Res
FNR
Food & Nutrition Research
1654-661X
Open Academia

10738
10.29219/fnr.v68.10738
Original Article
Exploring the anti-obesity effects of kimchi through enhanced thermogenesis in differentiated T37i brown adipocytes
Yun Ye-Rang 1*
Lee Ji-Eun 1
Lee Seongsoo 2
Hong Sung Wook 1*
1 World Institute of Kimchi, Gwangju, Republic of Korea
2 Gwangju Center, Korea Basic Science Institute (KBSI), Gwangju, Republic of Korea
* Ye-Rang Yun, World Institute of Kimchi, Nam-Gu, Gwangju 61755, Republic of Korea. Tel.: +82 62 610 1849. Email: yunyerang@wikim.re.kr
* Sung Wook Hong, World Institute of Kimchi, Nam-Gu, Gwangju 61755, Republic of Korea. Tel.: +82 62 610 1760. Email: swhong@wikim.re.kr
29 8 2024
2024
68 10.29219/fnr.v68.1073803 5 2024
24 6 2024
15 7 2024
© 2024 Ye-Rang Yun et al.
2024
https://creativecommons.org/licenses/by/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), allowing third parties to copy and redistribute the material in any medium or format and to remix, transform, and build upon the material for any purpose, even commercially, provided the original work is properly cited and states its license.
Background

Previous research has demonstrated the anti-obesity effects of kimchi in 3T3-L1 adipocytes and mice with diet-induced obesity by assessing the expression of obesity-associated genes. Additionally, recent studies have identified mechanisms involving thermogenesis that support these effects.

Objective

This study aims to further investigate the anti-obesity properties of kimchi, focusing on its impact on thermogenic activity in differentiated T37i brown adipocytes.

Design

The study first evaluated the antioxidant potential of kimchi using total antioxidant capacity (TAC) and ferric reducing antioxidant power (FRAP) assays. Optimal differentiation conditions for T37i adipocytes were established before proceeding with evaluations of cell viability, intracellular triglyceride (TG) content, lipid accumulation, and the expression of genes and proteins related to obesity and thermogenesis.

Results

Kimchi maintained over 90% cell viability in T37i adipocytes at concentrations up to 1,000 μg/mL. Efficient differentiation of T37i preadipocytes was achieved using a medium containing 10% calf serum, 2 nM 3,3’,5-triiodo-L-thyronin (T3), and 100 nM insulin. Kimchi significantly reduced intracellular TG levels and lipid accumulation, compared to the control group, and enhanced the expression of genes and proteins related to thermogenesis while reducing the expression of obesity-related genes.

Discussion

The findings suggest that kimchi exerts its anti-obesity effects by modulating thermogenic and obesity-related pathways in brown adipocytes, which may be partially attributed to its antioxidant properties.

Conclusions

Kimchi shows promise as a preventive measure against obesity by influencing metabolic pathways associated with both obesity and thermogenesis in T37i brown adipocytes.

Graphic Abstract

Keywords

kimchi
obesity
thermogenesis
brown adipocytes
gene expression
Funding This research received support from the World Institute of Kimchi (KE2301-2 and KE(C)2203) and was funded by the Ministry of Science and ICT, Republic of Korea.
==== Body
pmcPopular scientific summary

We establish the more efficient differentiation condition of T37i brown adipocyte.

Kimchi inhibits intracellular triglyceride and lipid accumulation in T37i brown adipocytes.

Kimchi shows an anti-obesity effect by regulation of obesity-related biomarkers as well as thermogenesis-related biomarkers.

This study is the first evidence of kimchi’s anti-obesity impact through the regulation of thermogenic effect.

Interest in kimchi has been steadily increasing because of its recognition as a health beneficial food, particularly in the context of the COVID-19 pandemic. Consequently, numerous studies have delved into its health advantages (1–3). Kim et al. demonstrated that Lactobacillus sakei HEM 224, extracted from kimchi, alleviated inflammatory conditions in the gastrointestinal and respiratory tracts by bolstering the epithelial barrier and modulating the immune response (3). In another investigation, kimchi consumption effectively mitigated obesity by regulating neuroinflammation and addressing microbiota imbalance (1). The health-promoting properties of kimchi have been attributed to its active constituents, namely lactic acid bacteria (LAB), and the metabolites resulting from kimchi fermentation (4, 5). Our prior studies have shown that these active constituents can inhibit endoplasmic reticulum (ER) stress-induced hepatic steatosis both in vitro and in vivo (4). Furthermore, kimchi supplemented with LAB, known for their anti-obesity effects, exhibited enhanced efficacy against obesity in 3T3-L1 cells (5).

Among kimchi’s various health benefits, its anti-obesity effects have been extensively studied. Previous investigations have focused on the anti-obesity properties of kimchi using 3T3-L1 white adipocytes and high-fat diet-fed animal models (5–7). Our previous research demonstrated the anti-obesity potential of LAB-containing kimchi in differentiated 3T3-L1 cells (5). Hong et al. documented that kimchi enriched with catechins and LAB exhibited anti-obesity effects in high-fat diet-induced obese mice by modulating lipid metabolism and the gut microbiome (6). Similarly, our earlier study revealed that kimchi supplemented with citrus concentrate exerted anti-obesity effects in high-fat diet-induced obese mice (7). Additionally, we confirmed the anti-obesity effects of LAB-fortified kimchi in high-fat diet-induced obese mice (8).

Recent studies have explored the anti-obesity effects of thermogenesis by assessing the expression of thermogenic-specific genes and proteins, such as uncoupling protein-1 (UCP-1), peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α), and PR domain-containing 16 (PRDM16) in white adipocytes and tissues, aligning with current research trends (9, 10). Choi et al. observed that treatment with Paeonia lactiflora root enhanced levels of UCP-1, PGC-1α, and PRDM16 in 3T3-L1 cells, thereby exerting anti-obesity effects (9). Similarly, in obese mice, (20R)-panaxadiol demonstrated anti-obesity effects by upregulating the expression of thermogenic proteins (10). Among these anti-obesity mechanisms through thermogenesis, AMP-activated protein kinase (AMPK) pathway is a predominant pathway that is closely involved in brown adipose tissue differentiation and activation (11). AMPK activation not only indirectly modulated a UCP-1 protein, which increase thermogenic activity, but also induced related biomarker expression (12). Similarly, kimchi active components and kimchi also induced AMPK activation in our previous studies (13, 14). Therefore, kimchi anti-obesity effect of kimchi through thermogenesis is expected. Although studies on the anti-obesity effect of thermogenesis have been extensively conducted, there is little study focusing on brown adipocytes.

Thus, this study aimed to explore the anti-obesity effects of thermogenesis in T37i brown adipocytes. Initially, we assessed the antioxidant activity of kimchi. Subsequently, after establishing optimal differentiation conditions for T37i adipocytes, we investigated the anti-obesity properties of kimchi by evaluating parameters such as cell viability, triglyceride (TG) levels, lipid accumulation, and the expression of obesity/thermogenesis-related genes and proteins.

Materials and methods

Chemicals

3,3’,5-Triiodo-L-thyronin (T3), insulin, oil-red O (ORO) solution, and a total antioxidant capacity (TAC) kit were sourced from Sigma-Aldrich (MO, USA). The FRAP assay kit was acquired from Ann Arbor Biotechnology (MI, USA). The Cell Counting Kit-8 (CCK-8) was obtained from Dojindo (Kumamoto, Japan). The triglyceride assay kit was procured from Asan Pharmaceutical (Seoul, Korea). The TRIzolTM reagent was purchased from Invitrogen (Carlsbad, CA, USA). The TOPScriptTM cDNA Synthesis Kit and SYBR Green premix were obtained from Enzynomics, Inc. (Daejeon, Korea). RIPA buffer was sourced from Thermo Fisher Scientific (Waltham, MA, USA). Primary and secondary antibodies for western blotting were purchased from Cell Signaling Technology (Danvers, MA, USA).

Preparation of kimchi

Kimchi was prepared using brined cabbage, red pepper, garlic, ginger, onion, radish, and other ingredients. Fermentation of kimchi was carried out until reaching a pH of 4.2 at 6°C, followed by freeze-drying for subsequent analysis.

Capsaicinoid analysis

For capsaicinoid extraction, 2.5 g of homogenized kimchi was weighed and combined with glass beads (size 4) in 22 mL clear vials equipped with a PTFE liner (Supelco, USA). Subsequently, 15 mL of methanol was added. The vials were capped, heated in a block at 90°C for 1 h, cooled to room temperature (RT, 15–25°C), transferred into 25 mL volumetric flasks, and filled with methanol. Samples were then filtered through disposable syringes with 0.2 μm filters (Millipore, USA) and subjected to capsaicinoid content determination using high-performance liquid chromatography (HPLC) with a Lachrom Ultra C18 column (50 mm × 2.0 mm, 2 μm; Hitachi, Japan) and an Agilent 1260 infinity LC system equipped with a fluorescence detector (Agilent Technologies, USA). The analysis conditions were as follows: mobile phase A, 0.1% acetic acid; mobile phase B, acetonitrile; isocratic condition A: B = 6:4; flow rate of 0.6 mL/min; excitation wavelength of 280 nm, emission wavelength of 325 nm; column temperature of 25°C; and injection volume of 2 μL.

Antioxidant activity analysis

The antioxidant activity of kimchi was assessed through TAC and FRAP assays. TAC analysis was conducted using a commercial kit. Cu2+ working solution was incubated with various concentrations of kimchi samples (0, 50, 100, 250, 500, 1,000, and 2,500 μg/mL) for 90 min at RT. Absorbance was measured at 570 nm, and the TAC value was expressed in nM based on the Trolox standard. FRAP analysis was performed using a commercial kit. The FRAP color solution was incubated with various concentrations of kimchi samples (0, 50, 100, 250, 500, 1,000, and 2,500 μg/mL) for 30 min at RT, and absorbance was measured at 560 nm. FRAP values were expressed in μM based on the Fe (II) standard.

Cell culture and cell viability analysis

T37i mouse brown adipocytes were procured from Millipore (Billerica, MA, USA) and cultured in DMEM/F12 supplemented with HEPES, l-glutamine (10% fetal bovine serum (FBS), and 1% penicillin/streptomycin). Cell viability was assessed using a CCK-8 kit. T37i preadipocytes (1 × 104 cells/well) were seeded and treated with kimchi (0, 50, 100, 250, 500, 1,000, and 2,500 μg/mL) for 1 day. After washing with PBS, cells were incubated with 20 μL CCK-8 solution for 2 h, and absorbance was measured at 450 nm.

Optimal differentiation condition analysis

To determine the optimal differentiation conditions for T37i preadipocytes, a differentiation condition test was conducted considering the type of serum (FBS and calf serum (CS)) and the composition of the differentiation medium (ratio of T3 to insulin: 2 nM + 20 nM, 2 nM + 40 nM, and 2 nM + 100 nM). Optimal conditions were evaluated based on ORO-stained images and intensities. Subsequent experiments were performed under the identified optimal conditions (2 nM T3 and 100 nM insulin for 9 days).

Intracellular triglyceride content analysis

Lipids from differentiated T37i adipocytes were extracted using a solvent mixture (700 μL, chloroform/methanol/H2O mixture, 8:4:3, v/v/v), as previously described (15). Extracted lipids were incubated at room temperature for 60 min, and the organic layer was obtained by centrifugation at 800 × g for 10 min and dried. Dried lipids were dissolved in ethanol (20 μL), and triglyceride content was measured (Asan Pharmaceutical, Seoul, Korea).

Oil-red O staining analysis

Differentiated T37i adipocytes were rinsed and fixed in 10% formalin for 30 min. Subsequently, the cells were stained with ORO solution for 15 min at RT and then washed. For lipid quantification, the stained cells were extracted with isopropanol, and the absorbance was measured at 510 nm.

Quantitative real-time polymerase chain reaction analysis

Total RNA was extracted using the TRIzolTM reagent, and cDNA synthesis was performed using a cDNA synthesis kit. Quantitative real-time polymerase chain reaction (qPCR) of the synthesized cDNA was performed using SYBR Green Premix and primers (Table 1). The qPCR protocol involved an initial activation step at 94°C for 10 min, followed by 45 cycles of denaturation at 94°C for 15 s, and annealing/extension at 60°C for 1 min. The qPCR results were normalized to those of GAPDH.

Table 1 Primer sequences for quantitative real-time PCR

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)	
GAPDH	GTATGACTCCACTCACGGCAAA	GGTGTGGCTCCTGGAAGATG	
Obesity-related gene	
aP2	CATGGCCAAGCCCAACAT	CGCCCAGTTTGAAGGAAATC	
C/EBPα	AGGTGCTGGAGTTGACCAGT	CAGCCTAGAGATCCAGCGAC	
FAS	TCTGAGCAGGTGCAGGAGGA	GTTGTTCCTCCAGTTCCGATTTGTA	
LXRα	CTCAATGCCTGATGTTTCTCCT	TCCAACCCTATCCCTAAAGCAA	
PPARγ	TGGAATTAGATGACAGCGACTTGG	CTGGAGCAGCTTGGCAAACA	
SREBP-1c	AGAGGGTGAGCCTGACAA	CCTCTGCAATTTCCAGAT	
Thermogenesis-related gene	
CIDEA	ATCACAACTGGCCTGGTTACG	TACTACCCGGTGTCCATTTCT	
CtBP1	TTGGGCATCATTGGACTAGGT	TAACGCAGTCACTGTGGAAGA	
PGC-1α	GCAGCCAAGACTCTGTATG	ATTGGTCGCTACACCACTTC	
PPIA	CAAATGCTGGACCAAACACAA	GCCATCCAGCCATTCAGTCT	
PRDM16	ATGCGAGGTCTGCCACAAGT	CTGCCAGGCGTGTAATGGTT	
UCP-1	GGCCTCTACGACTCAGTCCA	TAAGCCGGCTGAGATCTTGT	
PCR, Polymerase chain reaction.

Western blot analysis

Differentiated T37i adipocytes were lysed with RIPA buffer (Invitrogen, Thermo Fisher Scientific, USA) on ice for 1 h, followed by centrifugation at 10,000 × g for 10 min at 4°C. Proteins (30 μg) were separated by electrophoresis and transferred to membranes (Bio-Rad, Hercules, CA, USA). The membranes were then incubated with primary antibodies, including GAPDH, UCP-1, PGC-1α, and PRDM16 (1:1,000, Cell Signaling Technology, Danvers, MA, USA), followed by incubation with anti-rabbit secondary antibodies (Cell Signaling Technology, Danvers, MA, USA). Protein bands were visualized using an enhanced chemiluminescence system (ECL Advance; GE Healthcare, Hatfield, UK). Protein density was quantified using the Image J 1.53 program (NIH, USA).

Statistical analysis

All experiments were conducted in triplicate. Data are presented as mean ± standard deviation (SD). Significant differences were determined using Student’s t-test (two groups) and one-way analysis of variance (ANOVA, for three or more groups), followed by Dunnett’s multiple comparison test using GraphPad Prism 9 (GraphPad, Inc., San Diego, CA, USA). Statistical significance was set at P < 0.05.

Results and discussion

Capsaicinoid content of kimchi

The capsaicinoid content was quantified using HPLC as a representative active constituent of kimchi. Capsaicin and dihydrocapsaicin were quantified by comparison with a reference standard. As depicted in Fig. 1A, capsaicin and dihydrocapsaicin contents were determined to be 96.31 mg/kg and 61.62 mg/kg, respectively. Kimchi was classified into five groups based on their capsaicin and dihydrocapsaicin contents, affecting perceived spiciness: control, mild, medium, hot and extreme kimchi according to Park’s classification (16). Our capsaicinoid content (157.93 mg/kg) aligned with the mild and medium levels, with 96.31 mg/kg for capsaicin and 61.62 mg/kg for dihydrocapsaicin.

Fig. 1 Capsaicin and dihydrocapsaicin contents and impact of kimchi on antioxidant activities and cell viability in T37i brown preadipocytes. (A) HPLC chromatograms of capsaicin and dihydrocapsaicin. (B) Total antioxidant capacity (TAC). (C) Ferric reducing antioxidant power (FRAP). (D) Cell viability. Results are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, ***P < 0.001, and ****P < 0.0001, vs. non-treated group.

Antioxidant effect of kimchi

The antioxidant potential of kimchi was assessed using TAC and FRAP assays. Previous studies have consistently demonstrated the antioxidant activity of kimchi (15, 17). In line with these findings, both TAC and FRAP levels of kimchi exhibited a dose-dependent increase (Fig. 1B and 1C). Notably, the highest TAC and FRAP levels, at 2,500 μg/mL, were measured at 9.36 nM and 100.57 μM, respectively.

Effect of kimchi on T37i preadipocyte viability

Figure 1D depicts the viability of T37i preadipocytes when treated with kimchi at various concentrations (0, 50, 100, 250, 500, 1,000, and 2,500 μg/mL). Preadipocyte viability remained above 90% up to a concentration of 1,000 μg/mL. Notably, the viability of kimchi-treated cells varied depending on the cell type and kimchi formulation. For instance, the viability of naturally fermented kimchi (NK) and starter kimchi (SK) was also approximately 80% up to 1,000 μg/mL; however, viability decreased to 60% at 2,500 μg/mL (5). Despite differences in kimchi formulations, cell viability remained above 80% up to 500 or 1,000 μg/mL (5, 7, 17). Based on these findings, subsequent experiments were conducted using 1,000 μg/mL of kimchi.

Optimal differentiation conditions

Brown adipocytes are characterized by a high mitochondrial density and small lipid droplet morphology. In this investigation, T37i brown adipocytes were primarily examined at 40× magnification, while 3T3-L1 white adipocytes were predominantly observed at 10× magnification (Fig. 2A). Previous research indicates that T37i adipocyte differentiation commonly occurs in differentiation media containing 2 nM T3 and 20 nM insulin for 6 days (18–20). However, well-differentiated T37i adipocytes were not observed in this study. To establish optimal differentiation conditions, experiments were conducted employing varying serum concentrations (FBS and calf serum) and ratios of T3 to insulin (1:1, 1:2, and 1:5), as depicted in Fig. 2B. Notably, the use of calf serum resulted in significantly higher differentiation of T37i adipocytes (P < 0.05, Fig. 2B and 2C). Moreover, higher concentrations of insulin led to significantly increased differentiation of T37i adipocytes (P < 0.05). Additionally, UCP-1 mRNA expression was confirmed in differentiated T37i adipocytes (data not shown). Based on these findings, differentiation experiments were conducted in DMEM/F12 supplemented with HEPES and l-glutamine, with 10% fetal calf serum containing 2 nM T3 and 100 nM insulin.

Fig. 2 Optimization of differentiation conditions for T37i brown adipocytes. (A) Morphology of lipid droplets in differentiated T37i adipocytes. (B) Oil-red O (ORO) stained images. (C) ORO intensity. Results are presented as mean ± SD (n = 3). ***P < 0.001, vs. non-differentiated cells (Nor).

Effect of kimchi on intracellular TG levels

In addition to UCP-1 expression, elevated TG levels are a characteristic feature of differentiated T37i adipocytes. The intracellular TG levels extracted from these differentiated adipocytes were assessed using a commercial kit. As depicted in Fig. 3A, the intracellular TG level significantly increased with differentiation in the control group; however, kimchi significantly reduced intracellular TG levels (P < 0.05). According to Penfornis et al., the mineralocorticoid (MR) receptor markedly increases TG levels in a dose-dependent manner; nevertheless, MR antagonists RU-26752 and RU-38486 notably decrease TG levels in differentiated T37i adipocytes (19). Additionally, carbamazepine demonstrates a significant decrease in TG levels (21). Several studies have demonstrated that kimchi significantly reduces TG levels in differentiated 3T3-L1 adipocytes (5, 17, 22). This study represents the first documentation of kimchi’s suppressive effect on differentiated T37i adipocytes.

Fig. 3 Influence of kimchi (1,000 μg/mL) on triglyceride (TG) content and lipid accumulation in differentiated T37i brown adipocytes. (A) TG content. (B) ORO intensity. (C) ORO-stained images. Results are presented as mean ± SD (n = 3). ***P < 0.001, vs. control group (Con).

Effect of kimchi on lipid accumulation

The impact of kimchi on lipid accumulation was assessed through ORO staining. As illustrated in Fig. 3B and 3C, ORO-stained lipid droplets were evident in the control (Con) group. However, kimchi significantly reduced the number of ORO-stained lipid droplets (P < 0.05). Consistent with the TG results, kimchi effectively curbed lipid accumulation in differentiated T37i adipocytes. Similar findings were observed in studies where the sex hormone progesterone reduced lipid accumulation by approximately 30% in ORO assays (23). Additionally, carbamazepine has been reported to inhibit lipid accumulation (21). Collectively, these results indicate that kimchi exerts anti-obesity effects by reducing intracellular TG levels and inhibiting lipid accumulation.

Effect of kimchi on thermogenesis-related gene and protein levels

To corroborate the anti-obesity effects of kimchi, the expression of thermogenesis-related genes was evaluated. UCP-1, PGC-1α, and PRDM16 are well established as major contributors to thermogenesis, thus influencing anti-obesity effects (24). Consequently, their expression at both gene and protein levels has been widely investigated in various cellular and tissue contexts (25, 26). Moreover, additional genes such as cell death-inducing DNA fragmentation factor-like effector A (CIDEA), peptidylprolyl isomerase A (PPIA), and C-terminal binding protein 1 (CtBP1) have been identified as thermogenesis-related genes (27).

Fig. 4A–4F demonstrates a significant increase in the expression of thermogenesis-related genes following kimchi treatment compared to the control (P < 0.05). Consistent with these findings, visfatin has been reported to enhance the expression of thermogenic genes (28), whereas metformin has shown similar effects on thermogenic protein expression (29).

Fig. 4 Effect of kimchi (1,000 μg/mL) on thermogenesis-related gene expression in differentiated T37i brown adipocytes. (A) UCP-1. (B) PGC-1α. (C) PRDM16. (D) CIDEA. (E) PPIA. (F) CtBP1. Results are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, and ***P < 0.001, vs. control group (Con).

Consistent with the gene expression results, kimchi significantly upregulated the expression of key thermogenesis-related proteins, including UCP-1, PGC-1α, and PRDM16 (Fig. 5A–5D). Previous studies have consistently demonstrated that bioactive components enhance the expression of thermogenesis-related proteins. For example, ginsenosides Rb1 and Rg1, as well as carotene, have been shown to increase UCP-1, PGC-1α, and PRDM16 protein expression in 3T3-L1 cells (30, 31). These findings collectively underscore kimchi’s capacity to induce the expression of thermogenesis-related genes and proteins, thereby exerting an anti-obesity effect.

Fig. 5 Effect of kimchi (1,000 μg/mL) on thermogenesis-related protein expression in differentiated T37i brown adipocytes. (A) Western blot images. (B) UCP-1 protein intensity. (C) PGC-1α protein intensity. (D) PRDM16 protein intensity. Results are presented as mean ± SD (n = 3). **P < 0.01 and ***P < 0.001, vs. control group (Con).

Although the mechanism study was not conduct in this study, our previous studies reported that kimchi active components and kimchi induced AMPK activation (13, 14). Therefore, these results suggest that kimchi shows the anti-obesity effect by thermogenesis in AMPK pathway. In the future, it is necessary to conduct and verify the mechanism in the AMPK pathway.

Effect of kimchi on obesity-related gene expression

In addition to investigating the expression of genes related to thermogenesis, we examined the expression of genes associated with obesity. Kimchi notably downregulated the expression of obesity-related genes, including adipocyte fatty acid-binding protein (aP2), CCAAT/enhancer-binding protein alpha (C/EBPα), peroxisome proliferator-activated receptor gamma (PPARγ), liver X receptor alpha (LXRα), sterol regulatory element-binding protein-1c (SREBP-1c), and fatty acid synthase (FAS) (P < 0.05, as depicted in Fig. 6A–6F). Numerous studies have reported a significant reduction in the expression of obesity-related genes in differentiated 3T3-L1 adipocytes following kimchi treatment (32, 33).

Fig. 6 Effect of kimchi (1,000 μg/mL) on obesity-related gene expression in differentiated T37i brown adipocytes. (A) aP2. (B) C/EBPα. (C) PPARγ. (D) LXRα. (E) SREBP-1c. (F) FAS. Results are presented as mean ± SD (n = 3). *P < 0.05, **P < 0.01, and ***P < 0.001, vs. control group (Con).

These findings suggest that kimchi reduces the expression of thermogenesis-related genes and proteins, thereby eliciting an anti-obesity effect. In summary, the anti-obesity properties of kimchi were supported by the upregulation of thermogenic gene expression and the downregulation of obesity-related gene levels in differentiated T37i adipocytes.

Conclusions

In this study, we assessed the antioxidant activity of kimchi and established optimal differentiation conditions for T37i brown adipocytes. By modulating the expression of genes and proteins related to obesity and thermogenesis, we induced anti-obesity effects. This study represents the first evidence of kimchi’s anti-obesity impact on differentiated T37i brown adipocytes through the regulation of obesity and thermogenesis pathways.

However, this study has some limitations. While we demonstrated the anti-obesity effects of kimchi on T37i adipocytes, further research is necessary to validate these effects on brown adipose tissue using animal models as well as mechanism study. Therefore, the verification of kimchi’s anti-obesity effects in mechanism and animal study is warranted.

Authors’ contributions

Y.R. Yun: conceptualization, methodology, data curation, writing – original draft preparation, writing – review and editing, supervision, project administration. J.E. Lee: methodology, data curation, writing – original draft preparation. S. Lee: conceptualization, methodology, data curation. S.W. Hong: project administration and funding acquisition.

Conflict of interest and funding

The authors declare no conflicts of interest.

Data availability

Not applicable.
==== Refs
References

1 Kim N, Lee J, Song HS, Oh YJ, Kwon MS, Yun M, et al . Kimchi intake alleviates obesity-induced neuroinflammation by modulating the gut-brain axis. Food Res Int 2022; 158 : 111533. doi: 10.1016/j.foodres.2022.111533 35840231
2 Tan LJ, Yun YR, Hong SW, Shin S. Effect of kimchi intake on body weight of general community dwellers: a prospective cohort study. Food Funct 2023; 14 : 2162–71. doi: 10.1039/d2fo03900a 36752575
3 Kim HS, Oh H, Kim B, Ji Y, Holzapfel WH, Kang H. Multifunctional effects of Lactobacillus sakei HEM 224 on the gastrointestinal tract and airway inflammation. Sci Rep 2023; 13 : 17918. doi: 10.1038/s41598-023-45043-0 37864021
4 Yun YR, Choi YJ, Kim YS, Chon SY, Lee MA, Chung YB, et al . Antioxidant and anti-inflammatory effects of solar salt brined kimchi. Food Sci Biotechnol 2023; 32 : 679–87. doi: 10.1007/s10068-022-01203-y 37009041
5 Hyun IK, Hong SW, Ma MJ, Chang JY, Lee S, Yun YR. Anti-obesity effect of kimchi with starter cultures in 3T3-L1 cells. J Microbiol Biotechnol 2024; 34 : 123–31. doi: 10.4014/jmb.2307.07005 37830224
6 Hong GH, Lee SY, Yoo JI, Chung JH, Park KY. Catechin with lactic acid bacteria starters enhances the antiobesity effect of kimchi. J Med Food 2023; 26 : 560–9. doi: 10.1089/jmf.2023.K.0067 37405755
7 Yun YR, Kim HC, Seo HY. Antiobesity effects of kimchi added with Jeju citrus concentrate on high-fat diet-induced obese mice. Nutr Res 2021; 86 : 50–9. doi: 10.1016/j.nutres.2020.11.007 33482598
8 Yun YR, Kwon MS, Lee HJ, Lee W, Lee JE, Hong SW. Anti-obesity activity of lactic acid bacteria-starter-based kimchi in high-fat diet-induced obese mice. J Funct Foods 2024; 112 : 105966. doi: 10.1016/j.jff.2023.105966
9 Choi JW, Choi HJ, Ryu GH, Lee JW, Beak JK, Koh EJ et al . Paeonia lactiflora root decreases lipid accumulation through the induction of lipolysis and thermogenesis via AMPK activation in 3T3‑L1 cells. Int J Mol Med 2023; 52 : 65. doi: 10.3892/ijmm.2023.5268 37326061
10 Lv Y, Lv X, Feng J, Cheng F, Yu Z, Guan F, et al . (20R)-panaxadiol improves obesity by promoting white fat beigeing. Front Pharmacol 2023; 14 : 1071516. doi: 10.3389/fphar.2023.1071516 36909162
11 Ahmad B, Serpell CJ, Fong IL, Wong EH. Molecular mechanisms of adipogenesis: the anti-adipogenic role of AMP-activated protein kinase. Front Mol Biosci 2020; 7 : 76. doi: 10.3389/fmolb.2020.00076 32457917
12 van der Vaart JI, Boon MR, Houtkooper RH. The role of AMPK signaling in brown adipose tissue activation. Cells 2021; 10 : 1122. doi: 10.3390/cells10051122 34066631
13 Yun YR, Lee JE. Alliin, capsaicin, and gingerol attenuate endoplasmic reticulum stress-induced hepatic steatosis in HepG2 cells and C57BL/6N mice. J Funct Foods 2022; 95 : 105186. doi: 10.1016/j.jff.2022.105186
14 Yun YR, Lee JE. Kimchi attenuates endoplasmic reticulum stress-induced hepatic steatosis in HepG2 cells and C57BL/6N mice. Nutr Res 2024; 124 : 43–54. doi: 10.1016/j.nutres.2024.01.013 38367426
15 Lee JE, Min SG, Hong SW, Kim JH, Kim GH, Yun YR. Anti-obesity effects of kimchi with red yeast rice in 3T3-L1 adipocytes and high-fat diet-induced obese mice. J Funct Foods 2023; 106 : 105594. doi: 10.1016/j.jff.2023.105594
16 Park B, Yang JS, Moon EW, Seo HY, Ha JH. Influence of capsaicinoids content on the microbial community during kimchi fermentation. J Microbiol Biotechnol 2019; 29 : 1580–90. doi: 10.4014/jmb.1907.07023 31474094
17 Yun YR, Park SH, Kim IH. Antioxidant effect of kimchi supplemented with Jeju citrus concentrate and its antiobesity effect on 3T3-L1 adipocytes. Food Sci Nutr 2019; 7 : 2740–6. doi: 10.1002/fsn3.1138 31428362
18 Zennaro MC, Le Menuet D, Viengchareun S, Walker F, Ricquier D, Lombès M. Hibernoma development in transgenic mice identifies brown adipose tissue as a novel target of aldosterone action. J Clin Invest 1998; 101 (6 ): 1254–60. doi: 10.1172/JCI1915 9502766
19 Penfornis P, Viengchareun S, Le Menuet D, Cluzeaud F, Zennaro MC, Lombès M. The mineralocorticoid receptor mediates aldosterone-induced differentiation of T37i cells into brown adipocytes. Am J Physiol Endocrinol Metab 2000; 279 : E386–94. doi: 10.1152/ajpendo.2000.279.2.E386 10913039
20 Viengchareun S, Zennaro MC, Pascual-Le Tallec L, Lombes M. Brown adipocytes are novel sites of expression and regulation of adiponectin and resistin. FEBS Lett 2002; 532 : 345–50. doi: 10.1016/s0014-5793(02)03697-9 12482590
21 Turpin E, Muscat A, Vatier C, Chetrite G, Corruble E, Moldes M, et al . Carbamazepine directly inhibits adipocyte differentiation through activation of the ERK 1/2 pathway. Br J Pharmacol 2013; 168 : 139–50. doi: 10.1111/j.1476-5381.2012.02140.x 22889231
22 Lee KH, Song JL, Park ES, Ju J, Kim HY, Park KY. Anti-obesity effects of starter fermented kimchi on 3T3-L1 adipocytes. Prev Nutr Food Sci 2015; 20 : 298–302. doi: 10.3746/pnf.2015.20.4.298 26770918
23 Kaikaew K, Liu W, Steenbergen J, McLuskey-Dankbar A, Visser J. SUN-108 dose-dependent effect of progesterone on T37i brown adipocyte differentiation. J Endocr Soc 2019; 3 (Suppl 1 ): SUN-108. doi: 10.1210/js.2019-SUN-108
24 Ma P, He P, Xu CY, Hou BY, Qiang GF, Du GH. Recent developments in natural products for white adipose tissue browning. Chin J Nat Med 2020; 18 : 803–17. doi: 10.1016/S1875-5364(20)60021-8 33308601
25 Wu MV, Bikopoulos G, Hung S, Ceddia RB. Thermogenic capacity is antagonistically regulated in classical brown and white subcutaneous fat depots by high fat diet and endurance training in rats: impact on whole-body energy expenditure. J Biol Chem 2014; 289 : 34129–40. doi: 10.1074/jbc.M114.591008 25344623
26 Li R, Zhu Q, Wang X, Wang H. Mulberry leaf polyphenols alleviated high-fat diet-induced obesity in mice. Front Nutr 2022; 9 : 979058. doi: 10.3389/fnut.2022.979058 36185673
27 Zhu X, Ren T, Xiong Q, Lin Z, Lin X, Lin G. Salidroside alleviates diet-induced obesity and insulin resistance by activating Nrf2/ARE pathway and enhancing the thermogenesis of adipose tissues. Food Sci Nutr 2023; 11 : 4735–44. doi: 10.1002/fsn3.3450 37576042
28 Dimitriadis GK, Adya R, Tan BK, Jones TA, Menon VS, Ramanjaneya M et al . Effects of visfatin on brown adipose tissue energy regulation using T37i cells. Cytokine 2019; 113 : 248–55. doi: 10.1016/j.cyto.2018.07.013 30060995
29 Geerling JJ, Boon MR, van der Zon GC, van den Berg SA, van den Hoek AM, Lombès M, et al . Metformin lowers plasma triglycerides by promoting VLDL-triglyceride clearance by brown adipose tissue in mice. Diabetes 2014; 63 : 880–91. doi: 10.2337/db13-0194 24270984
30 Lee K, Seo YJ, Song JH, Chei S, Lee BY. Ginsenoside Rg1 promotes browning by inducing UCP1 expression and mitochondrial activity in 3T3-L1 and subcutaneous white adipocytes. J Ginseng Res 2019; 43 : 589–99. doi: 10.1016/j.jgr.2018.07.005 31695565
31 Mukherjee S, Yun JW. β-carotene stimulates browning of 3T3-L1 white adipocytes by enhancing thermogenesis via the β3-AR/p38 MAPK/SIRT signaling pathway. Phytomedicine 2022; 96 : 153857. doi: 10.1016/j.phymed.2021.153857 34840022
32 Han KJ, Lee NK, Yu HS, Park H, Paik HD. Anti-adipogenic effects of the probiotic Lactiplantibacillus plantarum KU15117 on 3T3-L1 adipocytes. Probiotics Antimicrob Proteins 2022; 14 : 501–9. doi: 10.1007/s12602-021-09818-z 34264486
33 Park JE, Oh SH, Cha YS. Lactobacillus brevis OPK-3 isolated from kimchi inhibits adipogenesis and exerts anti-inflammation in 3T3-L1 adipocyte. J Sci Food Agric 2014; 94 : 2514–20. doi: 10.1002/jsfa.6588 24453065
