
==== Front
PLoS Biol
PLoS Biol
plos
PLOS Biology
1544-9173
1545-7885
Public Library of Science San Francisco, CA USA

39231388
10.1371/journal.pbio.3002757
PBIOLOGY-D-23-02305
Short Reports
Biology and Life Sciences
Cell Biology
Cell Adhesion
Integrins
Biology and Life Sciences
Cell Biology
Cellular Structures and Organelles
Extracellular Matrix
Integrins
Biology and Life Sciences
Biochemistry
Proteins
Protein Domains
Biology and Life Sciences
Molecular Biology
Molecular Biology Techniques
Transfection
Research and Analysis Methods
Molecular Biology Techniques
Transfection
Research and Analysis Methods
Specimen Preparation and Treatment
Staining
Cell Staining
Physical Sciences
Chemistry
Chemical Compounds
Organic Compounds
Amides
Physical Sciences
Chemistry
Organic Chemistry
Organic Compounds
Amides
Biology and Life Sciences
Molecular Biology
Molecular Biology Techniques
Artificial Gene Amplification and Extension
Polymerase Chain Reaction
Research and Analysis Methods
Molecular Biology Techniques
Artificial Gene Amplification and Extension
Polymerase Chain Reaction
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Connective Tissue Cells
Fibroblasts
Biology and Life Sciences
Anatomy
Biological Tissue
Connective Tissue
Connective Tissue Cells
Fibroblasts
Medicine and Health Sciences
Anatomy
Biological Tissue
Connective Tissue
Connective Tissue Cells
Fibroblasts
Engineering and Technology
Signal Processing
Signal Amplification
A flexible loop in the paxillin LIM3 domain mediates its direct binding to integrin β subunits
Paxillin LIM3 directly binds integrin β subunits
Baade Timo Conceptualization Investigation Methodology Writing – original draft 1 2
Michaelis Marcus Conceptualization Investigation Methodology Writing – original draft 3 4
Prestel Andreas Investigation Methodology 3 ¤
Paone Christoph Investigation Methodology 1 2
Klishin Nikolai Investigation Methodology 3 4
Herbinger Marleen Investigation Methodology 1
Scheinost Laura Investigation 1
Nedielkov Ruslan Methodology 3
https://orcid.org/0000-0002-1005-2141
Hauck Christof R. Conceptualization Funding acquisition Methodology Project administration Supervision Writing – original draft Writing – review & editing 1 2 *
https://orcid.org/0000-0002-5795-1195
Möller Heiko M. Conceptualization Funding acquisition Methodology Project administration Supervision Writing – original draft Writing – review & editing 3 4 *
1 Lehrstuhl Zellbiologie, Universität Konstanz, Konstanz, Germany
2 Konstanz Research School Chemical Biology, Universität Konstanz, Konstanz, Germany
3 Analytische Chemie, Universität Potsdam, Potsdam, Germany
4 DFG Research Training Group 2473 “Bioactive Peptides”
Parent Carole A. Academic Editor
University of Michigan, UNITED STATES OF AMERICA
The authors have declared that no competing interests exist.

¤ Current address: Section for Biomolecular Sciences, The Kaj Ulrik Linderstrøm-Lang Centre for Protein Science, Structural Biology and NMR laboratory, Copenhagen, Denmark

* E-mail: christof.hauck@uni-konstanz.de (CRH); heiko.moeller@uni-potsdam.de (HMM)
4 9 2024
9 2024
4 9 2024
22 9 e30027576 9 2023
17 7 2024
© 2024 Baade et al
2024
Baade et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Integrins are fundamental for cell adhesion and the formation of focal adhesions (FA). Accordingly, these receptors guide embryonic development, tissue maintenance, and haemostasis but are also involved in cancer invasion and metastasis. A detailed understanding of the molecular interactions that drive integrin activation, FA assembly, and downstream signalling cascades is critical. Here, we reveal a direct association of paxillin, a marker protein of FA sites, with the cytoplasmic tails of the integrin β1 and β3 subunits. The binding interface resides in paxillin’s LIM3 domain, where based on the NMR structure and functional analyses, a flexible, 7-amino acid loop engages the unstructured part of the integrin cytoplasmic tail. Genetic manipulation of the involved residues in either paxillin or integrin β3 compromises cell adhesion and motility of murine fibroblasts. This direct interaction between paxillin and the integrin cytoplasmic domain identifies an alternative, kindlin-independent mode of integrin outside-in signalling particularly important for integrin β3 function.

How do integrins and paxillin interact at focal adhesions? Here, the authors present a 3D-structure of the LIM3 domain of paxillin which reveals a direct association between paxillin and the cytoplasmic tail of the integrin beta subunit.

http://dx.doi.org/10.13039/501100001659 Deutsche Forschungsgemeinschaft CRC969, project B06 https://orcid.org/0000-0002-1005-2141
Hauck Christof R. http://dx.doi.org/10.13039/501100001659 Deutsche Forschungsgemeinschaft RTG 2473 Project C3 https://orcid.org/0000-0002-5795-1195
Möller Heiko M. http://dx.doi.org/10.13039/501100001659 Deutsche Forschungsgemeinschaft RTG 2474 Michaelis Marcus http://dx.doi.org/10.13039/501100001659 Deutsche Forschungsgemeinschaft RTG 2474 Klishin Nikolai Funding for this work was awarded to CRH via CRC969, project B06 by Deutsche Forschungsgemeinschaft (https://www.dfg.de/). The work and position of TB, CP and MH was supported by the CRC969. Funding and support for this work was awarded to HMM, MM, and NK via RTG 2473 (Project number 392923329), project C3 by Deutsche Forschungsgemeinschaft (https://www.dfg.de/). The work of MM was supported by the RTG 2474. The work and position of NK was funded by the RTG 2474. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityThe resonance assignment of paxillin LIM2/3 has been deposited to the BMRB (Entry# 51154). The coordinates of the final ensemble of Paxillin LIM2/3 domains have been deposited to the PDB (Accession code: 7QB0). The ImageJ macro used to quantify the cell spreading data has been deposited to the Zenodo database (https://zenodo.org/doi/10.5281/zenodo.12736436).
Data Availability

The resonance assignment of paxillin LIM2/3 has been deposited to the BMRB (Entry# 51154). The coordinates of the final ensemble of Paxillin LIM2/3 domains have been deposited to the PDB (Accession code: 7QB0). The ImageJ macro used to quantify the cell spreading data has been deposited to the Zenodo database (https://zenodo.org/doi/10.5281/zenodo.12736436).
==== Body
pmcIntroduction

Integrins are specialized cell surface receptors of animal cells that sense the extracellular matrix and coordinate cell adhesion with the organization of the cytoskeleton [1]. Integrins are transmembrane glycoproteins consisting of an α and β subunit, with 18 distinct integrin α and 8 integrin β subunits encoded in the human genome [2]. The high affinity, active conformation of these heterodimers can be stabilized either by extracellular ligand binding (outside-in signalling) or by distinct intracellular signalling processes, which allow the association of the cytosolic scaffolding proteins talin and kindlin with the β subunit cytoplasmic tail (inside-out signalling) [3]. Active integrins, together with their binding partners talin and kindlin, serve as the nucleus for the initiation of large, multimeric protein complexes termed “focal adhesions” (FAs) [4,5]. Combined biochemical, genetic, and microscopic analyses have revealed the stratified layout of FAs and identified the characteristic compendium of signalling and adaptor proteins, the so-called integrin adhesome [6–9]. While the essential roles of talin and kindlin in initiating integrin-based adhesion sites in various cell types have become clear [10], the function of other core adhesome proteins during the initial steps of FA formation is still debated.

For example, LIM (Lin-11, Isl1, MEC-3) domain containing adapter proteins are a highly enriched subgroup of integrin adhesome proteins thought to be involved in mechanosensing [7,11,12]. Individual LIM domains encompass approximately 60 amino acids forming a double zinc finger motif, which mediates binding to other proteins or nucleic acids [13,14]. A prominent member of this group of adapter proteins is paxillin, which contains 4 LIM domains and is ubiquitously expressed in mammalian tissues [15,16]. Paxillin is commonly employed as a marker protein of FAs and nascent focal complexes under various conditions, even where the normal morphology, function, and architecture of FAs is disturbed. Paxillin is one of the first proteins recruited to FAs [17] and efficiently localizes there even in the absence of myosin-generated forces [18]. Paxillin is found in nanometer distance from the plasma membrane with the carboxy-terminus detected in the same confined membrane-proximal layer as the cytoplasmic domain of integrin αv [9]. A main determinant of paxillin’s efficient recruitment to integrins seems to be its association with kindlin2, which has been mapped to the amino-terminal LD domains and the carboxy-terminal LIM3 / LIM4 domain region of paxillin [19–21]. Recently, a crucial role of the paxillin LIM2 domain for FAs recruitment has been suggested [22], while initial work identified the paxillin LIM3 domain as being the essential determinant of its FA targeting [23]. A further mode of indirect recruitment of paxillin to integrin β tails can be mediated by the interaction of paxillin LD motifs with the talin R8 rod domain [24]. However, paxillin can localize to FAs in talin knockout (KO) cells [25], and paxillin is clearly incorporated into FAs in the absence of kindlins [26,27], suggesting additional currently uncharacterized, kindlin- and/or talin-independent mode (s) of paxillin’s integrin engagement.

Here, we demonstrate that the paxillin LIM2 and LIM3 domains directly interact with carboxy-terminal residues of the integrin β subunit. Biochemical analysis of recombinant proteins, the NMR-based 3D structure of the paxillin LIM2/3 domains, and functional analysis of mutated paxillin and integrin β3 in vitro and in the cellular context reveal that this interaction is based on a flexible loop in paxillin’s LIM3 domain, which presumably operates in a clamp-like mechanism to modulate cellular responses towards integrin ligands.

Results

Paxillin LIM2/3 domains can directly bind the cytoplasmic tails of integrin β1 and β3

In line with previous reports [11,18], we recently observed that paxillin can be recruited in the absence of mechanical forces to clusters of the integrin β CT, similar to the behaviour of known integrin binding partners such as talin and kindlin2 [28]. We wondered whether recruitment to clustered integrin β tails is a general feature of LIM domain containing adhesome proteins. To this end, we used CEACAM-integrin β CT fusion proteins (CEA-ITGB1 or CEA-ITGB3), which can be engaged from the outside of the cell by multivalent CEACAM binding bacteria (Neisseria gonorrhoeae). This process initiates microscale accumulation of free integrin β tails mimicking nascent adhesion formation and was therefore named Opa protein triggered integrin clustering (OPTIC) (S1A Fig) [28]. Interestingly, when coexpressed with CEA3-ITGB1 or CEA3-ITGB3, only paxillin and the closely related proteins Hic-5 and leupaxin showed a significant enrichment (Figs 1A, S1B and S1C), while other LIM domain proteins did not accumulate at clustered integrin β tails (Figs 1A, S1C and S1D). Paxillin recruitment to integrin clusters was dependent on the LIM domains, since the paxillin C-terminus encompassing LIM1-LIM4, but not the isolated N-terminal LD1-LD5 domains, strongly accumulated at integrin β cytoplasmic tails (Fig 1B and 1D), and paxillin LIM1-LIM4, but not the LD1-LD5 domains, displaced full-length paxillin together with its binding partner FAK from FA sites (Fig 1C–1E). These results indicated that paxillin, leupaxin, and Hic-5 differ from other LIM domain containing adhesome proteins by their ability to locate at clustered integrin β tails. Moreover, pulldown assays with purified, recombinant proteins demonstrated that, similar to the talin F3 domain and Kindlin2, the paxillin LIM2/3 domains can bind the cytoplasmic tails of integrin β1 and β3 in the absence of other cellular proteins (Fig 1F). These findings suggested an important role of the LIM2/3 domains to directly connect paxillin with integrin β tails.

10.1371/journal.pbio.3002757.g001 Fig 1 The LIM2/3 domains direct paxillin to the cytoplasmic tail of integrin β1 and β3.

(A) 293T cells were transiently cotransfected with a CEACAM3-ITGB3 (ITGB3) fusion construct together with GFP or the indicated GFP-labelled proteins. Cells were seeded on poly-L-lysine and incubated for 1 h with Pacific Blue–labelled Neisseria gonorrhoeae (Ngo; blue) to cluster ITGB3 (stained red with α-CEACAM antibody). Recruitment of GFP-fused proteins to the clustered integrin β3 tail is indicated by white arrowheads. Bars represent 2 μm. (B) Stable GFP-paxillin expressing Flp-In 3T3 cells were transiently transfected with RFP-tagged paxillin LIM1-4 or RFP-tagged paxillin LD1-5 domains. Displacement of GFP-paxillin by RFP-LIM1-4, but not RFP-LD1-5, is visible in boxed and enlarged areas. (C) GFP-Paxillin localization at FAs in presence of LIM1-4 or LD1-5 domains as in (B) was evaluated by measuring the GFP fluorescence intensity. Shown are mean values of GFP-paxillin intensity from 3 independent experiments. Total number of analysed FAs is given in brackets under each sample. Error bars represent 5 and 95 percentiles. Significance was calculated using one-way ANOVA, followed by Bonferroni multiple comparison test (*** p < 0.0001, ns = not significant). The data underlying this panel can be found in S1 Data. (D) GFP-FAK expressing MEFs were transiently transfected with RFP-paxillin full-length or RFP-LIM1-4. Displacement of GFP-FAK by RFP-LIM1-4, but not RFP-Paxillin, is visible in boxed and enlarged areas. (E) Calculation of GFP-FAK intensity at FAs was performed as in (C) n = 360 FAs per sample from 3 independent experiments. Significance was calculated using one-way ANOVA, followed by Bonferroni multiple comparison test (*** p < 0.0001). The data underlying this panel can be found in S1 Data. (F) In vitro pulldown using recombinant Strep-tag integrin β1 or β3 cytoplasmic tails and recombinant talin1 F3 domain, full-length kindlin2 or paxillin LIM2/3 domain fused to His-SUMO, or His-SUMO only as negative control.

The solution structure of paxillin LIM2/3 reveals a flexible loop region in the LIM3 domain involved in binding to the integrin β3 carboxy terminus

To investigate the direct interaction between paxillin and the integrin β subunit in more detail, we used NMR spectroscopy to gain structural insight and to delineate the binding interface. Since LIM3 and, to a lesser extent, LIM2 have been shown to be mainly responsible for FA targeting of paxillin [23], we expressed the LIM2/3 tandem domain (aa380-499) of human paxillin and determined its solution structure based on heteronuclear multidimensional NMR experiments [29] (Fig 2A). Not surprisingly, regarding their high sequence similarity (39% identity when aligning residues P381-D436 of LIM2 with P440-E495 of LIM3; S2B Fig), both the LIM2 and the LIM3 domain of paxillin exhibit the characteristic double zinc finger motif as described for other LIM domain-containing proteins and paxillin family members [13,14,30,31] (Fig 2B and 2C). Each domain comprises 2 orthogonally packed β-hairpins, followed by an α-helix (Fig 2B and 2C). Interestingly, the LIM2 and LIM3 domains are connected by a short linker of 4 amino acids (F438-K441). There are in total only 19 long-range NOEs connecting 2 residues of the LIM2 domain (K432 and F435) with 4 residues of the linker region and the LIM3 domain, respectively (K440, R446, T458, and L459).

10.1371/journal.pbio.3002757.g002 Fig 2 The paxillin LIM2/3 domains directly interact with C-terminal residues of integrin β3.

(A) Assigned 1H-15N-HSQC spectrum of paxillin LIM2/3. Backbone amide crosspeaks and side-chain amide groups are labeled by amino acid type and position. (B, C) Solution structure of paxillin LIM2/3. The final ensemble of 10 conformers with lowest target function is shown fitted to the LIM2 domain (residues P381 to F438) (B) or fitted to the LIM3-domain (residues P440 to R497) (C), shown in ribbon representations. In the fitted part, α-helices are colored cyan and β-strands magenta. Zinc ions are shown as grey spheres. The linker region between LIM2 and LIM3, residues F438-A439-P440-K441, is colored in green. The flexible loops of the LIM2 domain (residue F415 to F421) and the LIM3 domain (residue T473 to E482) are shown in blue. The domain that was not used for fitting is shown in light grey. (D) 15N-HSQC titration of 300 μM 15N integrin β3 ct (ITGB3 ct) with paxillin LIM2/3. Paxillin was added in concentrations up to 900 μM. Boxes show a selection of signals affected by CSPs (residues I783, N782, and R786) in the presence of 0 μM (black), 150 μM (green), 300 μM (blue), and 900 μM (red) paxillin LIM2/3. Insets show the concentration dependence of combined amide CSPs globally fitted to a one site binding model. (E) Combined amide CSPs of 300 μM 15N integrin β3 ct in the presence of 760 μM paxillin LIM2/3 vs. residue number of integrin β3 ct. Lines indicate average δΔ + 1× s.d. (yellow), δΔ + 2× s.d. (orange), and δΔ + 3× s.d. (red). (F) In vitro pulldown of His-SUMO or His-SUMO-paxillin LIM2/3 (PXN LIM2/3) using the Strep-tag integrin β3 cytoplasmic tail in the wild-type form (wt) or with a truncation of the carboxy-terminal 3 (Δ3aa) or 8 (Δ8aa) amino acids. The bar graph below shows the densitometric quantification of the pulldown experiments (n = 3). Statistical significance was calculated using one-sample t test to calculate if samples mean are significantly different from a hypothetical value of 1 (* p < 0.05, ** p < 0.01). The data underlying this panel can be found in S1 Data. (G) 15N-HSQC titration of 300 μM 15N integrin β3 Δ3aa (ITGB3 Δ3aa) with paxillin LIM2/3 (PXN LIM2/3). Paxillin was added up to a concentration of 750 μM. (H) Combined amide CSPs of 300 μM 15N integrin β3 ct Δ3aa in the presence of 750 μM paxillin LIM2/3 vs. residue number of integrin β3 ct Δ3aa.

According to the measurements of the heteronuclear NOE between HN and N of the amides, the linker between LIM2 and LIM3 shows only slightly higher flexibility on the ps-to-ns timescale than the domains themselves (S2A Fig). However, the reduction in long-range NOE contacts in this region suggests that the structure is less densely packed here, resulting in differential relative orientations of the domains (Fig 2B and 2C). This would fit into the previously proposed scenario of the LIM domains as a sort of molecular ruler and/or tension sensor [11].

The heteronuclear NOE discloses further regions of increased flexibility in both domains, namely, around K393, and E419 in the LIM2 domain, and E451, and S479 in LIM3. All these regions are located in loops leading from the first 2 ligands in each zinc finger to the following β-hairpins in each LIM domain, respectively.

Interestingly, by analyzing the heteronuclear NOEs and the structural definition of the final ensemble of conformers, we identified a 7-amino acid stretch (F475-F481) in the second zinc finger of the LIM3 domain that constitutes a flexible, surface exposed loop in the free protein (Fig 2C). This loop is flanked by F475 and F481 and is situated adjacent to a hydrophobic patch or groove. In this region, the amino acid sequence and, in particular, residues F475, F480, and F481 are highly conserved within paxillin family members and across species (S2B Fig). We speculated that this flexible loop might act in concert with its opposing residues (E451, N452, and Y453) of the first zinc finger and the hydrophobic patch to support a clamp-like mechanism for integrin β CT binding. Noteworthy, the LIM2 domain harbors a similarly flexible loop, yet with a negatively charged residue at its center (E419) and a less hydrophobic patch opposing it (LIM2: K393VVTALD399 versus LIM3: N452YISALN458; S2B Fig).

To identify the binding region of paxillin LIM2/3 on the integrin β CT, we titrated unlabeled paxillin LIM2/3 to 15N-labeled cytoplasmic tails of human integrin β1 (aa758-798) or β3 (aa748-788), respectively. In both cases, significant chemical shift perturbations (CSPs) of specific integrin residues were observed (Figs 2D, 2E, S3A and S3B). A dissociation constant (KD) of 52 ± 30 μM was apparent for integrin β1 (S3A Fig), while integrin β3 showed a higher KD (528 ± 130 μM) (Fig 2D). As expected, regarding the higher KD value in case of integrin β3, the titration curves do not reach full saturation but end at ca. 70% fraction bound. This is limited by the maximum concentration of unlabelled binding partner that could be reached and limits, in turn, the accuracy of the KD value determined.

These findings are in line with our previous microscopic observations, where recruitment of paxillin to the clustered integrin β1 cytoplasmic tail was more pronounced (S1C and S1D Fig). Surprisingly, when mapping the CSPs onto the primary sequence of integrin β CTs, the interacting regions were distinct. While the highest CSPs in integrin β1 CT were distributed over the membrane proximal NPxY motif and a neighbouring conserved TT motif (S3B Fig), the largest chemical shifts in integrin β3 were confined to the 8 C-terminal amino acids, spanning the membrane distal NxxY motif (Fig 2E). Indeed, deleting 8 amino acids from the C-terminus of integrin β3 (Δ8aa) completely abrogated paxillin LIM2/3 binding in pulldown experiments, while deletion of the last 3 amino acids (Δ3aa) significantly reduced paxillin binding (Fig 2F). Furthermore, applying integrin β3 CTs Δ3aa or Δ8aa in titration experiments with paxillin LIM2/3 yielded no significant CSPs, confirming the loss of interaction (Figs 2G, S3C and S3D). The biochemical data were further corroborated by OPTIC assays, were both the ITGB3 Δ3 and the Δ8 mutant, but not mutation of the kindlin binding site (integrin β3 S778A) [32,33], diminished paxillin recruitment to clustered integrin β3 tails (S3E and S3F Fig). As expected, association of the talin F3 domain with the integrin β3 tail was not compromised by C-terminal deletion of 3 or 8 amino acids (S3G Fig), supporting the idea that the direct binding of paxillin to the carboxy-terminal residues of integrin β3 could be relevant in a cellular context.

The flexible loop in paxillin LIM3 mediates a direct association with the integrin β3 cytoplasmic tail

To precisely identify the integrin binding site within the paxillin LIM2/3 domains, we titrated the unlabeled CT of human integrin β3 to 15N-labelled paxillin LIM2/3. Similar to the inverse titrations, the KD value of this interaction was determined to 532 ± 239 μM (Fig 3A). It should be noted here that the integrin β3 peptide can be added to higher final concentrations compared to the titration of 15N-labeled integrin β3 with unlabelled paxillin (Fig 2D). Therefore, the maximum CSPs observed in Fig 3A are larger than those in Fig 2D. Changes in the arrangement of aromatic sidechains with respect to the amide groups of the flexible loop may play an additional role. Importantly, the most prominent CSPs in paxillin were recorded within the second zinc finger of the LIM3 domain, specifically in the flexible loop region between F475 and F481 (Fig 3B). To verify our NMR-based epitope mapping, we individually mutated residues of the loop region. Interestingly, exchanging phenylalanine F475, F480, or F481 for alanine caused a complete or partial unfolding of the LIM3 domain (S4A–S4C Fig). Although these residues show strong CSPs and participate in integrin binding, these phenylalanines are also essential for maintaining the structure of the LIM3 domain. To gain further insight into the role of the loop region, these phenylalanines were left intact, but instead, the residues between F475 and F480 were mutated individually (V476A, S479A) or in combination (V476-S479) to alanine (LIM2/3-4A). Individual point mutations as well as Paxillin LIM2/3-4A exhibited a stable LIM domain fold (S4D-S4F Fig). However, when titrating 15N-labelled LIM2/3-4A with up to millimolar concentrations of integrin β3, no saturable CSPs could be detected (Fig 3C and 3D). The relatively large CSPs of a few isolated residues (F421, Y453, and F480) did not saturate and, therefore, do not indicate specific binding of the 4A-variant towards ITGB3. Instead, these residues seem to be quite sensitive to slight changes in buffer composition. Although identical buffer solutions during NMR sample preparation were used, such differences may occur during up-concentration or as a consequence of variations within the purification protocols of paxillin-LIM2/3 versus the integrin peptides. Pulldown assays with the paxillin LIM2/3-4A mutant confirmed diminished binding to the integrin β3 CT (Fig 3E). Next, we introduced the LIM3 loop mutations into full-length paxillin (GFP-PXN-4A) to corrupt the direct engagement of integrin β3 in intact cells. In addition, we generated a truncated paxillin lacking the LIM4 domain (GFP-PXN ΔLIM4) to interfere with the kindlin-mediated indirect binding of paxillin to the integrin β subunit as reported by Zhu and colleagues [19]. GFP-tagged paxillin (PXN) wild type (wt), GFP-PXN-4A, or GFP-PXN ΔLIM4 were stably reintroduced into paxillin KO fibroblasts (S5A Fig). When cell spreading on the integrin ligands vitronectin and fibronectin was monitored, spreading of paxillin KO cells was strongly impaired and reexpression of GFP-paxillin wt rescued this phenotype (Figs 3F and S5B). In contrast, the GFP-PXN-4A mutant was not able to revert the spreading defect and mimicked paxillin KO cells in the first 2 h after seeding on the substrate, while paxillin lacking the LIM4 domain reconstituted cell spreading partially (Figs 3F and S5B). PXN wt and PXN ΔLIM4 also reverted the round, circular morphology of the paxillin-KO fibroblasts to the spindle-shaped, pointed cell phenotype of wt fibroblasts, whereas cells reexpressing GFP-PXN-4A retained the elevated circularity of the paxillin KO cells (Figs 3F and S5B). On vitronectin, both GFP-PXN-4A and GFP-PXN ΔLIM4 showed slightly reduced presence at FA sites (S5C and S5D Fig), but only in GFP-PXN-4A cells a reduction in overall FA area was apparent (S5C and S5E Fig). Furthermore, in paxillin KO cells as well as in GFP-PXN ΔLIM4 and GFP-PXN-4A cells, the presence of kindlin at FA sites appeared diminished (S5C Fig). These results indicate that paxillin and, in particular, the direct interaction between the flexible loop of the paxillin LIM3 domain and integrin β3 is of importance for FA composition and function.

10.1371/journal.pbio.3002757.g003 Fig 3 A flexible loop in the LIM3 domain mediates binding to the integrin β cytoplasmic tail.

(A) 15N-HSQC titration of 250 μM 15N paxillin LIM2/3 wt (PXN LIM2/3 wt) with integrin β3. ITGB3 ct was added in concentrations up to 2,420 μM. Boxes show a selection of signals affected by CSPs (residues F480 and F481) in the presence of 0 μM (black), 200 μM (green), 600 μM (blue), and 2420 μM (red) integrin β3 ct. (B) Combined amide CSPs of 250 μM 15N paxillin LIM2/3 in the presence of 750 μM integrin β3 vs. residue number of paxillin. Lines indicate average δΔ + 1× s.d. (yellow), δΔ + 2× s.d. (orange), and δΔ + 3× s.d. (red). The amide CSPs were mapped onto the solution structure of paxillin LIM2/3 shown as surface representation from 2 perspectives. Residues showing CSPs larger than average δΔ + 3× s.d. are colored red, residues for which [average δΔ + 3× s.d. < δΔ < average δΔ +2× s.d.] are colored orange, and residues for which [average δΔ + 2× s.d.< δΔ < average δΔ + 1× s.d.] are colored yellow. Residues with δΔ < average + 1× s.d. are colored grey. The boxed region is also shown in stick representation, including the flexible loop of the LIM3 domain using the same color code. Residues experiencing significant CSPs are labelled by amino acid type and position. (C) 15N-HSQC titration of 300 μM 15N paxillin LIM2/3 4A (PXN LIM2/3 4A) with integrin β3. Integrin was added in concentrations up to 1582 μM. Boxes show a selection of signals affected by CSPs (residues F421 and Y453) in the presence of 0 μM (black), 632 μM (green), 1,107 μM (blue), and 1,582 μM (red) PXN LIM2/3 4A. (D) Combined amide CSPs of 250 μM 15N PXN LIM2/3 4A in the presence of 630 μM integrin β3 vs. residue number of paxillin. Lines indicate average Δδ+ 1× s.d. (yellow), Δδ + 2× s.d. (orange), and Δδ + 3× s.d. (red). (E) In vitro pulldown of recombinant His-SUMO PXN LIM2/3 wt or His-SUMO PXN LIM2/3 4A using Strep-Tag ITGB3 ct wt. PXN LIM2/3 4A shows reduced binding to ITGB3. (F) Spreading of paxillin KO cells, stably reexpressing empty vector (PXN KO), GFP-paxillin wt (PXN wt), or paxillin mutants GFP-PXN ΔLIM4 or GFP-PXN-4A. Starved cells were seeded for 30 or 120 min on the integrin β3 ligand vitronectin. The membrane of fixed cells was stained with CellMask Orange to visualize total cell extension. Scale bars represent 20 μm. Below is the quantification of stained area/individual cell at 30 min (orange) and 120 min (blue). Sample sizes are given in brackets. Statistical significance was calculated using one-way ANOVA followed by Bonferroni multiple comparison test (ns: not significant; *** p ≤ 0.001; ** p ≤ 0.01). The data underlying this panel can be found in S1 Data.

Paxillin directly associates with integrin β3 in the absence of kindlins to promote cell spreading

To finally corroborate the physiological relevance of the direct interaction between integrin β3 and paxillin LIM domains, we first generated integrin β3 KO fibroblasts via CRISPR/Cas9 and stably reintroduced either full-length integrin β3 wt or the truncated integrin β3 variants, Δ8aa or Δ3aa, which lack the newly characterised paxillin binding site (Fig 4A). Expression of other FA proteins was not altered in these cells (Fig 4B). While integrin β3-deficient cells exhibited a strongly impaired initial spreading on vitronectin- and fibronectin-coated substrates, the reexpression of integrin β3 wt reverted this phenotype (Figs 4C and S5F). In contrast, integrin β3 Δ3aa and, even more so, integrin β3 Δ8aa reexpressing fibroblasts were impaired in their spreading ability (Figs 4C and S5F). A similar spreading defect on integrin ligands has also been reported for kindlin-deficient cells, and deletions of the integrin carboxy terminus might also corrupt the kindlin binding site, indirectly affecting the recruitment of paxillin. To substantiate our biochemical findings of a direct paxillin interaction with the integrin β subunit, we employed kindlin1- and kindlin2-deficient double KO cells [20,26]. As these cells display strongly diminished expression of integrin β3 compared to wt fibroblasts, we introduced integrin β3 wt, integrin β3 Δ8aa, or integrin β3 Δ3aa into the kindlin1/2 KO cells (Fig 4D). In the kindlin KO cells, the reexpression of integrin β3 wt or its variants did also correct the reduced levels of integrin αv but did not affect levels of other FA proteins (Fig 4D and 4E). In line with the lack of integrin β3 expression, the mock-transfected kindlin1/2-KO fibroblasts hardly attached and did not spread on vitronectin-coated substrates (Fig 4F). This phenotype has been reported before and has been used to demonstrate the essential role of kindlins in integrin-mediated cell adhesion [20]. However, even in the absence of kindlin1/2, cell spreading on vitronectin was partially recovered upon expression of integrin β3 wt (Fig 4F). Importantly, the newly appearing adhesion sites in integrin β3 wt expressing cells stained positive for paxillin and expression of integrin β3 mutants with a truncated paxillin binding site did not support cell attachment on vitronectin (Fig 4F). Furthermore, paxillin-positive adhesions in integrin β3 wt expressing kindlin1/2-KO cells appeared upon plating onto vitronectin, but not upon plating onto poly-L-lysine, and these integrin β3-mediated contacts also stained positive for talin (Fig 4F). Altogether, our results provide evidence of a direct binding interaction between the distal carboxy terminus of integrin β3 and a flexible loop in the paxillin LIM3 domain. This direct association localizes paxillin to FAs in the absence of kindlins and modulates integrin β3-initiated cellular responses.

10.1371/journal.pbio.3002757.g004 Fig 4 The paxillin–integrin β3 interaction allows cell attachment in the absence of kindlins.

(A) Flow cytometric analysis of NIH Flp-In integrin β3 KO and the indicated ITGB3 wt, ITGB3 Δ8aa, or ITGB3 Δ3aa reexpressing cell lines. Cells were left unstained or stained against mouse integrin β3 or with an isotype matched control IgG. (B) WCLs of cell lines in (A) were probed with the indicated antibodies directed against core FA proteins. Tubulin was used as loading control. (C) Serum starved cells as in (A) were seeded onto vitronectin-coated (5 μg/ml) glass slides for 30 min, and cell area was measured. Shown are mean values and 95% confidence intervals of n = 60 cells per sample from 3 independent experiments. Statistical significance was calculated using one-way ANOVA followed by Bonferroni multiple comparison test (*** p ≤ 0.001). The data underlying this panel can be found in S1 Data. (D) Flow cytometric analysis of Kindlin 1/2 flox cells (KindCtrl), Kindlin 1/2 KO (KindKO), or KindKO cells stably transduced with either murine full-length integrin β3, truncated integrin β3 Δ8aa or Δ3aa, or empty vector backbone (mock). Cells were analysed for their surface expression of various integrin subunits using flow cytometry. (E) WCL from cell lines in (D) were analysed by western blotting with antibodies against indicated core FA proteins. Monoclonal α-tubulin antibody was used as loading control. (F) Serum starved cells as in (D) were seeded on glass coverslips coated with 50 μg/ml vitronectin or poly-Lysine for 4 h. Cells were fixed and stained for endogenous paxillin or talin as indicated. Paxillin- and talin-positive cell attachment sites in ITGB3 wt expressing kindlin1/2 KO cells are indicated with black arrowheads.

Discussion

Although paxillin was discovered more than 30 years ago and constitutes a core FA protein, its mode of FA targeting has remained controversial. Recent biochemical approaches have pointed to an indirect association of paxillin with the integrin β1 and β3 subunits via the integrin binding partner kindlin1 or kindlin2 [21,26]. As the association of kindlin with paxillin appears to rest on the paxillin LD repeats and the LIM4 domain [19,20], these findings do not explain the central role of the LIM3 domain for FA localization, which has been delineated by microscopic observations in intact cells [23]. Here, we present evidence for a direct interaction between the paxillin LIM3 domain and the cytoplasmic tails of integrin β1 and integrin β3, respectively. Together with the indirect link provided by kindlin, the intimate association of paxillin with the integrin β subunit now unveils the full spectrum of paxillin’s FA recruitment modalities and unmasks the fundamental building principles of cellular attachment sites.

In solution, paxillin’s LIM2 and LIM3 domains adopt an overall fold consistent with available structural data for LIM domains of other proteins [13,14,30,31]. However, our NMR structure reveals an intriguing detail, which is conserved in paxillin orthologues from other species. Indeed, the LIM3 domain of paxillin harbours a flexible, surface-exposed loop, which, based on sequence homology, is also present in the paxillin family members Hic-5 and leupaxin. This loop demarcates the integrin binding site in the LIM3 domain and appears to function as a clasp to stabilize the association of paxillin with the integrin cytoplasmic tail. Noteworthy, LIM2 and LIM3 share significant sequence similarity (S2B Fig). This, together with their tandem arrangement, suggests that these LIM domains originate from a gene duplication event as has been proposed by others on a broader context of LIM domain-containing proteins [34].

This additional direct interaction between the integrin β cytoplasmic tail and paxillin’s LIM3 domain now consolidates an emerging principle of FA organization: Each core component of FAs, including talin, kindlin, paxillin, FAK, vinculin, and α-actinin, is able to sustain multiple, independent interactions with other FA components. In analogy to a steel frame construction, this kind of assembly not only allows a stepwise expansion of the protein complex but also provides a further mechanical reinforcement with every incoming component. In the specific example of paxillin, this protein can associate via its LIM4 domain with integrin-bound kindlin2 [19], but then paxillin will also be in place to utilize the flexible loop in its LIM3 domain to bind the integrin β subunit and to reenforce this tripartite complex as a prerequisite for efficient initial cell spreading. Furthermore, as paxillin can interact via its LIM1/2 domains with the talin head [22] and via its LD1 domain with the talin rod region [24], there is the possibility that paxillin strengthens the early integrin-associated protein complex beyond kindlin. Indeed, a stabilization of the integrin-talin-kindlin nexus by paxillin has been observed [21]. On first sight, such a cooperative binding scenario seems implausible as the binding sites of paxillin and kindlin at the carboxy terminus of the integrin β3 subunit partially overlap. However, a recent study has highlighted an unforeseen behaviour of asymmetric affinity regulation by integrin tail allostery, where kindlin binding increases the affinity of talin to associate with the same integrin tail, whereas the binding of talin, in turn, decreases kindlin’s affinity for its neighouring binding site [35]. This surprising finding suggests that while kindlin exhibits cooperative binding behaviour towards talin-association with integrin β1, talin shows competitive behaviour towards kindlin-binding to the same integrin tail. However, despite the decreased kindlin–integrin affinity in the presence of talin, a ternary complex between integrin, talin, and kindlin is observed, as this ternary complex is stabilized by additional talin–kindlin interactions [35].

We also can envision that the flexible loop of paxillin LIM3 enables this protein to associate with a minimal binding site encompassing the carboxy-terminal amino acids of the integrin β3 tail, even though this binding site partially overlaps with the kindlin binding site and vice versa. However, such a presumably competitive behaviour with regard to direct integrin association might be compensated by the binding interactions between paxillin and kindlin/talin, which are mediated by paxillin’s LIM4 and LD domains, respectively. While the affinity of an individual interaction between paxillin and integrin β3 with KD approximately 500 μM is surprisingly weak, many of such interactions are formed during FA assembly. Similar to other well-known, multivalent interactions, such as those mediated by oligosaccharide–lectin interactions in cell–cell recognition, such interactions may become—through avidity—very strong but still allow for fast assembly and disassembly through Velcro-like mechanisms. In this regard, multiple reciprocal interactions between talin, kindlin, paxillin, and the integrin β tail would also increase the avidity and might demonstrate once more how multivalent low-affinity interactions such as those observed for paxillin LIM3 and integrin β3 stabilize macromolecular networks. Accordingly, the relatively low affinity between LIM3 and integrin β3 might be a prerequisite for efficient assembly and disassembly of FAs.

Intriguingly, such reciprocal interactions between FA core components could also be the basis for the astonishing flexibility in the temporal sequence, in which these proteins can assemble at integrin cytoplasmic domains. For example, talin binding to the integrin β tail appears as a prerequisite for the recruitment of its binding partner FAK [36,37], while the opposite sequence of assembly has also been reported [38,39]. This behaviour is mirrored by kindlin and paxillin, as kindlin is able to recruit paxillin, while the direct binding of paxillin to the β subunit can turn this sequence of events on its head and could potentially allow paxillin-dependent recruitment of kindlin. Interestingly, one of the factors, which determines the order of assembly, appears to be the nature of the involved integrin heterodimer. In particular, differences between integrin α5β1 and integrin αvβ3 do not only exist with regard to the ligand spectrum but also how they convey the ligand binding event into the cell [10]. In this regard, α5β1 integrins are known to determine adhesion strength and form catch bonds with their ligands, when increasing forces are applied [40,41]. The elevated binding affinity of paxillin for integrin β1 and its ability to associate with talin and kindlin might reflect this need to withstand high forces. Although integrin αvβ3 is not able to sustain the high binding strength of α5β1 integrin, integrin αvβ3 exhibits faster binding rates and stimulates integrin α5β1-mediated binding [42,43]. Interestingly, the fast binding rate of integrin αvβ3 correlates with its increased ability to recruit paxillin and its propensity to initiate larger paxillin-positive adhesion sites [43,44]. Furthermore, on patterned substrates, cell spreading and paxillin recruitment preferentially occur via the vitronectin-binding integrin αvβ3 [45]. Together with our findings of a prominent recruitment of paxillin to integrin β3 in kindlin-deficient cells and of reduced spreading of paxillin LIM3-4A expressing cells on vitronectin, all these observations suggest a particularly prominent role for the direct association of the paxillin LIM3 domain with integrin β3. It is also interesting to note that the paxillin LIM3 domain appears to latch onto a specific section of the integrin β3 subunit at the far carboxy terminus, which shows significant CSPs upon binding. The C-terminal amino acids of integrin β3 differ from all other β subunits, making this a unique recognition site and helping to explain this peculiar interaction mode of paxillin and integrin β3. These residues can also serve as an unconventional binding site for the SH3 domains of various Src family kinases, adding to Src kinase activation upon integrin engagement [46–48]. Accordingly, a reduction in Src kinase activity could also contribute to the spreading phenotype of kindlin KO cells expressing truncated integrin β3 variants.

Although further studies are needed to delineate the stoichiometry of talin, kindlin, and paxillin at clustered integrin β subunits, our structural elucidation of the paxillin LIM2 and LIM3 domains and their association with the integrin β carboxy terminus now provides the foundation to probe and manipulate the functional contribution of paxillin to matrix adhesion and cell spreading.

Materials and methods

Antibodies and dyes

The following primary and secondary antibodies were used at indicated concentrations: anti-human α-actinin1 (mouse monoclonal, BM75.2, Sigma Aldrich, A5044; WB 1:1,000), anti-human talin (mouse monoclonal, 8d4, Sigma Aldrich, T3287; WB 1:750), anti-human FAK (rabbit polyclonal, A-17, Santa Cruz, sc-557; WB 1:250), anti-human kindlin2 (mouse monoclonal, 3A3, Merck, MAB2617; WB 1:1,000, IF 1:200), anti-mouse kindlin2 (rabbit polyclonal, 11453-1-AP, Proteintech; WB 1:2,000), anti-human cSRC (rabbit polyclonal, SRC2, Santa Cruz, sc-18; WB 1:1,000), anti-human ILK (rabbit monoclonal, EP1593Y, Epitomics; WB 1:1,000), anti-human p130Cas (rabbit polyclonal, N17, Santa Cruz; WB 1:1,000), anti-human vinculin (mouse monoclonal, VIN-1, Sigma Aldrich, V9131; WB 1:1,000), anti-human Hic-5 (mouse monoclonal, 34, BD Biosciences, 611164; WB 1:500), anti-human paxillin (mouse monoclonal, 5H11, Thermo Fisher Scientific, AHO0492; WB 1:1,000, IF 1:200), anti-GAPDH (mouse monoclonal, GA1R, Thermo Fisher Scientific, MA5-15738-HRP), anti-human Rac (rabbit polyclonal, invitrogen, PA5-17519; WB 1:1,000), anti-human CEACAM1, 3, 4, 5, 6 (mouse monoclonal, D14HD11, Aldevron; WB 1:6,000, IF 1:200); mouse monoclonal anti 6xHis (mouse monoclonal, HIS.H8, Thermo Fisher Scientific, MA1-21315; WB 1:2,000), anti GFP (mouse monoclonal, JL8, Clontech; WB: 1:6,000), anti-human tubulin (mouse monoclonal, E7, purified from hybridoma cell supernatants, Developmental Studies Hybridoma Bank, University of Iowa, USA; WB 1:1,000), anti-mouse integrin β1 (Armenian hamster monoclonal, Hmb1-1, Thermo Fisher Scientific, 11-0291-82; FC 1:300), anti-mouse integrin β3 (Armenian hamster monoclonal, 2C9.G3, Thermo Fisher Scientific, 13-0611-81; FC 1:200), anti-mouse integrin α5 (rat monoclonal, MFR5, BD Biosciences, 553319; FC 1:300), anti-mouse integrin αV (rat monoclonal, RMV-7, BD Biosciences, 550024; FC 1:300). Secondary antibodies used: horseradish peroxidase (HRP)-conjugated goat anti-mouse; WB: 1:10,000, HRP-conjugated goat anti-rabbit; WB: 1:5,000; Cy5-conjugated goat anti-mouse; IF 1:200, Dylight 488 conjugated goat anti-mouse, IF 1:200, Rhodamine Red-X–conjugated goat anti-arm. Hamster; FC 1:300, Rhodamine Red–conjugated goat anti-rat; FC 1:300 (all from Jackson ImmunoResearch, Baltimore, USA). CellMask Orange Plasma membrane stain, Thermo Fisher Scientific, C10045; IF 1:1,000.

Cell culture and transient transfection

Human embryonic kidney 293T cells (293T; American Type Culture Collection CRL-3216) were grown in DMEM supplemented with 10% calf serum. Flp-In 3T3 murine fibroblasts (Thermo Fisher Scientific) were cultured in DMEM supplemented with 10% fetal calf serum (FCS) and 1% nonessential amino acids. GFP-FAK expressing mouse embryonic fibroblasts (GFP-FAK MEFs) derived from FAK/p53 −/− KO MEFs [49] and Kindlin1/2 KO fibroblasts [20,26] were cultured in DMEM supplemented with 10% FCS and 1% nonessential amino acids on gelatine-coated (0.1% in PBS) cell culture dishes. All cells were maintained at 37°C, 5% CO2, and subcultured every 2 to 3 days.

For transient transfection of 293T cells, cells were seeded at 25% confluence the day before and transfected using the standard calcium phosphate method with a total amount of 5 μg plasmid DNA/dish. For transient transfection of Flp-In 3T3 cells, 1 × 105 cells were seeded into 6-well plates the day before and transfected with using jetPRIME transfection reagent (Polyplus transfection, Illkirch, France), following manufacturer’s protocol. GFP-FAK MEFs were transiently transfected with Lipofectamin 2000, according to manufacturer’s recommendations.

Whole cell lysates (WCLs) and WB

WCLs were generated by lysing equal cell numbers in radioimmunoprecipitation assay buffer (1% Triton X-100, 50 mM Hepes, 150 mM NaCl, 10% glycerol, 1.5 mM MgCl2, 1 mM EGTA, 0.1% wt/vol SDS, and 1% vol/vol deoxycholic acid) supplemented with freshly added protease and phosphatase inhibitors (10 mM sodium pyrophosphate, 100 mM NaF, 1 mM sodium orthovanadate, 5 μg/ml leupeptin, 10 μg/ml aprotinin, 10 μg/ml Pefabloc, 5 μg/ml pepstatin, and 10 μM benzamidine) and phosphatase saturating substrate (para-nitrophenolphosphate [pNPP]; Sigma-Aldrich; 10 mM). Chromosomal DNA was mechanically sheared by passing through a metal needle. DNA and cell debris were pelleted by addition of sepharose beads and centrifugation (13,000 rpm, 30 min, 4°C). Supernatant was supplemented with 4× SDS sample buffer (4% wt/vol SDS, 20% wt/vol glycerol, 125 mM Tris-HCl, 20% vol/vol β-mercaptoethanol, and 1% wt/vol Bromophenol blue (pH 6.8)) and boiled for 5 min at 95°C. Proteins were resolved on 10% to 18% SDS-PAGE. After separation, the proteins were transferred to a polyvinylidene fluoride membrane (Merck Millipore), followed by blocking in 2% BSA containing 50 mM Tris-HCl, 150 mM NaCl, and 0.05% Tween 20 (pH 7.5) (TBS-T) buffer. The membrane was incubated with primary antibody in blocking buffer overnight at 4°C, washed 3 times with TBS-T, and incubated with HRP-conjugated secondary antibody in TBS-T for 1 h at RT. The chemiluminescent signal of each blot was detected with ECL substrate (Thermo Fisher Scientific) on the Chemidoc Touch Imaging System (Bio-Rad) in signal accumulation mode. Acquired images were processed in Adobe Photoshop CS4 by adjusting illumination levels of the whole image. Original uncropped and minimally adjusted images of all western blots can be found in S1 Raw Images.

Recombinant DNA

The construction of His6SUMO-tagged talin F3, eGFP-tagged full-length talin, His6SUMO-kindlin2, as well as the generation of the Twin-Strep-tag vector for bacterial expression has been described in detail [50]. The generation of CEA3-ITGB3-CT fusion constructs has been described previously [28]. cDNA of human paxillin isoform a (NM_002859.4) was kindly provided by Alexander Bershadsky (Mechanobiology Institute, National University of Singapore, Singapore) and was used as template for polymerase chain reaction (PCR) amplification. His6SUMO-PXN LIM2/3 was generated by amplifying paxillin using primers: PXN LIM2/3 forward: 5′-CCAGTGGGTCTCAGGTGGTTCCCCGCGCTGCTAC-3′; PXN LIM2/3 reverse: 5′-CTGATCCTCGAGTTACCCATTCTTGAAATATTCAGGCGAGCCGCGCCGCTC-3′. The product was then ligated into pET24a His-Sumo bacterial expression vector using Eco31I and XhoI restriction sites.

Paxillin full length was amplified using primers PXN-fl forward: 5′-ACTCCTCCCCCGCCATGGACGACCTCGACGCCCTGCTG-3′ and PXN-fl reverse: 5′-CCCCACTAACCCGCTAGCAGAAGAGCTTGAGGAAGCAGTTCTGACAGTAAGG-3′. Paxillin LD1-5 was amplified using primers PXN-fl forward and PXN LD1-5 reverse: 5′-CCCCACTAACCCGCAGCTTGTTCAGGTCAG-3′. Paxillin LIM1-4 was amplified using primers PXN-LIM1-4 forward: 5′- ACTCCTCCCCCGCCATGAAGCTGGGGGTCGCCACAGTCGCCAAAG-3′ and PXN-fl reverse.

cDNAs encoding LIM domain proteins: Hic-5 cDNA (isoform 1, NM_001042454.3) was kindly provided by Nicole Brimer (University of Virginia, Charlottesville, USA). Hic-5 was amplified using the primers Hic-5 forward: 5′- ACTCCCCCGCCATGGAGGACCTGGATGCCC-3′ and Hic-5 reverse: 5′- CCCCACTAACCCGTCAGCCGAAGAGCTTCAGG-3′. Leupaxin was amplified from pOTB7-LPXN (obtained from Harvard Medical School PlasmID Database; HsCD00331641) using primers LPXN forward: 5′- ACTCCTCCCCCGCCATGGAAGAGTTAGATGCC-3′ and LPXN reverse: 5′- CCCCACTAACCCGGCATTACAGTGGGAAGAGC-3′. PINCH-1 was amplified from pDNR-LIB hLIMS1 (obtained from Harvard Medical School PlasmID Database, HsCD00326503) using the primers PINCH forward: 5′-ACTCCTCCCCCGCCATGGCCAACGCCCTGGCCAGC-3′ and PINCH reverse: 5′-CCCCACTAACCCGTTTCCTTCCTAAGGTCTCAGC-3′. cDNA for LASP-1 was provided by Elke Butt (Universitätsklinikum Würzburg, Würzburg, Germany) and amplified using primers LASP forward: 5′- ACTCCTCCCCCGCCATGAACCCCAACTGCGCC-3′ and LASP reverse: 5′- CCCCACTAACCCGTCAGATGGCCTCCACGTAGTTGG-3′.

The respective PCR products were cloned into the pDNR-Dual-LIC vector according to the ligation independent cloning (LIC) strategy. The sequence verified constructs were then subcloned into the expression vector pEGFP-C1 harbouring a loxP recombination site via Cre-Lox recombination.

mEmerald-Migfilin was a gift from Michael Davidson (Addgene #54182) and was used unmodified. pEGFP-Zyxin was described elsewhere [51].

Site directed mutagenesis

The amino acid residue of interest was changed using the overlap-extension PCR mutagenesis procedure. Desalted oligonucleotide primers were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany) and can be found in following table. Human Paxillin LIM2/3 was used as a template.

Mutation Forward primer Reverse primer

Paxillin LIM2/3 F475A gcaGTGAACGGCAGCTTCTTC TGGCGTGAAGCATTCCC

Paxillin LIM2/3 V476A gcaAACGGCAGCTTCTTCGAGC GAATGGCGTGAAGCATTCC

Paxillin LIM2/3 N477A gcaGGCAGCTTCTTCGAGCAC CACGAATGGCGTGAAGCATTCC

Paxillin LIM2/3 G478A gcaAGCTTCTTCGAGCACGACG GTTCACGAATGGCGTGAAGC

Paxillin LIM2/3 S479A gcaTTCTTCGAGCACGACGG GCCGTTCACGAATGGCGTG

Paxillin LIM2/3 F480A gcaTTCGAGCACGACGGGCAG GCTGCCGTTCACGAATGG

Paxillin LIM2/3 F481A gcaGAGCACGACGGGCAGCCCTAC GAAGCTGCCGTTCACGAATGGC

Paxillin LIM2/3 4A tgcagctTTCTTCGAGCACGACGG gctgCGAATGGCGTGAAGCATTC

Recombinant protein expression

Recombinant proteins with His6-SUMO tag encoded on a pET24a vector were expressed in E. coli Tuner (DE3) cells. Cells were cultured in lysogeny broth medium containing 50 μg/mL kanamycin and 1% glucose (wt/vol) (for paxillin constructs additionally 0.1 mM ZnCl2) at 37°C until an OD600 value of 0.6 to 0.8 was reached. Subsequently, overexpression was induced by addition of isopropyl β-D-thiogalactoside (IPTG) to a final concentration of 0.5 mM (for integrin β1 1 mM, respectively). After 6- to 8-h incubation (for integrin-β1 overnight, respectively) at 30°C, cells were harvested by centrifugation at 10,000 × g for 15 min at 4°C and stored at −80°C. For isotopic labelling, bacteria were cultured in M9-minimal medium containing 15N ammonium chloride and/or 13C glucose as sole nitrogen and carbon sources. Integrin cytoplasmic domains with a TwinStrepTagII tag encoded on a pET24a vector were expressed in E. coli BL21(DE3) pRosetta cells. Cells were cultured in lysogeny broth medium containing 50 μg/mL kanamycin. Expression conditions were identical to His6-SUMO integrin β cytoplasmic tails. His6-SUMO, His6-SUMO-tagged talin F3, and kindlin2 were expressed in E. coli BL21(DE3). Bacteria were grown at 37°C to an OD of 0.6 to 0.8 and induced with 1 mM IPTG overnight at 30°C (His6-SUMO and talin F3) or 20°C (kindlin2).

Protein purification

All steps were performed at 4°C. Pelleted cells were slowly thawed on ice, resuspended in 1:5 (wt/vol) lysis buffer (50 mM Tris, 300 mM NaCl (pH 8.0), protease inhibitors), and lysed via a high-pressure homogenizer (Emulsiflex C3, Avestin, Ottawa, Canada). The mixture was separated by ultracentrifugation at 100,000 × g for 30 min at 4°C, and supernatant was loaded onto a HisTrap HP column (GE Healthcare, Freiburg, Germany) preequilibrated with 50 mM Tris, 10 mM imidazole and 300 mM NaCl (pH 8.0). The loaded column was washed and eluted fractions, monitored by UV absorbency at 280 nm, were pooled and dialyzed in 50 mM Tris, 300 mM NaCl (pH 8.0). After overnight cleavage with Ulp1, the His6-SUMO tag was removed by subsequent HisTrap purification and protein solution was subjected to size-exclusion by using HiLoad 16/60 Superdex 30 (for integrin constructs) or Superdex 75 column (for paxillin constructs, GE Healthcare, Freiburg, Germany) preequilibrated with 50 mM Na2HPO4, 150 mM NaCl (pH 6.2) (for integrin constructs) or 7.5 (for paxillin constructs). For paxillin constructs, all buffers contained also 0.1 mM ZnSO4 and 1 mM DTT, respectively. Purified protein was checked by SDS-PAGE.

Pulldown assays with integrin β cytoplasmic domains

Approximately 2.5 μg of TwinStrep-tagged integrins or 10 μg of biotin-integrin peptides (β3wt aa742-788 (Biotin-HDRKEFAKFEEERARAKWDTANNPLYKEATSTFTNITYRGT-OH), β3Δ3aa aa742-785 (Biotin-HDRKEFAKFEEERARAKWDTANNPLYKEATSTFTNITY-OH), β3Δ8aa aa742-780 (Biotin-HDRKEFAKFEEERARAKWDTANNPLYKEATSTFT-OH); all from Novopep Limited) were loaded onto Strep-Tactin Sepharose beads (50% suspension; IBA Lifesciences) or streptavidin agarose beads (50% suspension; 16–126; Merck) in pulldown buffer (50 mM Tris (pH 8), 150 mM NaCl, 10% glycerol, 0.05% Tween, 10 μM ZnCl2) for 30 min at RT under continuous rotation. After centrifugation (2,700g, 2 min, 4°C), samples were washed 3 times with pulldown buffer. Then, integrin-loaded beads were suspended in bait protein solution (2 μM of protein diluted in pulldown buffer) and incubated 2 h at 4°C under constant rotation. Samples were centrifuged (2,700g, 2 min, 4°C) and washed 3 times with pulldown buffer. Strep-Tactin samples were eluted under native conditions by adding 30 μl of buffer BXT (50 mM Tris (pH 8), 150 mM NaCl, 50 mM biotin). After 10-min incubation at RT under constant rotation, samples were centrifuged. Supernatants were mixed with 4× SDS and boiled for 5 min at 95°C before they were subjected to WB. Streptavidin agarose beads were directly mixed with 2× SDS and boiled for 10 min at 95°C to elute proteins from biotin-integrin peptides before they were subjected to WB.

Resonance assignment

All NMR-experiments for the resonance assignment and structure determination were recorded on a Bruker Avance III 600 MHz spectrometer equipped with an H/C/N TCI cryoprobe. Three-dimensional spectra were recorded using nonuniform sampling (25% to 50% sparse sampling) and reconstructed by recursive multidimensional decomposition (Topspin v3.1–3.2). NMR-sample conditions: 500 μM 13C-15N-Paxillin-LIM2/3, 150 mM NaCl, 50 mM Na2HPO4, 4 mM NaN3, 1 mM DTT, 5% (or 100% D2O) (pH 7.5). Recorded 3D-spectra in 5% D2O: HNCO, HN(CA)CO, CBCANH, CBCA(CO)NH, H(CCCO)NH, (H)C(CCO)NH, NOESY-15N-HSQC, NOESY-13Cali.-HSQC; in 100% D2O: H(C)CH-TOCSY, (H)CCH-TOCSY, H(C)CH-COSY, NOESY-13Cali.-HSQC, NOESY-13Caro.-HSQC (NOESY mixing time: 120 ms in all spectra). Backbone resonance assignment was done semiautomatically using CARA v1.8.4.2 and Autolink II v0.8.7 [52]. The sidechain resonances were assigned manually. A nearly complete backbone assignment was achieved (99%) while N477 and N505 did not show amide resonances probably due to exchange broadening. The extent of the resonance assignment over all was 90% (see also Table 1). NOESY cross-peaks were picked and quantified using ATNOS [53] (implemented in UNIO’10 v2.0.2 [54]). TALOS-N was used to calculate φ- and ψ-angles based on the backbone chemical shifts [55]. The resonance assignment of paxillin LIM2/3 has been deposited to the BMRB (Entry 51154).

10.1371/journal.pbio.3002757.t001 Table 1 Resonance assignment and structure determination statistics.

Resonance assignment	
Backbone resonances	1H: 99%; 13C: 99%; 15N: 97%	
All resonances	1H: 91%; 13C: 92%; 15N: 77%	
NMR constraints	
Total unambiguous distance restraints	1,226 (100.0%)	
Intraresidue (i, i)	303 (24.7%)	
Sequential (i, i+1)	354 (28.9%)	
Medium-range (2≤|i-j|≤4)	151 (12.3%)	
Long-range (|i–j|>4)	418 (34.1%)	
Total dihedral angle restraints	343	
φ	100	
ψ	100	
χ1	99	
χ2	31	
χ3	31	
Ensemble statistics (20 structures)	
Violation analysis	
Maximum distance violation (Å)	0.61	
Maximum dihedral angle violation region (deg.)	12.19	
Target function	
Mean CYANA target function	5.75 ± 0.5	
RMSD from mean structure	
Backbone heavy atoms (Å)	0.77 ± 0.17 (LIM2, P381-F438)
0.78 ± 0.30 (LIM3, P440-R497)	
All heavy-atoms (Å)	1.20 ± 0.16	
Ramachandran plot	
Most-favorable regions (%)	77.4	
Additionally allowed regions (%)	21.3	
Generously allowed regions (%)	1.0	
Disallowed regions (%)	0.4	

Structure calculation

Initial structure calculation was done using Cyana v3.0 [56], with the protein sequence, the resonance assignment (CARA), NOESY-peaklists (ATNOS), and backbone angular restraints (TALOS-N) as input. In later stages of the calculation, additional distance and angular constraints for a tetrahedral Zinc-coordination of the respective amino acids were implemented according to [57]. The coordination mode of the 4 histidines (H403, H406, H462, and H492) was determined by the difference of chemical shifts of Cδ2 and Cε1 [58], and in all cases, δ (Cε1)–δ (Cδ2) was larger than 17 ppm indicating a coordination via Nδ1 for all histidines. The structures were visualized and analyzed with PyMOL v1.3 (The PyMOL Molecular Graphics System, Version 2.0 Schrödinger, LLC). The coordinates of the final ensemble have been deposited to the PDB (Accession code: 7QB0)

Chemical shift perturbation mapping

1H-15N HSQC spectra were recorded on a Bruker Avance III 600 MHz spectrometer equipped with a 5-mm BBI probe and a Bruker Avance NEO 500 MHz equipped with a H/C/N TCI CryoProbe Prodigy (Bruker Biospin GmbH, Rheinstetten, Germany). Chemical shifts were referenced to internal sodium 3-(Trimethylsilyl)propane-1-sulfonat-d6 (DSS) at 0.0 ppm. The spectra were processed and analyzed with Topspin v2.1–4.0 (Bruker Biospin GmbH, Rheinstetten, Germany) and CARA (v. 1.9.1.5.). For NMR-experiments, the proteins were concentrated by repeated ultrafiltration (Amicon Ultra-4 Ultracel-3 kDa centrifugal filter device, Merck Millipore, Burlington, USA).

Experiments were performed at 298 K in buffer containing 50 mM Na2HPO4, 150 mM NaCl, 0.1 mM ZnSO4, 1 mM DTT, 5% D2O (pH = 6.2) (if integrin was 15N-labeled) or pH = 7.5 (if paxillin was 15N-labeled). Experimental procedure: To a sample of 15N-labeled protein, a stock solution of unlabeled interaction partner up to a final concentration of the respective constructs was added for collecting 1H-15N HSQC spectra. The resonance assignment of integrin β1 was transferred from BMRB entry 16159 [59] and for integrin β3 from the BMRB entry 15552 [60]. Chemical shift change (Δδ) was calculated with the equation Δδ=0,5*[ΔδH2+0,14*ΔδN2]

where Δδ [ppm] = δbound − δfree. The titration curves were fitted in OriginPro (v. b9.5.5.409) using the equation Δδ([L],[P])=Δδmax([P]+[L]+KD)−([P]+[L]+KD)2−4[P][L]2[P]

A simultaneous fit for multiple signals was used, allowing individual Δδmax values for each residue, but a global value for the dissociation constant KD.

sgRNA design and cloning

For the generation of recombinant sgRNA-expression vectors, we equipped the pBluescript vector (pBS SK+, Agilent Technologies, Santa Clara, CA, USA) with the murine U6 promotor controlled sgRNA expression cassette from pSpCas9(BB)-2A-GFP (PX458, a gift from Feng Zhang, Addgene plasmid # 48138) [61]. Therefore, we amplified the U6 controlled sgRNA expression cassette by PCR with the following primer pair: U6_sgRNA_forward: 5′-ATAGGTACCGTGAGGGCCTATTTCCC-3′ U6_sgRNA_reverse: 5′-ATACTCGAGGTCTGCAGAATTGGCGC-3′. The resulting construct was cloned into pBS SK+ via XhoI and KpnI restriction sites. The sequence verified construct (pBS-U6) was then digested with BbsI and ligated with the annealed primer pair

MCS_oligo_forward:

5′-CACCGGGTCTTCGATGGGCCCAATTCGAATACACGTGGTTGATTTAAATGGG

CCCGAAGACCT-3′

MCS_oligo_reverse:

5′-AAACAGGTCTTCGGGCCCATTTAAATCAACCACGTGTATTCGAATTGG

GCCCATCGAAGACCC-3′

to create pBS-U6 with a multiple cloning site (pBS-U6-MCS) within the BbsI restriction sites. To generate the respective pBS-U6-Cer-sgRNA plasmid, the following sgRNA Oligos Cer-KO forward: 5′-CACCGCCGTCCAGCTCGACCAGGA-3′ and Cer-KO reverse: 5′-AAACTCCTGGTCGAGCTGGACGGC-3′ were annealed and ligated into the pBS-U6-MCS vector via the BbsI restriction sites. To eliminate remaining pBS-U6-MCS after the ligation step, samples were digested with BstBI. All constructs were sequence verified by LGC Genomics.

For targeting paxillin, the sgRNA oligos targeting exon 2 PXN-KO sense: 5′-CACCGACGGTGGTGGTGGGACCGG-3′ and PXN-KO reverse: 5′-AAACCCGGTCCCACCACCACCGTC-3′ were annealed and ligated into pSpCas9(BB)-2A-GFP (PX458-sgRNA mPXN)). For targeting murine integrin β3, the sgRNA oligos targeting exon 2 mITGB3-KO sense: 5′-CACCGCGGACAGGATGCGAGCGCAG-3′ and mITGB3-KO reverse: 5′-AAACCTGCGCTCGCATCCTGTCCGC-3′ were annealed and ligated into pBS-U6-MCS to generate pBS-U6-mITGB3-sgRNA.

All sgRNAs were designed with the help of the CRISPR design tool (http://crispr.mit.edu) [62] and E-CRISP (www.e-crisp.org/E-CRISP).

Generation of integrin β3 and paxillin knockout cell lines

For the generation of integrin β3 and paxillin KO cell lines, Flp-In 3T3 cell line (Invitrogen) was first stably transduced with a lentiviral vector encoding Histon2B mCerulean. Therefore, human histone 2B cDNA (H2B, gift from Thomas U. Meyer, University of Konstanz, Konstanz, Germany) was amplified by PCR with the following primer pair: hH2B_forward: 5′-ATAGCTAGCACCATGCCAGAGCCAGCGAAGTC-3′ hH2B_reverse: 5′-ATAACCGGTTTAGCGCTGGTGTACTTGG-3′ and cloned into pmCerulean-C1 (gift from David Piston, Vanderbilt University Medical Center, Nashville, USA) via NheI and AgeI restriction sites. The resulting construct was again subjected to PCR amplification with primers: H2B-Cer_forward: 5′-ATAGGATCCACCATGCCAGAGCCAGCGAAG-3′ and H2B-Cer_reverse: 5′-ATACTCGAGCTATTTGTACAGTTCGTCCATGCCG-3′. The PCR product was subcloned into pWZL Blasticidin (pWZLBlast, gift from Nicole Brimer, University of Virginia, Charlottesville, USA) via BamHI and XhoI restriction sites to generate pWZLBlast-H2B-Cer. For retroviral production, 80% confluent Phoenix-Eco cells [63] were transfected with pWZLBlast-H2B-Cer and cultured for 2 days. Afterwards, the supernatant was harvested, filtered through a 0.45-μm pore-size filter unit (Minisart, Sartorius Stedim Biotech GmbH, Göttingen, Germany) and applied on previously seeded NIH3T3 Flp-In cells at a ratio of 1:1 (vol/vol, supernatant: NIH3T3 growth medium) together with 4 μg/ml Polybrene (Sigma-Aldrich). Transduced cells were cultured in regular growth medium supplemented with 5 μg/ml blasticidin (Carl Roth GmbH + Co. KG, Karlsruhe, Germany). Cerulean-positive cells were sorted by FACS and seeded as single cells into 96-well plates to generate clonal Cerulean-positive NIH3T3 H2B-Cer Flp-In cell lines.

Paxillin KO cells were generated by transiently transfecting NIH3T3 H2B-Cer Flp-In cells with a combination of PX458-sgRNA mPXN + pBS-U6-Cer-sgRNA at a ratio of 1:5. Integrin β3 KO cells were generated by transiently transfecting NIH3T3 H2B-Cer Flp-In cells with a combination of PX458-sgRNA Cer + pBS-U6-mITGB3-sgRNA at a ratio of 1:5. Ten days after transfection, single cerulean-negative cells were sorted into 96-well plates and clonal cell lines were expanded and KO of the target protein was verified by western blot.

Stable complementation of knockout cells

For complementation of integrin β3, cDNA of murine integrin β3 (gift from Michael Davidson, Addgene plasmid # 54130) was amplified by PCR using the following primers mITGB3 forward: 5′-GATGACACTAGTGACCGCCATGCGAGCGCAGTG-3′ and mITGB3-fl reverse: 5′- TCGGCAGCCCTCGAGCTAAGTCCCCCGGTAGGTGATATTG-3′; mITGB3 forward and mITGB3Δ8aa reverse: 5′-TCGGCAGCCCTCGAGCTAGAAGGTGGAGGTGGCCTCTTTATAC-3′; mITGB3 forward and mITGB3Δ3aa reverse: 5′-TCGGCAGCCCTCGAGCTAGTAGGTGATATTGGTGAAGGTGGAGGTG-3′.

The respective products were cloned into pEF5/FRT-DEST (gift from Rajat Rohatgi, Addgene plasmid # 41008) using SpeI and PspXI restriction sites.

For complementation of Flp-In paxillin KO cells, we equipped the expression vector pEF5/FRT-DEST with a GFP-tag adjacent to a LoxP site for C-terminal protein tagging via Cre-Lox recombination. Therefore, the respective sequence was amplified by PCR from pEGFP C1 (Clontech, Takara Bio Europe, Saint-Germain-en-Laye, France) with the following primer pair: EGFP_forward: 5′-GCCTAGACTAGTTAGCGCTACCGGTCGCCACCATG-3′ EGFP_reverse: 5′-GCAGCGCTCGAGGGCTGATTATGATCAGTTATCTAGATCC-3′. The resulting construct was cloned into pEF5/FRT-DEST via SpeI and PspXI restriction sites to generate the expression vector pEF5/FRT EGFP C1 loxp.

The coding sequences (CDS) of paxillin was amplified by PCR with the following primers:

PXN-fl forward: 5′-ACTCCTCCCCCGCCATGGACGACCTCGACGCCCTGCTG-3′

PXN-fl reverse: 5′-CCCCACTAACCCGCTAGCAGAAGAGCTTGAGGAAGCAGTTCTGACAGTAAG

G-3′. PXN ΔLIM4 forward: 5′- ACTCCTCCCCCGCCATGGACGACCTCGACGCCCTGCTG -3′, PXN ΔLIM4 reverse: 5′-CCCCACTAACCCGCGAGCCGCGCCGCTCGTGGTAGTGC-3′; the paxillin 4A mutant was generated by overlap extension PCR. In a first PCR, 2 fragments were generated using primers PXN-fl forward and PXN-4A reverse: 5′- TGCTGCTGCAGCGAATGGCGTGAAGCATTCCCGGCACACAAAG -3′. For the second fragment primers PXN-4A forward: 5′- GCTGCAGCAGCATTCTTCGAGCACGACGGGCAGCCCTAC -3′ and PXN-fl reverse were used. In a second step, the 2 fragments were annealed by overlap extension PCR and amplified using primers PXN-fl forward and PXN-fl reverse.

The respective products were cloned into the pDNR-Dual-LIC vector according to the LIC strategy. The sequence verified constructs were then subcloned into the expression vector pEF5/FRT EGFP-C1 by Cre-Lox recombination.

Respective KO cell lines were complemented by transient transfection of 0.8 μg cDNA coding for the gene of interest + 3.2 μg Flp recombinase expression vector (pOG44) using jetPRIME transfection reagent (Polyplus transfection, Illkirch, France). After 3 days, positive cells were selected by addition of 250 μg/ml Hygromycin B for 8 days.

Flow cytometry

Cells were trypsinized and suspended in growth medium. Samples were centrifuged at 100g for 3 min, and the resulting pellet was resuspended in FACS buffer (PBS with 5% FCS, 2 mM EDTA). Cells were washed once in FACS buffer, and 1 × 106 cells per sample were incubated with monoclonal anti-integrin antibodies as indicated for 1 h at 4°C under constant rotation. Cells were washed 3 times with FACS buffer, followed by incubation for 30 min with a Rhodamine-Red–conjugated secondary antibody. Cells were analysed by flow cytometry (BD LSRFortessa, FACSDiva software, BD Biosciences, Heidelberg, Germany).

Cell spreading analysis

Sterile glass coverslips were coated overnight at 4°C with 5 μg/ml vitronectin or 5 μg/ml fibronectin type III repeats 9–11 (FNIII9-11). Cells were starved overnight in starvation medium (DMEM + 0.5% FCS). After 12-h starvation cells were trypsinized, trypsin was inactivated using soybean trypsin inhibitor (Applichem; 0.25 mg/ml in DMEM + 0.25% BSA). Cells were pelleted by centrifugation (100g, 3 min, RT) and suspended in DMEM + 0.25% BSA. Cells were kept in suspension for 30 min before seeding on coated glass coverslips. After 30 and 120 min of adherence, cells were washed once with PBS++ (0.5 mM MgCl2, 0.9 mM CaCl2), fixed with 4% PFA in PBS for 15 min at RT, washed thrice in PBS, permeabilized with 0.4% Triton-X-100 in PBS for 5 min at RT, washed thrice in PBS, and blocked for 30 min in blocking buffer (10% heat-inactivated CS in PBS). Cells were stained with CellMask Orange (diluted to 5 μg/ml in blocking buffer) and DAPI (diluted to 0.2 μg/ml in blocking buffer) for 30 min at RT. Images were analysed by a custom-built ImageJ macro. This macro has been deposited to the Zenodo database (https://zenodo.org/doi/10.5281/zenodo.12736436).

Fluorescent microscopy and microscope settings

For confocal laser scanning microscopy, all images were taken from fixed specimens embedded in Dako fluorescent mounting medium (Dako, Carpinteria, USA) on a LEICA SP5 confocal microscope equipped with a 63.0×/1.40 NA oil HCX PL APO CS UV objective and analyzed using LAS AF Lite software. All images were acquired in xyz mode with 1,024 × 1,024 pixel format and 100 Hz scanning speed at 8-bit resolution. Fluorochromes used are Pacific Blue (excitation 405 nm, emission bandwidth: 435 to 475 nm); CF405M (excitation 405 nm, emission bandwidth: 435 to 475); GFP (excitation 488 nm, emission bandwidth: 500 to 525 nm); CellMask Orange (excitation 561 nm, emission bandwidth: 571 to 613 nm); RFP (excitation 561 nm, emission bandwidth 571 to 613 nm); and Cy5 (excitation 633 nm, emission bandwidth: 640 to 700 nm). Images were processed using ImageJ by applying the same brightness/contrast adjustments to all images within 1 experimental group.

TIRF microscopy

Cells were starved overnight in starvation medium (DMEM + 0.5% FCS). After 12-h starvation cells were trypsinized, trypsin was inactivated using soybean trypsin inhibitor (Applichem; 0.25 mg/ml in DMEM + 0.25% BSA). Cells were pelleted by centrifugation (100g, 3 min, RT) and suspended in DMEM + 0.25% BSA. Cells were kept in suspension for 30 min before seeding on Wilco dishes, coated with 5 μg/ml vitronectin. Cells were imaged with a GE DeltaVision OMX Blazev4, equipped with a 60×/1.49 UIS2 APON TIRFM objective in Ring TIRF mode. Settings were adjusted to reach clean TIRF illumination without epifluorescence. A separate sCMOS camera was used for each channel, and images were later aligned using OMX image alignment calibration and softWoRx 7.0. Fluorophores used were GFP (excitation wavelength 488 nm, emission bandwidth: 528/48 nm) and Cy5 (excitation wavelength 647 nm, emission bandwidth: 683/40 nm).

Opa-protein triggered integrin clustering (OPTIC)

OPTIC was performed as described previously [28]. Briefly, 293T cells were transfected with pcDNA3.1 CEACAM3-ITGB fusion constructs together with cDNA coding for the protein of interest fused to eGFP. Cells were seeded on coverslips coated with 10 μg/ml poly-L-lysine in suspension medium (DMEM + 0.25% BSA), 48 h post-transfection. After 2 h, adherent cells were infected with Pacific Blue–stained Neisseria gonorrhoeae (Opa52-expressing, non-piliated N. gonorrhoeae MS11-B2.1, kindly provided by T. Meyer, Berlin, Germany) at MOI 20 for 1 h in suspension medium. After 1 h, cells were fixed for 15 min with 4% paraformaldehyde in PBS at room temperature followed by 5-min permeabilization with 0.1% Triton X-100 in PBS. After washing with PBS, cells were incubated for 10 min in blocking solution (10% heat-inactivated calf serum in PBS) and stained for CEACAM3. After washing, cells were again incubated for 10 min in blocking solution followed by secondary antibody staining. Coverslips were mounted on glass slides using Dako fluorescent mounting medium (Dako, Carpinteria, USA).

Supporting information

S1 Fig Paxillin and closely related LIM-domain proteins localize to clustered integrin-β1 or -β3 ct.

(A) Schematic overview of the OPTIC workflow. Opa-expressing Ngo are used to cluster CEACAM3-integrin β cytoplasmic tail fusion proteins potentially resulting in the recruitment of an intracellular protein of interest (POI). (B) 293T cells were transiently cotransfected with a CEACAM3-ITGB1 (ITGB1) or CEACAM3-ITGB3 (ITGB3) fusion construct together with GFP-labelled LIM-domain-containing proteins. WCLs of the transfected 293T cells were probed by western blotting with a monoclonal antibody against GFP to detect the expression of GFP-LIM proteins (upper panel). Coomassie staining (lower panel) was used to verify equal loading of the membrane. (C) 293T cells transfected with CEACAM3-ITGB1 (ITGB1) and the indicated GFP-fusion proteins were seeded on poly-L-lysine. Cells were infected for 1 h with Pacific Blue−labelled Neisseria gonorrhoeae (Ngo; blue), fixed, and stained for ITGB1 (red). Recruitment of GFP-LIM proteins to clustered ITGB1 tail is indicated by white arrowheads. Bars represent 2 μm. (D) Quantification of (C). Each data point reflects the recruitment ratio R in a CEACAM3-ITGB1-expressing cell with associated bacteria. Horizontal lines indicate mean values and 95% confidence intervals (whiskers) of n = 60 cells from 3 independent experiments. Statistical significance was calculated using one-way ANOVA, followed by Bonferroni multiple comparison test (*** p < 0.001, ns = not significant). The data underlying this panel can be found in S1 Data. (E) Quantification and statistical evaluation as in (D) of GFP-fusion protein recruitment to CEACAM3-ITGB3 (ITGB3) (see main Fig 1A). The data underlying this panel can be found in S1 Data.

(PDF)

S2 Fig Zinc fingers of the paxillin LIM3 domain show increased structural flexibility and are highly conserved across species.

(A) Heteronuclear 15N{1H} NOE. The intensity ratio between spectra with and without 1H saturation is displayed vs. residue number. Values of 0.8 indicate rigid parts of the structure. Values smaller than 0.8 indicate increasing flexibility on the ps-to-ns timescale. The data underlying this panel can be found in S1 Data. On top of the heteronuclear NOE plot, the domain and secondary structure arrangement of the paxillin construct used in this study is depicted. α-Helices are shown in light blue. β-Sheets as magenta arrows. The secondary structure elements depicted here were identified with Pymol’s dss command and correspond to the cartoon representation of the 3D structural ensemble shown in Fig 2. The linker connecting the LIM2 with the LIM3 domain is shown in green. Regions harboring flexible loops are shown in blue and grey, respectively. (B) Sequence alignment of paxillin LIM3 domain across different species: Alignment was performed using the structural alignment tool from T-Coffee and coloured using the BoxShade tool at ExPASy. Identical residues are shaded in black; highly similar residues are shaded gray. In addition, an alignment is shown of paxillin’s LIM2 and LIM3 domains. The region harboring a flexible loop, which is crucial for binding of the LIM3 domain to β-integrin, is indicated by a blue line.

(PDF)

S3 Fig The cytoplasmic domains of integrin-β1 and integrin-β3 support direct binding of paxillin.

(A) 15N-HSQC titration of 300 μM 15N integrin β1 ct (ITGB1 ct) with paxillin LIM2/3 (PXN LIM2/3). Paxillin was added in concentrations up to 500 μM. Boxes show a selection of signals affected by CSPs (residues K784, T788, and T789) in the presence of 0 μM (black), 150 μM (green), 300 μM (blue), and 650 μM (red) paxillin LIM2/3. Insets show the concentration dependence of combined amide CSPs globally fitted to a one site binding model. (B) Combined amide CSPs of 300 μM 15N integrin β1 ct in the presence of 650 μM paxillin LIM2/3 vs. residue number of integrin β1 ct. (C) 15N-HSQC titration of 300 μM 15N paxillin LIM2/3 (PXN LIM2/3) with integrin β3 ct Δ8aa (ITGB3 Δ8aa). Integrin was added up to a concentration of 600 μM. (D) Combined amide CSPs of 300 μM 15N paxillin LIM2/3 in the presence of 600 μM integrin β3 ct Δ8aa vs. residue number of paxillin LIM2/3. (E) 293T cells were transiently cotransfected with a CEACAM3 ITGB3 (CEA3-ITGB3) fusion construct or the indicated truncated ITGB3 mutants together with GFP or GFP-paxillin and seeded on poly-L-lysine. Cells were infected for 1 h with Pacific Blue–labelled Neisseria gonorrhoeae (Ngo, blue), fixed, and stained for ITGB3 (red). Recruitment of GFP-Paxillin to clustered ITGB3 tails is indicated by white arrowheads. Bars represent 1 μm. (F) Quantification of GFP/GFP-paxillin recruitment to the indicated CEA3-ITGB3 variants from (E). Shown are means and 95% confidence intervals of n = 60 cells from 3 independent experiments. Significance was calculated using one-way ANOVA followed by Bonferroni multiple comparison test. Significance levels compared to paxillin wt are indicated (ns: not significant; *** p ≤ 0.001). The data underlying this panel can be found in S1 Data. (G) Streptactin pulldown of recombinant His-SUMO or His-SUMO-talin F3 using the Strep-tag integrin β3 cytoplasmic tail in the wt form or with a truncation of the carboxy-terminal 3 (Δ3) or 8 (Δ8) amino acids. Integrin β3–associated talin F3 domain was detected by anti-His-tag blot (upper panel); the Strep-tag integrin tails were revealed by streptactin blot (lower panel). The input of purified His-SUMO or His-SUMO-Talin F3 protein is shown on the left hand side. (H) NMR-based interaction study between talin’s FERM domain and integrin β3. Superposition of 15N-HSQC spectra of 15N-labeled wt ITGB3 (left graph) or ITGB3 Δ3 (ΔRGT; right graph). In both experiments, multiple signals of the integrin peptide shift or disappear completely through the interaction with the large FERM domain, indicating equivalent binding of the wt and Δ3 integrin peptide to talin.

(PDF)

S4 Fig NMR experiments with paxillin LIM3 mutants show that conserved aromatic residues in the flexible loop are essential for maintaining a stably folded structure.

Alanine scan of paxillin LIM3’s flexible loop region. Shown are superpositions of 1H-15N-HSQC spectra of wt paxillin LIM2/3 (black) and paxillin LIM2/3 mutants (red). The bar graphs below show the combined amide CSPs of 15N-labelled paxillin LIM2/3 wt compared to the indicated mutant paxillin LIM2/3 along the amino acid sequence. (A) Paxillin LIM2/3 F475A. (B) Paxillin LIM2/3 F480A. (C) Paxillin LIM2/3 F481A. (D) Paxillin LIM2/3 V476A. (E) Paxillin LIM2/3 S479A. (F) Paxillin LIM2/3 4A.

(PDF)

S5 Fig The direct interaction between the paxillin LIM3 flexible loop and integrin β3 contributes to cell spreading.

(A) NIH 3T3 Flp-In cells (NIH3T3) were used to derive paxillin KO cells. Paxillin KO cells were stably transfected with the empty vector (PXN KO) or vectors encoding GFP-paxillin wt (PXN wt), paxillin lacking the LIM4 domain (PXN ΔLIM4), or paxillin with a mutated flexible loop in LIM3 (PXN-4A). Western blot of WCLs with anti-paxillin antibody demonstrates the lack of endogenous paxillin in the PXN KO cells and reexpression of equivalent levels of paxillin wt or mutants in the stably reexpressing cells (upper panel). The lower panel verifies equal loading of samples by anti-tubulin blot. (B) Cells from (A) were starved overnight and seeded for 30 or 120 min, respectively, on the integrin ligand fibronectin in the absence of serum. Cells were fixed and the cell membrane was stained with CellMask Orange. Scale bar represents 20 μm (upper panel). To analyse cell spreading, the area of individual cells was quantified (lower panel). Shown are mean values with 95% confidence intervals from 3 independent experiments for 30-min time point or from 2 independent experiments for 120-min time point. Sample sizes are given in brackets. Statistical significance was calculated using one-way ANOVA followed by Bonferroni multiple comparison test (ns: not significant; *** p ≤ 0.001; ** p ≤ 0.01). The data underlying this panel can be found in S1 Data. (C) TIRF microscopy images of PXN KO and reexpressing cell lines seeded on vitronectin for 30 min before fixation. Cells were stained with a monoclonal anti-kindlin antibody. (D, E) FA analysis of n > 1,000 kindlin-positive FAs per sample. FAs were analysed for GFP-paxillin intensity (D) and FA area (E). Violin plot in (E) show the Kernel probability density distribution. Densities are plotted symmetrically to the left and right of the box plots. Inserted boxplots show mean values with 95% confidence intervals. Statistical significance was calculated using one-way ANOVA followed by Bonferroni multiple comparison test. Significance levels compared to paxillin wt are indicated (ns: not significant; *** p ≤ 0.001; ** p ≤ 0.01; * p ≤ 0.05). Boxplots in (D) show mean and error bars represent 5 and 95 percentiles. Significance was calculated using one-way ANOVA, followed by Bonferroni multiple comparison test (*** p < 0.001, ns = not significant). (F) NIH Flp-In integrin β3 KO and the indicated ITGB3 wt, ITGB3 Δ8aa, or ITGB3 Δ3aa reexpressing cell lines were serum starved and seeded onto fibronectin-coated (5 μg/ml) glass slides for 30 min and cell area was measured. Shown are mean values and 95% confidence intervals of n = 60 cells per sample from 3 independent experiments. Statistical significance was calculated using one-way ANOVA followed by Bonferroni multiple comparison test (*** p ≤ 0.001; ** p ≤ 0.01). The data underlying panels D–F can be found in S1 Data.

(PDF)

S1 Data All numerical values underlying this study.

(XLSX)

S1 Raw Images Raw images of Figs 1F, 2F, 3E, 4B, 4E, S1B, S3G and S5A.

(PDF)

We gratefully acknowledge initial contributions to peptide and protein preparation and interaction studies by J. Ude, M. Roth, M. Gallandi, and S. Feindler-Boeckh, as well as expert support in mass spectrometry by Dr I. Starke. We thank D. Schlaepfer (UCSD, San Diego, CA) for providing GFP-FAK reexpressing FAK−/− murine fibroblasts and R. Fässler and R. Böttcher (MPI for Biochemistry, Martinsried, Germany) for providing kindlin1/kindlin2-deficient mouse fibroblasts. The authors thank Alexander Bershadsky (Mechanobiology Institute, National University of Singapore, Singapore), Nicole Brimer (University of Virginia, Charlottesville, USA), and Elke Butt (Universitätsklinikum Würzburg, Würzburg, Germany) for providing constructs. We would also like to thank the Core Facilities of the University of Konstanz for excellent help and support with cell sorting (A. Sommershof, FlowKon) and microscopy (M. Stöckl, Bioimaging Center).

Abbreviations

CEACAM Carcinoembryonic antigen-related cell adhesion molecule

CSP chememical shift perturbation

CT carboxy-terminal

FA focal adhesion

FAK focal adhesion kinase

FCS fetal calf serum

GFP green fluorescent protein

HRP horseradish peroxidase

IPTG isopropyl β-Dthiogalactoside

ITGB integrin beta

KO knockout

LIC ligation independent cloning

LIM Lin-11, Isl1, MEC-3

MEF mouse embryonic fibroblast

NMR nuclear magnetic resonance

NOE nucelar Overhauser effect

OPTIC Opa protein triggered integrin clustering

PCR polymerase chain reaction

PXN paxillin

RFP red fluorescent protein

SUMO small ubiquitin-like modifier

WCL whole cell lysate

wt wild type

10.1371/journal.pbio.3002757.r001
Decision Letter 0
Hodge Richard Senior Editor
© 2024 Richard Hodge
2024
Richard Hodge
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
11 Sep 2023

Dear Dr Hauck,

Thank you for submitting your manuscript entitled "The solution structure of the paxillin LIM3 domain reveals a flexible loop mediating direct binding to integrin β3" for consideration as a Research Article by PLOS Biology.

Your manuscript has now been evaluated by the PLOS Biology editorial staff as well as by an academic editor with relevant expertise and I am writing to let you know that we would like to send your submission out for external peer review. However, we would like to consider the manuscript as a Short Report. Thus, please select that type of article from the dropdown menu when you submit the metadata (see below).

Before we can send your manuscript to reviewers, we need you to complete your submission by providing the metadata that is required for full assessment. To this end, please login to Editorial Manager where you will find the paper in the 'Submissions Needing Revisions' folder on your homepage. Please click 'Revise Submission' from the Action Links and complete all additional questions in the submission questionnaire.

Once your full submission is complete, your paper will undergo a series of checks in preparation for peer review. After your manuscript has passed the checks it will be sent out for review. To provide the metadata for your submission, please Login to Editorial Manager (https://www.editorialmanager.com/pbiology) within two working days, i.e. by Sep 13 2023 11:59PM.

If your manuscript has been previously peer-reviewed at another journal, PLOS Biology is willing to work with those reviews in order to avoid re-starting the process. Submission of the previous reviews is entirely optional and our ability to use them effectively will depend on the willingness of the previous journal to confirm the content of the reports and share the reviewer identities. Please note that we reserve the right to invite additional reviewers if we consider that additional/independent reviewers are needed, although we aim to avoid this as far as possible. In our experience, working with previous reviews does save time.

If you would like us to consider previous reviewer reports, please edit your cover letter to let us know and include the name of the journal where the work was previously considered and the manuscript ID it was given. In addition, please upload a response to the reviews as a 'Prior Peer Review' file type, which should include the reports in full and a point-by-point reply detailing how you have or plan to address the reviewers' concerns.

During the process of completing your manuscript submission, you will be invited to opt-in to posting your pre-review manuscript as a bioRxiv preprint. Visit http://journals.plos.org/plosbiology/s/preprints for full details. If you consent to posting your current manuscript as a preprint, please upload a single Preprint PDF.

Feel free to email us at plosbiology@plos.org if you have any queries relating to your submission.

Kind regards,

Richard

Richard Hodge, PhD

Senior Editor

PLOS Biology

rhodge@plos.org

10.1371/journal.pbio.3002757.r002
Decision Letter 1
Hodge Richard Senior Editor
© 2024 Richard Hodge
2024
Richard Hodge
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
22 Nov 2023

Dear Dr Hauck,

Thank you for your continued patience while your manuscript "The solution structure of the paxillin LIM3 domain reveals a flexible loop mediating direct binding to integrin β3" was peer-reviewed at PLOS Biology. Please accept my sincere apologies for the long delays that you have experienced during the peer review process. Your manuscript has now been evaluated by the PLOS Biology editors, an Academic Editor with relevant expertise, and by three independent reviewers.

In light of the reviews, which you will find at the end of this email, we would like to invite you to revise the work to thoroughly address the reviewers' reports.

As you can see, the reviewers generally think the findings are interesting for the field and note that the NMR analyses are well done. However, Reviewer #1 raises concerns the overall physiological relevance of the interaction and the proposed mechanistic model given the overlapping binding site of paxillin on integrin with kindlin. In the revised manuscript, we ask that you please discuss the problems and complexities in studying the repetitive LIM domains and the paxillin/kindlin vs paxillin/integrin interactions, as well as providing a more balanced and nuanced introduction along the lines proposed by Reviewer #3. After discussions with Academic Editor, we strongly encourage you to address the concerns of Reviewer #1 with additional experiments to enhance the physiological relevance of the study, but we will not make this essential to consider the revised version given the Short Report format.

Given the extent of revision needed, we cannot make a decision about publication until we have seen the revised manuscript and your response to the reviewers' comments. Your revised manuscript is likely to be sent for further evaluation by all or a subset of the reviewers.

We expect to receive your revised manuscript within 3 months. Please email us (plosbiology@plos.org) if you have any questions or concerns, or would like to request an extension.

At this stage, your manuscript remains formally under active consideration at our journal; please notify us by email if you do not intend to submit a revision so that we may withdraw it.

**IMPORTANT - SUBMITTING YOUR REVISION**

Your revisions should address the specific points made by each reviewer. Please submit the following files along with your revised manuscript:

1. A 'Response to Reviewers' file - this should detail your responses to the editorial requests, present a point-by-point response to all of the reviewers' comments, and indicate the changes made to the manuscript.

*NOTE: In your point-by-point response to the reviewers, please provide the full context of each review. Do not selectively quote paragraphs or sentences to reply to. The entire set of reviewer comments should be present in full and each specific point should be responded to individually, point by point.

You should also cite any additional relevant literature that has been published since the original submission and mention any additional citations in your response.

2. In addition to a clean copy of the manuscript, please also upload a 'track-changes' version of your manuscript that specifies the edits made. This should be uploaded as a "Revised Article with Changes Highlighted" file type.

*Re-submission Checklist*

When you are ready to resubmit your revised manuscript, please refer to this re-submission checklist: https://plos.io/Biology_Checklist

To submit a revised version of your manuscript, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' where you will find your submission record.

Please make sure to read the following important policies and guidelines while preparing your revision:

*Published Peer Review*

Please note while forming your response, if your article is accepted, you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*PLOS Data Policy*

Please note that as a condition of publication PLOS' data policy (http://journals.plos.org/plosbiology/s/data-availability) requires that you make available all data used to draw the conclusions arrived at in your manuscript. If you have not already done so, you must include any data used in your manuscript either in appropriate repositories, within the body of the manuscript, or as supporting information (N.B. this includes any numerical values that were used to generate graphs, histograms etc.). For an example see here: http://www.plosbiology.org/article/info%3Adoi%2F10.1371%2Fjournal.pbio.1001908#s5

*Blot and Gel Data Policy*

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare them now, if you have not already uploaded them. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Thank you again for your submission to our journal. We hope that our editorial process has been constructive thus far, and we welcome your feedback at any time. Please don't hesitate to contact us if you have any questions or comments.

Sincerely,

Richard

Richard Hodge, PhD

Senior Editor, PLOS Biology

rhodge@plos.org

------------------------------------

REVIEWS:

Reviewer #1: This manuscript reports the NMR-based structural and functional studies of paxillin LIM2-3 domain and its interaction with integrin beta cytoplasmic tails. The major conclusion is that such interaction is crucial for recruiting paxillin to the integrin adhesion site independent of kindlin. While the interaction appears to be novel, the physiological relevance of this interaction and the authors' major conclusion are not supported by the data. It has been well established that talin and kindlin, both of which bind to paxillin as the authors indicated, directly bind to integrin and trigger focal adhesion assembly. In fact, it was shown clearly that kindlin, which binds paxillin at nM affinity (Böttcher RT et al., J Cell Biol, 2017) and recruits paxillin to focal adhesion (Theodosiou et al., eLife, 2016). Of course, talin-paxillin interaction also promotes paxillin recruitment to integrin site. These earlier data show clearly that paxillin coordinates with kindlin and talin to be recruited to the integrin site not independently contrasting to what the authors proposed here. The technical flaws I saw in the authors' experiment are:

1. The paxillin LIM3 binding site on integrin tail overlaps with that of kindlin and probably part of talin too (Fig 2D) based on the talin-integrin and kindlin-integrin complex structures. Thus, the 3aa and 8aa deletion in integrin tail would clearly affect kindlin and likely talin too. These deletion data cannot support the paxillin recruitment to integrin site independent of kindlin and likely talin.

2. The mutations on LIM3 loop caused some cellular defects. However, given that LIM3 may also partially bind to other proteins such as Kindlin (Böttcher RT et al., J Cell Biol, 2017) and PTP-PEST (Cote et al., J. Biol. Chem, 274:20550-60, 1999), it is unclear if the mutations would also impair the interaction with these proteins, making the analysis ambiguous.

3. Kindlin, talin, and paxillin are all found in nascent focal adhesions. Given the overlapping binding site of paxillin on integrin with kindlin, it is hard to imagine how paxillin would localize to integrin independent of kindlin. The only possibility to me is that paxillin and kindlin bind to different integrins on the cell surface while being localized to integrin site but there is not data in the manuscript to support this possibility.

Overall, while I think the in vitro binding analysis appears to be ok, the physiological relevance and the mechanism of such binding remain confusing.

Reviewer #2: The paper by Baade et al. Report on the study of interactions of the paxillin LlM3 domain with an integrin protein. The paper contains cell-biological and biophysical experiments to probe for the interaction. The paper is well written, interesting to read and the conclusions are backed by data. The necessary controls have been mostly made. I consider this a careful study that should be published, and I have not detected any major issues.

I am not an expert on the cell-biological experiments but rather want to comment on the NMR part. I have a few minor suggestions:

* To better comprehend please color-code the linker in Fig. 2

* More importantly, please show domain borders in the heteronuclear NOE data in Fig S2A. I assume that the linker is around residue 452 (?). However, I noticed 3 more regions of slightly increased flexibility, which is likely due to loops (around residues 392, 418 and 480). Only the latter is discussed in the text.

* Is the flexible loop in the LlM3 domain rigidified upon interaction with the integrin? Any change in the magnitude of the heteronuclear NOE for loop residues?

* How many interdomain contacts are observed as NOEs?

* What is the sequence homology of LlM2 and LlM3? Do they stem from gene duplications?

* Concerning the interaction studies: I realized that CSPs were much larger on the LlM domains than on ITGB3 (compare figures 2C and 3A). Please comment. Or does the interface involve aromatic residues on one side that would result in larger CSPs?

* Sometimes figures are differently in size. Fr example 3B and 3D show the same region on both axis but the figures are differently scaled so that a wrong impression about the relative CSPs is given, please make the plots identical in size.

* I always prefer to have an HSQC spectrum in the main paper because it tells a lot how well-behaved the protein is (fonts seem to be stretched in the horizontal direction in S2C)

* Which residues were used for the superposition for the calc of the bb RMSD in Table 1?

* Did the structure calculation comprise a refinement in explicit water? Which parameter were used as distances for the Zn coordination?

* Line 601: The authors name is "Güntert"

* Please insert a reference for the method to establish the coordination mode of the His residues

* Please add assignment statistics to Table 1 or elsewhere. Were all backbone atoms assigned?

* I am not an expert on this, but to which extent is a interaction of 530 uM biological significant (lines 203/204). Please comment.

* The equation on line 664 has a typo. The "2" after the round brackets under the root is a square, not a factor of 2.

Reviewer #3: Paxillin is one of the most important but also still highly enigmatic proteins, localizing to cell-matrix adhesions (also called focal adhesions), thereby controlling the critical mechanisms of cell spreading. Paxillin is composed to of a highly flexible N-terminal domain exhibiting several small structural-defined helical motifs with characteristic acidic and hydrophobic amino acids (LD-motifs). These LD-motifs can interact with other focal adhesion proteins such as talin, vinculin and focal adhesion kinase. Interestingly, these LD-motif interactions are considered of low-affinity, since the expression of the N-terminal domain alone, is not enabling the efficient recruitment of paxillin to integrin-containing focal adhesions. In addition the N-terminal domain contains a proline stretch forming a binding site for the src SH3 domain, potentially relevant for regulation of paxillin recruitment to focal adhesions by tyr-phosphorylation. In contrast to the highly flexible N-terminal domain, the focal adhesion-targeting domain of paxillin is localized in the c-terminal domain of paxillin, which is composed of 4 tightly spaced LIM-domains. Initial LIM-domain deletion studies by Brown and Turner (1996) have shown that deletions of LIM3 and to a minor level LIM2, cause a strong reduction in focal adhesion localization when transfected in fibroblasts. However, more recently, quantitative approaches to measure the individual contribution of the LIM-domains to beta3-integrin-containing focal adhesions, revealed a surprisingly non-sequence specific role of LIM3 in the paxillin recruitment mechanisms. The exchange of LIM3 with either LIM1 or LIM2, barely modified paxillin affinity to focal adhesions, while its deletion strongly affected it (Ripamonti et al., 2021). Instead of an adhesion targeting role in LIM3, a lipid-binding motif was detected in LIM4 and the strongest interference with focal adhesion recruitment was observed by exchanging the LIM2 and LIM1, with LIM3 domains.

This very old and the more recent studies set the stage for the current manuscript, but highlights also potential problems in the interpretation of the biological results, when focusing exclusively on the role of the LIM3 domain for paxillin recruitment to focal adhesions. Due to the central position of the LIM3-domain in the 4 LIM-domain array, slight perturbation of the LIM3 domain will cause paxillin recruitment defect that cannot be easily distinguished from a perturbation with a flexible integrin peptide. While direct integrin/paxillin LIM-domain interactions were never shown before, the interactions of NPXY-motif containing peptides with the LIM-domains from Enigma, and from 4-1/2LIM-domain proteins were reported. Based on these previous observations, we would expect the NPXY-motifs of integrins to bind to paxillin LIM domains, potentially binding to hydrophobic pockets present on the LIM-domains.

Here in this manuscript the authors use NMR to probe the interaction of a purified LIM2/LIM3 tandem construct with either the beta1 and beta3 integrin tails. As expected the interactions are of low affinity, but sufficiently robust to evaluate the direct interaction of integrins with the LIM-domain of paxillin (surprisingly beta1 binds 10x better than beta3). By mutagenesis the authors identify a conserved and slightly flexible loop in LIM3 that is apparently relevant for binding to the very c-terminal end of the integrin b3-tail. They tested c-terminal deletions of 3 and 8 residues, in pull-down and cell-based assays with kindlin-deficient cells, as well as Ala-mutation of the loop residues in LIM3. When probing with N15-labeled integrin tails, perturbations by the Paxilin LIM2/LIM3 construct were found in the first and second NPXY-motif and at conserved inter-NPXY-residues for the beta3-tail, while for beta1 integrin tail, perturbations were identified only in the first NPXY-motif and inter-NPXY-residues, but not in the second NPXY-motif. Further c-terminal deletion of three residues in beta3, reduced paxillin pull-down, and completely blocked it when the 8 c-terminal residues were removed. Similarly paxillin 4A-substitution in the LIM3-loop only partially reduced beta3 binding, showing an alternative beta3 binding site in LIM2. Expression of beta3 integrins in kindlin ko cells partially rescued cell spreading, by developing small and instable cell projections. These projections were lost when the 3 and 8 c-terminal residues were removed, showing a more severe cellular phenotype compared to the pull-down and NMR-perturbation experiment, showing partial interactions with the del3-construct. Beta3 integrin-deletion studies indicated a signaling function for the last three amino acids in beta-3 integrins, which is consistent with the previously identified c-src binding site (however not mentioned in the manuscript).

Based on these data the authors propose a conserved binding site for beta3-integrins in the LIM3 domain of paxillin, recognizing the C-terminal end of the integrin peptide. However, the direct link between paxillin and beta3 integrin binding at LIM3 is not that evident and the effect of c-terminal integrin deletions are not consistent with the effects of the pull-down assays. Instead, the data supports a critical signaling function of the c-terminal RGT sequence in beta-3, while showing only minor perturbation of paxillin pull-down. Similarly mutation of LIM3 leads to NMR perturbation in LIM2, while maintaining the integrin pull-down. Therefore the presented data are consistent with deletion of the src binding site in the c-terminal integrin tail, and a redundant or multiple LIM-domain spanning binding sites for integrin tails. In summary, the quality of presented data is very good, but in multiple positions, the drawn conclusions are not supported by the data. This requires a considerable rephrasing of the text, a better and more balanced introduction to the field and a more careful interpretation of the data.

Major points:

Introduction:

While the general introduction into focal adhesions and the critical role of talin and kindlin is well done, it is important to mention that information gathered from studies in talin or kindlin-ko-cells are limited by their non-physiological context. Especially when Mn-dependent cell-matrix adhesions are introduced, the readers should be aware of the experimental nature of these adhesions, failing to represent the regulatory complexity of focal adhesions. For example, when citing Atherton et al., 2020, where the known link between the paxillin N-terminus and vinculin tail, or talin-rod domains has been experimentally confirmed, the readers should be made aware that in talin ko cells, paxillin and vinculin recruitment to Mn-activated integrins was independent from each other, which is different from what is stated in the text (line 119). In lines 123 -125, the idea that kindlin directs paxillin to focal adhesion is well introduced, but the alternative vision that the proximal NPXY-motif in integrins is critical for paxillin recruitment and induction of cell spreading is not introduced (Pinon et al., cited in the discussion). In addition, the recent literature analyzing the differential roles for LIM2 and LIM3 for recruitment of paxillin to focal adhesions should also be introduce (Ripamonti et al 2021; cited in the discussion). In this work, a critical and sequence specific role for LIM2, but not for LIM3 has been demonstrated. This information is particularly relevant, as the authors show partial reductions in integrin pull-downs with the 4A-mutant of the LIM2/LIM3 tandem construct, which proposes additional LIM-domain-dependent interactions outside of the LIM3 domain (e.g. Fig 3C-E).

Results:

Fig1. This new bacteria-based integrin clustering experiments nicely shows the integrin specificity of the paxillin family of LIM-domain containing proteins. This is an important experiment for the community as integrin-dependent (this report) versus tension-dependent (Schiller et al) LIM-domain recruitment mechanisms can be distinguished.

Fig2. NMR-based titration experiments are a very powerful technique to analyze low-affinity interactions between peptides and rigid protein domains. A general problem with low-affinity interactions is however the very high concentration of protein required for the measurement. High protein concentrations can reveal non-physiological effects within the protein solution. I found it surprising that the NMR-perturbation signal in the different titration curves for beta-3 integrin tail in Fig2C (inserts), is not saturating. This is different for the analysis with the beta1-integrin tail, potentially reflected by the 10 fold different affinity constant. The addition of a sentence mentioning this non-saturating behavior would be important, as it points to multiple less-definable interaction sites.

Fig2. The readers should be made aware of the discrepancy of the data shown in figure 2. While the NMR-perturbation experiments show a complete loss of interaction in the absence of the RGT-sequence in the beta3-integrin, there is still a considerable amount of LIM2/LIM3 pulled-down with the RGT-deleted integrin beta-3 peptide. Apparently, beta-3 integrin-peptide interactions at the first and second NPXY, as well as inter-NPXY-region are critically dependent on the RGT-peptide. Since Arg-residues are often involved in protein-protein or protein-peptide interactions, the specific mutation of the Arg-residue would have been a logic addition, especially since in beta1, a Glu-residue is following the second NPXY-motif, without inducing a relevant integrin/paxillin interaction.

Fig.3. The NMR perturbation experiments with the N15-labeled LIM2/LIM3 tandem domain are very instructive. However, there is a circular argument hidden in the analysis, that should be better explained to the reader. While showing that point mutations in critical Phe-residues lead to entire LIM3-domain perturbation (see figure S4A and S4B; for F475A and F480A-mutant), the same F480-residue is flexible and its side chain can be found unusually solvent exposed when interacting with the integrin beta-3 peptide (Fig. 3B). Could this actually mean that the beta-3 peptide is denaturing the LIM3 domain in this loop, leading to extensive remodeling of the LIM3 domain structure. Unfortunately, the subsequently used 4A-mutation, is also affecting the NMR-signal of neighboring LIM3-residues quite broadly, very similar to the F480A mutation (Fig. S4F). Therefore, I am particularly concerned with the mutation of the Gly-residues in the 4A-mutant. Since folding of LIM-domains does not only require hydrophobic residues, but also requires tight turns formed by critically positioned gly-residues, it is well possible that the 4A-mutation is locally perturbing the folding of the LIM3 domain. Blocking the gly-residue with the 4A-mutation could have strong negative effects on the folding of the neighboring residues and affect the entre LIM3 structure in complicated ways.

Moreover, figures 3C,D show that in the presence of the 4A-mutation in LIM3, there are new LIM2/beta3 interactions appearing, suggesting that the specificity of the detected beta3 interaction with LIM3 are rather low. This should be clearly stated in the manuscript, to avoid confusion and misinterpretation by the readers.

The considerable LIM2 involvement in beta3-binding is also shown in Fig. 3E, where the pull down with the 4A-mutant shows still important interactions not consistent with a unique critical role of LIM3.

Fig. 4. Two different knockouts strategies are used in this figure to show the importance of the integrin c-terminal domain and that of kindlin, known to bind to this domain. Unfortunately, this figure is disconnected from the rest of the paper and an obvious link to the previously analyzed paxillin/integrin interaction cannot be drawn. Deletion of the RGT-sequence in beta3-integrin reduces spreading, while completely blocking it in the 8 aa-deletion. Although not specifically analyzed, the deletion of RGT, may affect kindlin-recruitment, and kindlin-mediated cell spreading. Therefore causing a spreading defect because of reduced kindlin-binding rather than paxillin recruitment. This dependence on kindlin for cell spreading is confirmed by the removal of kindlin, blocking spreading of both the RGT- and 8aa- integrin deletion constructs. Thus kindlin is more relevant than a potential paxillin binding at the c-terminal integrin sequence.

Previous work by Theodosiou et al., 2016, has shown that in the absence of kindlin2, paxillin is no longer recruited to Mn-induced talin-containing adhesions (please also correct the section in the introduction, where it is incorrectly stated that paxillin is recruited to talin, in kindlin-ko cells, the reverse has been observed by Theodosiou). According to the pull-down in the previous figures, paxillin should still be recruited to kindlin-deficient beta-3 wt or delta-RGT-integrin expressing cells, which is not the case from the images shown in Fig. 4F (while talin accumulation can be seen in the projections in figure 4F (right panel). Thus the biochemical data is not directly translatable to the observations made in kindlin-ko cells, and this should be clearly said in the manuscript, in order to avoid overinterpretation of the data.

Minor points

In line 219, the beta3-S778A mutation is mentioned, without citing or showing the data that this mutation would induce a kindlin-binding defect. Likewise, potential kindlin-binding defects to the del RGT-sequence are not shown, but are key for understanding the experiments in figure 4.

In line 244, the use of the paxillin delta-LIM4 construct is mentioned as control for a perturbed LIM4/kindlin interaction. Considering that the LIM4 deletion is mainly affecting membrane-interaction and has only modest effects on the recruitment of paxillin to focal adhesions, this control is not able to distinguish between a kindlin, or integrin-dependent paxillin recruitment mechanisms.

When analyzing the flexibility of the LIM2/LIM3 construct by NMR, there is a similar flexible loop observable in LIM2 (Fig. S2). The authors should comment on this similarity, and discuss how solvent exposure of the flanking Phe-side chains as seen in the NMR structure, could perturb the overall folding of the LIM domains.

In summary, the manuscript shows a series of very interesting observations that are helpful for analyzing the mechanisms of LIM-domain-dependent recruitment of paxillin to integrin-cytoplasmic tails. Unfortunately, this reviewer is under the impression that the fixation on the likely overstated role of LIM3 for paxillin recruitment has prevented the authors from reporting potentially relevant interactions with the LIM2-domain of paxillin. In addition to the kindlin-mediated recruitment of paxillin, the direct interaction with integrin peptides is still quite obscure (see also Pinon et al., 2014) and the specificity and role of a direct integrin interaction with paxillin needs to be analyzed together with a proper discussion of the literature analyzing integrin/paxillin dependent cell spreading. In this context, the observed differences between beta1 and beta3 integrins are very interesting and need to be further discussed, and linked to the reported association of src with the c-terminal beta3-integrin tail.

10.1371/journal.pbio.3002757.r003
Author response to Decision Letter 1
Submission Version2
16 Apr 2024

Attachment Submitted filename: Baade_et_al-Response_to_Reviewers.pdf

10.1371/journal.pbio.3002757.r004
Decision Letter 2
De Bruijn, PhD Suzanne Senior Editor
© 2024 Suzanne De Bruijn, PhD
2024
Suzanne De Bruijn, PhD
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version2
20 Jun 2024

Dear Dr Hauck,

Thank you for your patience while we considered your revised manuscript "The solution structure of the paxillin LIM3 domain reveals a flexible loop mediating direct binding to integrin β3" for publication as a Short Reports at PLOS Biology. This revised version of your manuscript has been evaluated by the PLOS Biology editors, the Academic Editor and the original reviewers. Please accept my apologies for the unusual delay incurred in assessing your revision.

Based on the reviews, we are likely to accept this manuscript for publication, provided you satisfactorily address the remaining points raised by the reviewers. Please also make sure to address the following data and other policy-related requests.

IMPORTANT - please attend to the following:

*We would like to suggest a different title to improve accessibility. Please change your title to: "A flexible loop in the paxillin LIM3 domain mediates its direct binding to integrin β3"

* Please note that per journal policy, the model system/species studied should be clearly stated in the abstract of your manuscript. Therefore, please mention the cell lines that you used in the abstract.

* Please take the funding disclosure out of the acknowledgments. These will be included in the paper based on your entry in Editorial Manager.

* DATA POLICY:

You may be aware of the PLOS Data Policy, which requires that all data be made available without restriction: http://journals.plos.org/plosbiology/s/data-availability. For more information, please also see this editorial: http://dx.doi.org/10.1371/journal.pbio.1001797

Note that we do not require all raw data. Rather, we ask that all individual quantitative observations that underlie the data summarized in the figures and results of your paper be made available in one of the following forms:

1) Supplementary files (e.g., excel). Please ensure that all data files are uploaded as 'Supporting Information' and are invariably referred to (in the manuscript, figure legends, and the Description field when uploading your files) using the following format verbatim: S1 Data, S2 Data, etc. Multiple panels of a single or even several figures can be included as multiple sheets in one excel file that is saved using exactly the following convention: S1_Data.xlsx (using an underscore).

2) Deposition in a publicly available repository. Please also provide the accession code or a reviewer link so that we may view your data before publication.

Regardless of the method selected, please ensure that you provide the individual numerical values that underlie the summary data displayed in the following figure panels as they are essential for readers to assess your analysis and to reproduce it: Figs 1CE, 2F, 3F, 4C, S1DE, S2A, S3F and S5BDEF.

NOTE: the numerical data provided should include all replicates AND the way in which the plotted mean and errors were derived (it should not present only the mean/average values).

Please also ensure that figure legends in your manuscript include information on where the underlying data can be found, and ensure your supplemental data file/s has a legend.

Please ensure that your Data Statement in the submission system accurately describes where your data can be found.

* CODE POLICY

Per journal policy, if you have generated any custom code during the course of this investigation, please make it available without restrictions. Please ensure that the code is sufficiently well documented and reusable, and that your Data Statement in the Editorial Manager submission system accurately describes where your code can be found.

Please note that we cannot accept sole deposition of code in GitHub, as this could be changed after publication. However, you can archive this version of your publicly available GitHub code to Zenodo. Once you do this, it will generate a DOI number, which you will need to provide in the Data Accessibility Statement (you are welcome to also provide the GitHub access information). See the process for doing this here: https://docs.github.com/en/repositories/archiving-a-github-repository/referencing-and-citing-content.

* BLOT AND GEL REPORTING REQUIREMENTS:

We require the original, uncropped and minimally adjusted images supporting all blot and gel results reported in an article's figures or Supporting Information files. We will require these files before a manuscript can be accepted so please prepare and upload them now. Please carefully read our guidelines for how to prepare and upload this data: https://journals.plos.org/plosbiology/s/figures#loc-blot-and-gel-reporting-requirements

Please provide the original gels for: 1F, 2F, 3E, 4BE, S1B, S3G, S5A, S6BE.

As you address these items, please take this last chance to review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the cover letter that accompanies your revised manuscript.

We expect to receive your revised manuscript within two weeks.

To submit your revision, please go to https://www.editorialmanager.com/pbiology/ and log in as an Author. Click the link labelled 'Submissions Needing Revision' to find your submission record. Your revised submission must include the following:

- a cover letter that should detail your responses to any editorial requests, if applicable, and whether changes have been made to the reference list

- a Response to Reviewers file that provides a detailed response to the reviewers' comments (if applicable, if not applicable please do not delete your existing 'Response to Reviewers' file.)

- a track-changes file indicating any changes that you have made to the manuscript.

NOTE: If Supporting Information files are included with your article, note that these are not copyedited and will be published as they are submitted. Please ensure that these files are legible and of high quality (at least 300 dpi) in an easily accessible file format. For this reason, please be aware that any references listed in an SI file will not be indexed. For more information, see our Supporting Information guidelines:

https://journals.plos.org/plosbiology/s/supporting-information

*Published Peer Review History*

Please note that you may have the opportunity to make the peer review history publicly available. The record will include editor decision letters (with reviews) and your responses to reviewer comments. If eligible, we will contact you to opt in or out. Please see here for more details:

https://blogs.plos.org/plos/2019/05/plos-journals-now-open-for-published-peer-review/

*Press*

Should you, your institution's press office or the journal office choose to press release your paper, please ensure you have opted out of Early Article Posting on the submission form. We ask that you notify us as soon as possible if you or your institution is planning to press release the article.

*Protocols deposition*

To enhance the reproducibility of your results, we recommend that if applicable you deposit your laboratory protocols in protocols.io, where a protocol can be assigned its own identifier (DOI) such that it can be cited independently in the future. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols

Please do not hesitate to contact me should you have any questions.

Sincerely,

Suzanne

Suzanne De Bruijn, PhD,

Associate Editor

sbruijn@plos.org

PLOS Biology

------------------------------------------------------------------------

Reviewer remarks:

Reviewer #2: all points I have raised in the previous review have been sufficiently been dealt with (in fact, they were answered very thoroughly)

Reviewer #3: Suggested corrections to revision by Baade:

The revised version of the manuscript has clearly improved, as the introduction is more balanced and many of the experimental results better explained, or at least interpreted so that it fits the model of the authors.

However there is still a conceptual issue that is not completely resolved. Considering the fundamental nature of the paxillin family adapters and the strong sequence conservation in the LIM domains, it is surprising to note that the very similar cytoplasmic tails of beta1 and beta3 integrins show differences in the mode of paxillin recruitment. Since the identified RGT sequence in the beta3 is not conserved in beta1 integrins, it needs to be stated that the paxillin binding site found in this manuscript, may not reflect a typical paxillin recruitment mechanisms, but rather a specific feature of beta3 integrin.

Previously a beta3 integrin specific recruitment of the src kinase has been identified by Shattil and coworkers, involving the exact same RGT-motif in beta3 integrin. As this RGT-motif is critical for beta3-mediated recruitment of src for potentially inducing cell adhesion and spreading, it is possible that some of the observed cell spreading defects observed by the authors are due to a failure of beta3 to recruit src and not paxillin.

When analyzing the beta3-del3 mutation, the reduction in paxillin binding is partial, as is the recruitment of the paxillin LIM3-4A mutation. This translates into partial defects in spreading in beta3 and paxillin ko backgrounds. A more severe phenotype is observed upon deletion of the last 8 amino acids, which fits with the binding site of the kindlin adapter in the beta3 integrin, as well as the more extensive integrin beta3 binding site for paxillin.

In the absence of kindlin, the 3-amino acid deletion in beta3 is sufficient to completely perturb the beta3 induced cell adhesion and spreading. The enhanced severity of the phenotype in kindlin-ko cells shows the critical role of kindlin in the spreading process.

As the src binding site is much more confined to the RGT-sequence and not spanning 8-10 amino acids of the c-terminal end of the beta3 integrin, it is well possible that the failure of src binding to the deleted RGT sequence contributes to the strong spreading phenotype in the beta3 deletion mutants in the kindlin ko-background.

Currently information on the src-binding to the RGT-sequence are missing from the manuscript. As the below mentioned reports propose an alternative, paxillin independent explanation for the phenotypes of the beta3-deletion mutants they should be discussed. I would propose that the authors add a short paragraph (for example at line 425 in the discussion), and to mention that the last three amino acids specific to beta3 integrins "RGTcooh" have been shown to bind to the SH3 domain of Src, providing a possible mechanism to provide an integrin beta3-specific ability to induce spreading in the absence of kindlin. (Xiao et al. Blood, 2013, 121, 700-706; Katyal et al. Protein Science, 2013, 22, 1358-1365).

Minor issues :

Line 126: should read Ripamonti et al., 2021

Line 271: The authors should indicate what changes in the buffer modified these residual peaks in the 4A-mutant (salt, and or pH?).

Line 277: Please introduce the citation

Attachment Submitted filename: Revision-1-review.docx

10.1371/journal.pbio.3002757.r005
Author response to Decision Letter 2
Submission Version3
4 Jul 2024

Attachment Submitted filename: Response_to_reviewer_comments-7-2024.pdf

10.1371/journal.pbio.3002757.r006
Decision Letter 3
Hodge Richard Senior Editor
© 2024 Richard Hodge
2024
Richard Hodge
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version3
17 Jul 2024

Dear Dr Hauck,

On behalf of my colleagues and the Academic Editor, Carole Parent, I am pleased to say that we can accept your manuscript for publication, provided you address any remaining formatting and reporting issues. These will be detailed in an email you should receive within 2-3 business days from our colleagues in the journal operations team; no action is required from you until then. Please note that we will not be able to formally accept your manuscript and schedule it for publication until you have completed any requested changes.

Please note that I have taken the liberty of adding the information about the Zenodo deposition in the Data Availability Statement in the online submission form. During the production process, please feel free to take a look at the included sentence to make sure you are happy with it before publication.

Please take a minute to log into Editorial Manager at http://www.editorialmanager.com/pbiology/, click the "Update My Information" link at the top of the page, and update your user information to ensure an efficient production process.

PRESS

We frequently collaborate with press offices. If your institution or institutions have a press office, please notify them about your upcoming paper at this point, to enable them to help maximise its impact. If the press office is planning to promote your findings, we would be grateful if they could coordinate with biologypress@plos.org. If you have previously opted in to the early version process, we ask that you notify us immediately of any press plans so that we may opt out on your behalf.

We also ask that you take this opportunity to read our Embargo Policy regarding the discussion, promotion and media coverage of work that is yet to be published by PLOS. As your manuscript is not yet published, it is bound by the conditions of our Embargo Policy. Please be aware that this policy is in place both to ensure that any press coverage of your article is fully substantiated and to provide a direct link between such coverage and the published work. For full details of our Embargo Policy, please visit http://www.plos.org/about/media-inquiries/embargo-policy/.

Thank you again for choosing PLOS Biology for publication and supporting Open Access publishing. We look forward to publishing your study. 

Best wishes, 

Richard

Richard Hodge, PhD

Senior Editor, PLOS Biology

rhodge@plos.org

PLOS

Empowering researchers to transform science

Carlyle House, Carlyle Road, Cambridge, CB4 3DN, United Kingdom

ORCiD I plosbio.org I @PLOSBiology I Blog

California (U.S.) corporation #C2354500, based in San Francisco
==== Refs
References

1 Sun Z , Guo SS , Fassler R . Integrin-mediated mechanotransduction. J Cell Biol. 2016;215 (4 ):445–456. doi: 10.1083/jcb.201609037 27872252
2 Hynes RO . Integrins: bidirectional, allosteric signaling machines. Cell. 2002;110 (6 ):673–687. doi: 10.1016/s0092-8674(02)00971-6 12297042
3 Sun Z , Costell M , Fassler R . Integrin activation by talin, kindlin and mechanical forces. Nat Cell Biol. 2019;21 (1 ):25–31. doi: 10.1038/s41556-018-0234-9 30602766
4 Moser M , Legate KR , Zent R , Fassler R . The tail of integrins, talin, and kindlins. Science. 2009;324 (5929 ):895–899. doi: 10.1126/science.1163865 19443776
5 Geiger B , Yamada KM . Molecular architecture and function of matrix adhesions. Cold Spring Harb Perspect Biol. 2011;3 (5 ). cshperspect.a005033 [pii] doi: 10.1101/cshperspect.a005033 21441590
6 Zaidel-Bar R , Itzkovitz S , Ma’ayan A , Iyengar R , Geiger B . Functional atlas of the integrin adhesome. Nat Cell Biol. 2007;9 (8 ):858–867. ncb0807-858 [pii] doi: 10.1038/ncb0807-858 17671451
7 Horton ER , Byron A , Askari JA , Ng DH , Millon-Fremillon A , Robertson J , et al . Definition of a consensus integrin adhesome and its dynamics during adhesion complex assembly and disassembly. Nat Cell Biol. 2015. doi: 10.1038/ncb3257 26479319
8 Chastney MR , Lawless C , Humphries JD , Warwood S , Jones MC , Knight D , et al . Topological features of integrin adhesion complexes revealed by multiplexed proximity biotinylation. J Cell Biol. 2020;219 (8 ). doi: 10.1083/jcb.202003038 32585685
9 Kanchanawong P , Shtengel G , Pasapera AM , Ramko EB , Davidson MW , Hess HF , et al . Nanoscale architecture of integrin-based cell adhesions. Nature. 2010;468 (7323 ):580–584. nature09621 [pii] doi: 10.1038/nature09621 21107430
10 Bachmann M , Kukkurainen S , Hytonen VP , Wehrle-Haller B . Cell Adhesion by Integrins. Physiol Rev. 2019;99 (4 ):1655–1699. doi: 10.1152/physrev.00036.2018 31313981
11 Schiller HB , Friedel CC , Boulegue C , Fassler R . Quantitative proteomics of the integrin adhesome show a myosin II-dependent recruitment of LIM domain proteins. EMBO Rep. 2011;12 :259–266. embor20115 [pii] doi: 10.1038/embor.2011.5 21311561
12 Anderson CA , Kovar DR , Gardel ML , Winkelman JD . LIM domain proteins in cell mechanobiology. Cytoskeleton (Hoboken). 2021. doi: 10.1002/cm.21677 34028199
13 Kadrmas JL , Beckerle MC . The LIM domain: from the cytoskeleton to the nucleus. Nat Rev Mol Cell Biol. 2004;5 (11 ):920–931. doi: 10.1038/nrm1499 15520811
14 Matthews JM , Bhati M , Lehtomaki E , Mansfield RE , Cubeddu L , Mackay JP . It takes two to tango: the structure and function of LIM, RING, PHD and MYND domains. Curr Pharm Des. 2009;15 (31 ):3681–3696. doi: 10.2174/138161209789271861 19925420
15 Deakin NO , Pignatelli J , Turner CE . Diverse roles for the paxillin family of proteins in cancer. Genes Cancer. 2012;3 (5–6 ):362–370. doi: 10.1177/1947601912458582 23226574
16 Deakin NO , Turner CE . Paxillin comes of age. J Cell Sci. 2008;121 (Pt 15 ):2435–2444. 121/15/2435 [pii] doi: 10.1242/jcs.018044 18650496
17 Digman MA , Brown CM , Horwitz AR , Mantulin WW , Gratton E . Paxillin dynamics measured during adhesion assembly and disassembly by correlation spectroscopy. Biophys J. 2008;94 (7 ):2819–2831. S0006-3495(08)70533-2 [pii] doi: 10.1529/biophysj.107.104984 17993500
18 Pasapera AM , Schneider IC , Rericha E , Schlaepfer DD , Waterman CM . Myosin II activity regulates vinculin recruitment to focal adhesions through FAK-mediated paxillin phosphorylation. J Cell Biol. 2010;188 (6 ):877–890. jcb.200906012 [pii] doi: 10.1083/jcb.200906012 20308429
19 Zhu L , Liu H , Lu F , Yang J , Byzova TV , Qin J . Structural Basis of Paxillin Recruitment by Kindlin-2 in Regulating Cell Adhesion. Structure. 2019;27 (11 ):1686–97 e5. doi: 10.1016/j.str.2019.09.006 31590942
20 Bottcher RT , Veelders M , Rombaut P , Faix J , Theodosiou M , Stradal TE , et al . Kindlin-2 recruits paxillin and Arp2/3 to promote membrane protrusions during initial cell spreading. J Cell Biol. 2017;216 (11 ):3785–3798. doi: 10.1083/jcb.201701176 28912124
21 Gao J , Huang M , Lai J , Mao K , Sun P , Cao Z , et al . Kindlin supports platelet integrin alphaIIbbeta3 activation by interacting with paxillin. J Cell Sci. 2017;130 (21 ):3764–3775. doi: 10.1242/jcs.205641 28954813
22 Ripamonti M , Liaudet N , Azizi L , Bouvard D , Hytonen VP , Wehrle-Haller B . Structural and functional analysis of LIM domain-dependent recruitment of paxillin to alphavbeta3 integrin-positive focal adhesions. Commun Biol. 2021;4 (1 ):380. doi: 10.1038/s42003-021-01886-9 33782527
23 Brown MC , Perrotta JA , Turner CE . Identification of LIM3 as the principal determinant of paxillin focal adhesion localization and characterization of a novel motif on paxillin directing vinculin and focal adhesion kinase binding. J Cell Biol. 1996;135 (4 ):1109–1123. doi: 10.1083/jcb.135.4.1109 8922390
24 Zacharchenko T , Qian X , Goult BT , Jethwa D , Almeida TB , Ballestrem C , et al . LD Motif Recognition by Talin: Structure of the Talin-DLC1 Complex. Structure. 2016;24 (7 ):1130–1141. doi: 10.1016/j.str.2016.04.016 27265849
25 Atherton P , Lausecker F , Carisey A , Gilmore A , Critchley D , Barsukov I , et al . Relief of talin autoinhibition triggers a force-independent association with vinculin. J Cell Biol. 2020;219 (1 ). doi: 10.1083/jcb.201903134 31816055
26 Theodosiou M , Widmaier M , Bottcher RT , Rognoni E , Veelders M , Bharadwaj M , et al . Kindlin-2 cooperates with talin to activate integrins and induces cell spreading by directly binding paxillin. eLife. 2016:5. doi: 10.7554/eLife.10130 26821125
27 Klapproth S , Bromberger T , Turk C , Kruger M , Moser M . A kindlin-3-leupaxin-paxillin signaling pathway regulates podosome stability. J Cell Biol. 2019;218 (10 ):3436–3454. doi: 10.1083/jcb.201903109 31537712
28 Baade T , Paone C , Baldrich A , Hauck CR . Clustering of integrin β cytoplasmic domains triggers nascent adhesion formation and reveals a protozoan origin of the integrin-talin interaction. Sci Rep. 2019;9 (1 ):5728. doi: 10.1038/s41598-019-42002-6 30952878
29 Sattler M , Schleucher J , Griesinger C . Heteronuclear multidimensional NMR experiments for the structure determination of proteins in solution employing pulsed field gradients. Prog Nucl Mag Res Sp. 1999;34 (2 ):93–158. doi: 10.1016/S0079-6565(98)00025-9
30 Perez-Alvarado GC , Miles C , Michelsen JW , Louis HA , Winge DR , Beckerle MC , et al . Structure of the carboxy-terminal LIM domain from the cysteine rich protein CRP. Nat Struct Biol. 1994;1 (6 ):388–398. doi: 10.1038/nsb0694-388 7664053
31 Kontaxis G , Konrat R , Krautler B , Weiskirchen R , Bister K . Structure and intramodular dynamics of the amino-terminal LIM domain from quail cysteine- and glycine-rich protein CRP2. Biochemistry. 1998;37 (20 ):7127–7134. doi: 10.1021/bi973055v 9585524
32 Ma YQ , Qin J , Wu C , Plow EF . Kindlin-2 (Mig-2): a co-activator of beta3 integrins. J Cell Biol. 2008;181 (3 ):439–446. doi: 10.1083/jcb.200710196 18458155
33 Moser M , Nieswandt B , Ussar S , Pozgajova M , Fassler R . Kindlin-3 is essential for integrin activation and platelet aggregation. Nat Med. 2008;14 (3 ):325–330. doi: 10.1038/nm1722 18278053
34 Winkelman JD , Anderson CA , Suarez C , Kovar DR , Gardel ML . Evolutionarily diverse LIM domain-containing proteins bind stressed actin filaments through a conserved mechanism. Proc Natl Acad Sci U S A. 2020;117 (41 ):25532–25542. doi: 10.1073/pnas.2004656117 32989126
35 Aretz J , Aziz M , Strohmeyer N , Sattler M , Fässler R . Talin and kindlin use integrin tail allostery and direct binding to activate integrins. Nat Struct Mol Biol. 2023;30 (12 ):1913–1924. doi: 10.1038/s41594-023-01139-9 38087085
36 Wang P , Ballestrem C , Streuli CH . The C terminus of talin links integrins to cell cycle progression. J Cell Biol. 2011;195 (3 ):499–513. doi: 10.1083/jcb.201104128 22042621
37 Zhang X , Jiang G , Cai Y , Monkley SJ , Critchley DR , Sheetz MP . Talin depletion reveals independence of initial cell spreading from integrin activation and traction. Nat Cell Biol. 2008;10 (9 ):1062–1068. doi: 10.1038/ncb1765 19160486
38 Lawson C , Lim ST , Uryu S , Chen XL , Calderwood DA , Schlaepfer DD . FAK promotes recruitment of talin to nascent adhesions to control cell motility. J Cell Biol. 2012;196 (2 ):223–232. jcb.201108078 [pii] doi: 10.1083/jcb.201108078 22270917
39 Lawson C , Schlaepfer DD . Integrin adhesions: who’s on first? What’s on second? Connections between FAK and talin. Cell Adhes Migr. 2012;6 (4 ):302–306. doi: 10.4161/cam.20488 22983197
40 Roca-Cusachs P , Gauthier NC , Del Rio A , Sheetz MP . Clustering of alpha(5)beta(1) integrins determines adhesion strength whereas alpha(v)beta(3) and talin enable mechanotransduction. Proc Natl Acad Sci U S A. 2009;106 (38 ):16245–16250. doi: 10.1073/pnas.0902818106 19805288
41 Kong F , Garcia AJ , Mould AP , Humphries MJ , Zhu C . Demonstration of catch bonds between an integrin and its ligand. J Cell Biol. 2009;185 (7 ):1275–1284. doi: 10.1083/jcb.200810002 19564406
42 Schiller HB , Hermann MR , Polleux J , Vignaud T , Zanivan S , Friedel CC , et al . beta1- and alphav-class integrins cooperate to regulate myosin II during rigidity sensing of fibronectin-based microenvironments. Nat Cell Biol. 2013;15 (6 ):625–636. ncb2747 [pii] doi: 10.1038/ncb2747 23708002
43 Bharadwaj M , Strohmeyer N , Colo GP , Helenius J , Beerenwinkel N , Schiller HB , et al . alphaV-class integrins exert dual roles on alpha5beta1 integrins to strengthen adhesion to fibronectin. Nat Commun. 2017;8 :14348. doi: 10.1038/ncomms14348 28128308
44 Missirlis D , Haraszti T , Scheele C , Wiegand T , Diaz C , Neubauer S , et al . Substrate engagement of integrins alpha5beta1 and alphavbeta3 is necessary, but not sufficient, for high directional persistence in migration on fibronectin. Sci Rep. 2016;6 :23258. doi: 10.1038/srep23258 26987342
45 Pinon P , Parssinen J , Vazquez P , Bachmann M , Rahikainen R , Jacquier MC , et al . Talin-bound NPLY motif recruits integrin-signaling adapters to regulate cell spreading and mechanosensing. J Cell Biol. 2014;205 (2 ):265–281. doi: 10.1083/jcb.201308136 24778313
46 Arias-Salgado EG , Lizano S , Sarkar S , Brugge JS , Ginsberg MH , Shattil SJ . Src kinase activation by direct interaction with the integrin beta cytoplasmic domain. Proc Natl Acad Sci U S A. 2003;100 (23 ):13298–13302. doi: 10.1073/pnas.2336149100 14593208
47 Katyal P , Puthenveetil R , Vinogradova O . Structural insights into the recognition of β3 integrin cytoplasmic tail by the SH3 domain of Src kinase. Protein Sci. 2013;22 (10 ):1358–1365. doi: 10.1002/pro.2323 23913837
48 Xiao R , Xi XD , Chen Z , Chen SJ , Meng G . Structural framework of c-Src activation by integrin β3. Blood. 2013;121 (4 ):700–706. doi: 10.1182/blood-2012-07-440644 23169783
49 Schlaepfer DD , Hou S , Lim ST , Tomar A , Yu H , Lim Y , et al . Tumor necrosis factor-alpha stimulates FAK activity required for mitogen-activated kinase-associated interleukin 6 expression. J Biol Chem. 2007;282 (24 ):17450–17459.17438336
50 Grimm TM , Dierdorf NI , Betz K , Paone C , Hauck CR . PPM1F controls integrin activity via a conserved phospho-switch. J Cell Biol. 2020;219 (12 ). doi: 10.1083/jcb.202001057 33119040
51 Agerer F , Lux S , Michel A , Rohde M , Ohlsen K , Hauck CR . Cellular invasion by Staphylococcus aureus reveals a functional link between focal adhesion kinase and cortactin in integrin-mediated internalisation. J Cell Sci. 2005;118 (10 ):2189–2200. doi: 10.1242/jcs.02328 15855238
52 Masse JE , Keller R . AutoLink: automated sequential resonance assignment of biopolymers from NMR data by relative-hypothesis-prioritization-based simulated logic. J Magn Reson. 2005;174 (1 ):133–151. doi: 10.1016/j.jmr.2005.01.017 15809181
53 Herrmann T , Guntert P , Wuthrich K . Protein NMR structure determination with automated NOE-identification in the NOESY spectra using the new software ATNOS. J Biomol NMR. 2002;24 (3 ):171–189. doi: 10.1023/a:1021614115432 12522306
54 Serrano P , Pedrini B , Mohanty B , Geralt M , Herrmann T , Wuthrich K . The J-UNIO protocol for automated protein structure determination by NMR in solution. J Biomol NMR. 2012;53 (4 ):341–354. doi: 10.1007/s10858-012-9645-2 22752932
55 Shen Y , Bax A . Protein backbone and sidechain torsion angles predicted from NMR chemical shifts using artificial neural networks. J Biomol NMR. 2013;56 (3 ):227–241. doi: 10.1007/s10858-013-9741-y 23728592
56 Guntert P. Automated NMR structure calculation with CYANA. Methods Mol Biol. 2004;278 :353–378. doi: 10.1385/1-59259-809-9:353 15318003
57 Alberts IL , Nadassy K , Wodak SJ . Analysis of zinc binding sites in protein crystal structures. Protein Sci. 1998;7 :1700–1716. doi: 10.1002/pro.5560070805 10082367
58 Barraud P , Schubert M , Allain FH . A strong 13C chemical shift signature provides the coordination mode of histidines in zinc-binding proteins. J Biomol NMR. 2012;53 :93–101. doi: 10.1007/s10858-012-9625-6 22528293
59 Anthis NJ , Wegener KL , Ye F , Kim C , Goult BT , Lowe ED , et al . The structure of an integrin/talin complex reveals the basis of inside-out signal transduction. EMBO J. 2009;28 (22 ):3623–3632. doi: 10.1038/emboj.2009.287 19798053
60 Oxley CL , Anthis NJ , Lowe ED , Vakonakis I , Campbell ID , Wegener L . An Integrin Phosphorylation Switch: the effect of {beta}3 integrin tail phosphorylation on DOK1 and talin binding. J Biol Chem 2008;283 (9 ):5420–5426. doi: 10.1074/jbc.M709435200 18156175
61 Ran FA , Hsu PD , Wright J , Agarwala V , Scott DA , Zhang F . Genome engineering using the CRISPR-Cas9 system. Nat Protoc. 2013;8 (11 ):2281–2308. doi: 10.1038/nprot.2013.143 24157548
62 Hsu PD , Scott DA , Weinstein JA , Ran FA , Konermann S , Agarwala V , et al . DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol. 2013;31 (9 ):827–832. nbt.2647 [pii] doi: 10.1038/nbt.2647 23873081
63 Swift S , Lorens J , Achacoso P , Nolan GP . Rapid production of retroviruses for efficient gene delivery to mammalian cells using 293T cell-based systems. Curr Protoc Immunol. 2001;Chapter 10:Unit 10 7C. doi: 10.1002/0471142735.im1017cs31 18432682
