
==== Front
G3 (Bethesda)
Genetics
g3journal
G3: Genes | Genomes | Genetics
2160-1836
Oxford University Press US

38985658
10.1093/g3journal/jkae149
jkae149
Mutant Screen Report
AcademicSubjects/SCI01180
AcademicSubjects/SCI01140
Dominant suppressor genes of p53-induced apoptosis in Drosophila melanogaster
Szlanka Tamás Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Biology Centre, Czech Academy of Sciences, 37005 České Budějovice, Czech Republic
Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Lukacsovich Tamás Brain Research Institute, University of Zurich, 8057 Zurich, Switzerland

Bálint Éva Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Virágh Erika Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Biology Centre, Czech Academy of Sciences, 37005 České Budějovice, Czech Republic
Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Szabó Kornélia Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Department of Developmental Genetics, German Cancer Research Centre, 69120 Heidelberg, Germany

Hajdu Ildikó Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Molnár Enikő Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

https://orcid.org/0000-0002-2647-0495
Lin Yu-Hsien Biology Centre, Czech Academy of Sciences, 37005 České Budějovice, Czech Republic

Zvara Ágnes Laboratory of Functional Genomics, Core Facility, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Kelemen-Valkony Ildikó Cellular Imaging Laboratory, Core Facility, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Méhi Orsolya Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Török István Department of Developmental Genetics, German Cancer Research Centre, 69120 Heidelberg, Germany

Hegedűs Zoltán Bioinformatics Laboratory, Core Facility, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Department of Biochemistry and Medical Chemistry, Medical School, University of Pécs, 7624 Pécs, Hungary

Kiss Brigitta Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Ramasz Beáta Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Magdalena Laura M Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Puskás László Laboratory of Functional Genomics, Core Facility, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Mechler Bernard M Department of Developmental Genetics, German Cancer Research Centre, 69120 Heidelberg, Germany

Fónagy Adrien Centre for Agricultural Sciences, Plant Protection Institute, 1022 Budapest, Hungary

Asztalos Zoltán Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Aktogen Hungary Ltd., 6726 Szeged, Hungary

Steinbach Gábor Cellular Imaging Laboratory, Core Facility, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Žurovec Michal Biology Centre, Czech Academy of Sciences, 37005 České Budějovice, Czech Republic

Boros Imre Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Kiss István Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary

Salz H Editor
Corresponding author: Institute of Genetics, HUN-REN Biological Research Centre, 6726 Szeged, Hungary. Email: kiss43@brc.hu
Present address: Department of Dermatology and Allergology, University of Szeged, 6720 Szeged, Hungary
Present address: Department of Plant Physiology, Swammerdam Institute for Life Sciences, University of Amsterdam, 1098 XH Amsterdam, The Netherlands
Present address: Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Present address: Institute of Biochemistry, HUN-REN Biological Research Centre, 6726 Szeged, Hungary
Present address: Flow Cytometry Core Facility, EMBL Heidelberg, Meyerhofstraße 1, 69117 Heidelberg, Germany
Present address: Department of Genetics, University of Bucharest, 050095 Bucharest, Romania
Tamás Szlanka and Tamás Lukacsovich contributed equally to this work.

Conflicts of interest The authors declare no conflicts of interest.

9 2024
10 7 2024
10 7 2024
14 9 jkae14906 2 2024
15 6 2024
01 8 2024
© The Author(s) 2024. Published by Oxford University Press on behalf of The Genetics Society of America.
2024
https://creativecommons.org/licenses/by/4.0/ This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.

Abstract

One of the major functions of programmed cell death (apoptosis) is the removal of cells that suffered oncogenic mutations, thereby preventing cancerous transformation. By making use of a Double-Headed-EP (DEP) transposon, a P element derivative made in our laboratory, we made an insertional mutagenesis screen in Drosophila melanogaster to identify genes that, when overexpressed, suppress the p53-activated apoptosis. The DEP element has Gal4-activatable, outward-directed UAS promoters at both ends, which can be deleted separately in vivo. In the DEP insertion mutants, we used the GMR-Gal4 driver to induce transcription from both UAS promoters and tested the suppression effect on the apoptotic rough eye phenotype generated by an activated UAS-p53 transgene. By DEP insertions, 7 genes were identified, which suppressed the p53-induced apoptosis. In 4 mutants, the suppression effect resulted from single genes activated by 1 UAS promoter (Pka-R2, Rga, crol, and Spt5). In the other 3 (Orct2, Polr2M, and stg), deleting either UAS promoter eliminated the suppression effect. In qPCR experiments, we found that the genes in the vicinity of the DEP insertion also showed an elevated expression level. This suggested an additive effect of the nearby genes on suppressing apoptosis. In the eukaryotic genomes, there are coexpressed gene clusters. Three of the DEP insertion mutants are included, and 2 are in close vicinity of separate coexpressed gene clusters. This raises the possibility that the activity of some of the genes in these clusters may help the suppression of the apoptotic cell death.

apoptosis
p53
suppression
activating insertional mutagenesis
Drosophila
Hungarian Scientific Research Fund 10.13039/501100003549 OTKA K69279 German Research Foundation (DFG)-Hungarian Academy of Sciences (MTA) Collaboration Program UNG 436 113/81/0-6 NKFIH 10.13039/501100011019 138128 European Community’s Program Interreg Bayern Tschechische Republik BYCZ01-039
==== Body
pmcIntroduction

Cells seriously damaged by stress or not needed in development are removed by the process of programmed cell death, a genetically regulated “suicide” of cells (apoptosis, pyroptosis, ferroptosis, necroptosis, and entosis; Aubrey et al. 2018b; Liang et al. 2021; Yan et al. 2021; Yu et al. 2021; Bertheloot et al. 2021; Rizzotto et al. 2021). In the process of apoptosis (Pakos-Zebrucka et al. 2016; Voss and Strasser 2020), the transcription factor p53 is the central mediator that directly or indirectly controls the expression of an estimated 3,000 genes (Sammons et al. 2020). With its several isoforms, it is involved in the maintenance of cellular homeostasis, coordinating cell survival and senescence, stem cell renewal and differentiation, programmed cell death, etc. (Anbarasan and Bourdon 2019; Mehta et al. 2021).

A major activator of the p53 gene is the genetic stress (DNA damage, oncogenic mutations, and aneuploidy), which can lead to uncontrolled cell proliferation and cancer. In more than 50% of tumors, the p53 gene has missense mutations, mostly at 6 “hot spot” amino acid residues located in the DNA-binding domain. Some of these specific single amino acid substitutions are classified as gain-of-function (GOF) mutations that drive tumorigenesis (Alvarado-Ortiz et al. 2020); however, other studies reported that most of them act as dominant-negative effect or loss-of-function mutations (Aubrey et al. 2018a; Boettcher et al. 2019; Wang et al. 2024).

With respect to the cancerous transformation, the negative regulators/suppressors of p53 and/or apoptosis are of particular importance. Such genes, like members of the BCL-2 family (Singh et al. 2019; Kaloni et al. 2023), the IAP family (Cetraro et al. 2022), MDM2 (Hou et al. 2019), API5 (Abbas et al. 2024), and DDIAS (Im et al. 2023), under normal conditions, prevent unwanted cell death, and they play important roles in maintaining the cellular and organismal homeostasis. However, their abnormally elevated expression may interfere with the normal regulation of p53 and apoptosis, opening the gate to abnormal cell proliferation and cancer progression (Peng et al. 2022).

The discovery of a p53 Drosophila orthologous gene Dmp53 (Brodsky et al. 2000; Ollmann et al. 2000) revealed that the overall amino acid sequence homology of Dmp53 with the mammalian Tp53 is not particularly high. However, their protein structure, DNA-binding domain sequence, function, and even interaction network are highly similar and evolutionarily well conserved; therefore, the results gained in Drosophila can easily be interpreted for the mammalian system (D’Brot et al. 2017; Zhou 2019; Chakravarti et al. 2022). Specific functions for isoforms Dmp53A and Dmp53B are also reported in somatic, germline, and polyploid tissues of Drosophila (Zhang et al. 2014, 2015; Chakravarti et al. 2022).

The strategy of selectively activating random genes by the insertion of P element constructs that carry Gal4-inducible promoters, e.g. the EP element (Rørth 1996) or the GS construct (Toba et al. 1999), was successfully applied previously for the analysis of complex biological functions in the fruit fly. To recover dominant suppressors of p53-induced apoptosis, we made a GOF screen by making use of the DEP element, which is similar to EP but significantly improved, made in our laboratory. We identified 7 insertion mutants that, when overexpressed, significantly suppressed the apoptotic effect in the eyes, i.e. the rough eye (r.e.) phenotype, in the GMR-Gal4>DEP, UAS-p53 combination. In 3 of them, however, the activation of 1 gene was not enough to exert the suppression effect. As the genes around the DEP insertion are also activated to some extent, they might also contribute to the suppression of r.e.

Materials and methods

Fly cultures and stocks

Fly cultures were kept on standard cornmeal–yeast–agar medium at 25°C if not otherwise stated. The genetic combinations tested were established by standard genetic crosses on w homozygous background.

The following stocks were received from the BDSC Stock Center, Bloomington, Indiana:

P(Δ2-3) : ry[506] P{ry[+t7.2]=Delta2-3}99B

GMR-Gal4: w[*]; P{w[+mC]=GAL4-ninaE.GMR}12

UAS-p53 : y[1] w[1118]; P{w[+mC]=UAS-p53.Ex}3 (expresses the A isoform of p53)

yw; MKRS, FLP/TM6B, Cre : y[1] w[67c23]; MKRS, P{ry[+t7.2]=hsFLP}86E/TM6B, P{w[+mC]=Crew}DH2, Tb[1]

UAS-stg : w[1118]; P{w[+mC]=UAS-stg.N}16/CyO, P{ry[+t7.2]=sevRas1.V12}FK1

w[*]; T(2;3)ap[Xa], ap[Xa]/CyO; TM6

The shortened genotypes in bold preceding the complete ones represent the name used in the text. UAS-Spt5 was a kind gift from Ruth Palmer. Transgenic RNAi stocks were received from the NIG-FLY (Mishima), VDRC (Vienna; Dietzl et al. 2007), and BDSC (Bloomington) collections. The w, DEP homozygous stock used for the transposon mutagenesis was created in our laboratory (see below). In the description of the genetic constructs, we followed the terms of the last updates of FlyBase (Öztürk-Çolak et al. 2024)

Construction of the DEP activating transposon

The pDEP construct was made in our laboratory as follows: at first, we replaced the entire gene trap cassette in the backbone of pGT1 vector (Lukacsovich et al. 2001) with the mini-white+ (m-w+) gene of pCasper2. This step resulted in unique NotI as well as XhoI restriction sites next to the 5′ and 3′ P element ends, respectively. Using these sites, 2 multicloning sites (MCSs) containing several unique restriction sites were inserted in both sides of the m-w+ gene by ligating synthetic double-stranded oligonucleotides into the locations. The 5xUAS-hsp70-core promoter fragment — from the pUAST vector (Brand and Perrimon 1993) — and the loxP and FRT sequences were then inserted in the desired orientations into the MCSs to get the final DEP construct (Fig. 1). A detailed description of the steps of construction is available upon request. As Fig. 1 shows, the sequence unit containing the UAS promoter at the 5′ end of DEP and the m-w+ gene together are flanked by FRT sequences (UASFRT) while the 3′ UAS and the m-w+ are between 2 loxP sites (UASloxP). This arrangement makes the UAS promoters selectively deletable in vivo by the FLP or Cre recombinases. The pDEP construct was microinjected along with the Δ2-3 transposase helper plasmid into w1118 syncytial blastoderm-stage embryos by using standard techniques. Surviving adults were crossed again to w1118 homozygous flies, and in the next generation, transformants were screened for their red eye color, and X chromosomal insertions were selected.

Fig. 1. Structure of the DEP element and selective deletion of the UAS promoters. The 2 outward-directed UAS promoters are located at the ends of the mini-w+ DEP construct. The UAS promoters located at the 5′- and the 3′-ends are flanked by a pair of FRT and loxP sites, respectively. Each one of the UAS promoters together with the mini-w+ marker can selectively be deleted in vivo by the Cre and Flp recombinases (leaving the other UAS promoter intact) resulting ΔloxP and ΔFRT derivatives, respectively. The rectangular arrows at the UAS sites show the directions of the Gal4-induced transcription from the UAS promoters, and the triangles at the ends of the DEP construct represent the terminal repeats of the DEP element.

Genetic screen for dominant modifiers of the p53-induced apoptosis

As shown in Supplementary Fig. 1, female flies carrying the DEP element on the X chromosome were crossed to males of the P(Δ2-3) jumpstarter stock producing the P element transposase (Robertson et al. 1988). Remobilized by the transposase, the DEP element “jumps out” of the X chromosome and gets inserted at new sites in the genome. Males carrying the new insertions in their germline were crossed to females of a T(2;3) translocation balancer w/w; T(2;3)ap[Xa], ap[Xa]/CyO; TM6. In the next generation, male offspring (w/Y) have white eyes, except those which carry new autosomal DEP insertions and have colored eyes by the m-w+ expression. Single males with colored eyes were simultaneously crossed to T(2;3) translocation balancer females (see above) and homozygous “tester” females of w; GMR-Gal4; UAS-p53 genotype. To select against the P(Δ2-3) transposase source, we used those males only, which lacked any sign of eye color mosaicism. In the next generation, if the DEP insertion mutant activated by the GMR-Gal4 driver suppressed the p53-induced r.e. phenotype, red-eyed males carrying the new DEP suppressor mutation above CyO or TM6 balancer were crossed again to the appropriate balancer females. Through serial crosses to balancer stocks, the new insertions on the second or third chromosomes were isolated as homozygous mutant lines.

Determination of DEP insertion sites

Inverse PCR was performed according to the protocol described previously (Kyriacou 2000), with some modification. Shortly, genomic DNA of approximately 10 flies carrying a DEP insertion was extracted and digested with the restriction enzyme HpaII (NEB), and after phenol–chloroform extraction, the resulting fragments were ligated with T4 ligase (NEB) for 2 h at room temperature to circularize them. Two microliters out of the 20 μL ligation mixture was used as template in the PCR reaction. The PCR reactions were performed using Taq DNA Polymerase (QIAGEN) with the Taq PCR buffer, 1.5 mM MgCl2, 0.2 mM dNTPs, and a primer pair specific to the 3′P-end of the DEP element: P3′Fw1 that hybridizes between nucleotide positions 106 and 131 in the DEP vector (GTCTGAGTGAGACAGCGATATGATTG) and P3′Rev1 that binds to the vector between positions 75 and 51 (CACTCGCACTTATTGCAAGCATACG) on the complementary strand, both at 0.5 μM final concentration. The sample was cycled 35 times for 30 s at 95°C, 30 s at 58°C, and 1 min at 72°C. One microliter of the resulted reaction mixture was used as template for a second round of PCR reaction using the following nested primer pair: P3′Fw2 that hybridizes between nucleotide positions 131 and 154 (GTTGATTAACCCTTAGCATGTCCG) and P3′Rev2 that binds to the vector between positions 50 and 28 (TTAAGTGGATGTCTCTTGCCGAC) on the complementary strand, again at 0.5 μM final concentration. The second round reaction was performed under the same conditions as the first round except the annealing temperature was elevated to 60°C.

After purification (QIAquick, QIAGEN), the PCR product was sequenced with primers P3′Fw2 and/or P3′Rev2. Sequence data were blasted to FlyBase (FB2024_02, released 2024 April 23) to identify the genomic region carrying DEP insertion. Insertion points were verified in a third round of PCR reaction using a primer specific to the 5′P-end of the DEP element (P5′Fw) that hybridizes between nucleotide positions 5483 and 5504 in the DEP vector (GTATACTTCGGTAAGCTTCGGC) and a primer specific to each of the relevant genomic regions identified. The DEP insertion site sequences are given in Supplementary Table 1.

Confocal microscopy

Imaginal eye-antennal disks complexed to CNS from the third instar larvae were dissected and mounted in PBS, and native fluorescent signal of GFP was detected by Leica SP5 AOBS confocal laser scanning microscope (Leica, Germany). The images of compared eye disks of the DEP-bearing genotypes and their corresponding controls were captured from the same slide and at the same time within 1 h. We used a 488-nm argon laser for the excitation of the fluorescent signal of GFP, and the emission signals were detected by spectral detector in 500-590 nm range. The optical sections of the samples for quantitative analysis were taken using HCX PL FLUOTAR 5×/0.15 objective; image size: 1,024 pixel × 1,024 pixel, 3,100 μm × 3,100 μm, and pinhole 70 μm. Some selected samples were acquired for detailed images using HCX PL FLUOTAR 40×/0.75 objective; image size: 1,024 pixel × 1,024 pixel, 388 μm × 388 μm, line average 3, and pinhole 113 μm. The images were analysed by the FIJI software (Schindelin et al. 2012). The fluorescence intensities of the Z-sections were averaged using Z-projection, and mean/std was calculated from the pixel values higher than 25 for every kind of sample. (Background pixels less intensive than 25 were marked as NaN [not a number] and excluded from the calculation.)

Selective in vivo deletion of the UAS promoters in the DEP insertion mutants

To induce promoter deletion in the DEP element, the suppressor mutants (supprDEP) were crossed to yw; MKRS, FLP/TM6B, Cre flies, where the MKRS and TM6B balancer chromosomes carry heat-inducible transgenes of the FLP and Cre site-specific recombinases, respectively. The recombinases were induced by heat shock (37°C, 2 h) in the second instar larvae of the F1 generation. The male F1 flies carrying the MKRS or TM6B chromosomes were separately crossed to homozygous w balancer stocks. Because the UAS (along with the coupled promoter) and the mini-w+ marker were removed together, the UAS-deleted flies (supprDEPΔFRT or supprDEPΔloxP) in the next generation could be recognized by the white eye color (Fig. 1).

Silencing the suppressor genes with RNAi

To test whether silencing the DEP-bearing gene really weakened the suppression of apoptosis, we constructed Drosophila stocks carrying an RNAi transgene and the corresponding DEP suppressor mutant on separate autosomes. These stocks were crossed to the w; GMR-Gal4; UAS-p53 homozygous “tester” stock. Among the F1 offspring, we evaluated the r.e. phenotype of the flies that carried the DEP suppressor mutant together with the specific RNAi silencing construct and the UAS-p53 transgene, all of them driven by the GMR-Gal4 driver: GMR-Gal4>supprDEP, UAS-p53, UAS-RNAi.

RNA preparation and RT-qPCR

Total RNA from 20 heads of 3-day-old Drosophila adults for each genetic combination was purified using the RNA isolation kit of Macherey-Nagel (Macherey-Nagel, Düren, Germany) according to the manufacturer's instructions. One microgram of total RNA was reverse transcribed using the High-Capacity cDNA Archive Kit (Thermo Fisher Scientific, Waltham, MA, USA) according to the manufacturer's instructions in 20 μL final volume at 37°C for 2 h following a preincubation at room temperature for 10 min. After inactivating the enzyme at 75°C for 10 min, the reaction mixture was diluted 30 times. One microliter of the diluted reaction mix was used as template in the qPCR.

The reaction was performed with gene-specific primers and HOT FIREPol EvaGreen qPCR Mix Plus (ROX) (Solis BioDyne) according to the manufacturer's instructions at a final primer concentration of 250 nM in Eco Real-Time PCR System (Illumina) under the following conditions: 15 min at 95°C, 40 cycles of 95°C for 15 s, 60°C for 20 s, and 72°C for 20 s. Parts of the reactions were performed using 2× qPCRBIO SyGreen Mix Lo-ROX (PCR Biosystems) according to the manufacturer's instructions at a final primer concentration of 250 nM in RotorGene RG3000 (Corbett Research) qPCR system under the following conditions: 2 min at 95°C, 35 cycles of 95°C for 5 s, and 60°C for 30 s. Melt curve analysis was done after each reaction to check the quality of the products. Primers were designed online using the Roche Universal Probe Library Assay Design Center or the Integrated DNA Technologies qPCR Assay Design RealTime PCR Tool. The primers used to detect p53 mRNA were reported earlier (Pardi et al. 2011). Individual threshold cycle (Ct) values were normalized to Ct values of fzr and FoxK internal control genes. Relative gene expression levels between induced and control genotypes are presented as fold change values calculated using the formula (fold change = 2ΔΔCt), according to the ΔΔCt method (Livak and Schmittgen 2001). For comparation of induced p53 mRNA levels between GMR-Gal4>supprDEP, UAS-p53 genotypes and GMR-Gal4>UAS-p53 ΔΔCt values are directly presented. Primers used in qPCR analysis are listed in Supplementary Table 2.

Statistical analysis of RT-qPCR data

RNA samples were prepared and tested in 3 biological replicates (n = 3) for each genetic combination. Statistical comparison of normalized Ct (ΔCt) values of control and induced genotypes was done by Student's t-test (2-tailed, unequal variance). Results are summarized in Supplementary Table 3.

Results

Isolation and characterization of the mutants carrying the DEP insertions

Overexpression of Dmp53 in the whole body is lethal. To isolate dominant suppressor mutants of the p53-induced apoptosis, we took advantage of the GMR-Gal4 driver, which expresses the Gal4 mainly in the eye (Freeman 1996; Neufeld et al. 1998; Ray and Lakhotia 2015). In heterozygous GMR-Gal4>UAS-p53 flies (GMR-Gal4/+; UAS-p53/+), the elevated expression of p53A isoform causes extensive apoptotic cell death in the eye imaginal disks and results in smaller than normal adult eyes with highly disorganized ommatidial arrays: “r.e.” phenotype (Ollmann et al. 2000; Jin et al. 2000; Kim et al. 2011), as also shown in Fig. 3 (compare a and b). It has to be noted that in the GMR-Gal4/+ heterozygous condition, the GMR-Gal4 driver alone does not show any r.e. phenotype (Fig. 3a′). As the flies showing the r.e. phenotype are viable and fertile (Kramer and Staveley 2003), we built our activating mutagenesis screen on this approach (for the details, see Supplementary Fig. 1). For the mutagenesis, we used the DEP P element construct with 2 outward-directed UAS-coupled promoters (“UAS promoters”), 1 at each end (Fig. 1). As the Gal4 activates both UAS promoters, the transcription simultaneously starts in both directions from the insertion site.

Since the P element preferentially inserts near the 5′ end of the gene (Shilova et al. 2006), we expected that the induced downstream transcription from most DEP insertions would have resulted in enhanced gene expression. We searched for gene mutants (supprDEP) that could suppress the p53 overexpression-induced r.e. phenotype when activated by Gal4 in the genetic combination GMR-Gal4>supprDEP, UAS-p53. Out of more than 2,000 insertions on the second and third chromosomes, we recovered 7 such mutants (Figs. 2 and 3). All of them showed strong suppressor effect producing weaker than grade 1 r.e. phenotype according to our arbitrary r.e. scale (Supplementary Fig. 2). By sequencing the DNA flanking the insertions in the mutant lines, we identified 7 genes (Orct2, Polr2M, Pka-R2, Rga, stg/CDC25, crol, and Fak) with the DEP transposon inserted near their 5′-end and also determined the orientation of the DEP elements (Fig. 2): in 3 out of 7, the DEP insertions are in the first exon (Polr2MDEP105, stgDEP871, and FakDEP2107). In Orct2DEP54, the DEP insert is 129 bp downstream from the transcription start site in the unsplit gene. RgaDEP375 has the insert in the first intron while crolDEP1004 has it in the second exon. In Pka-R2DEP327, the DEP transposon is inserted upstream but near the 5′-end of the gene. As the DEP insertion sites are upstream relative to the translation start sites in all but 1 (Polr2MDEP105, 27 bp downstream from the translation start site) of the mutants, we supposed at first that the suppressor effect was a result of the Gal4-induced downstream transcription and overexpression of the gene. However, the transcription starting from a UAS promoter could also spread over the nearby genes. This assumption was tested by measuring the expression level of the neighbor genes by quantitative PCR and the selective deletion of the UAS promoters of the DEP element (see below).

Fig. 2. General features of DEP insertions and their genomic neighborhood. For the DNA sequence of the insertion site, see Supplementary Table 1. Arrows label the direction of gene transcription. Numbers below the arrows indicate the distance of the DEP insertion site in base pairs downstream from the gene's transcription start site. Asterisk denotes the distance is upstream from the gene's transcription start site. Thick arrows represent genes that are responsible for the suppression effect. The triangles represent the position of the DEP insertions. 5′FRT-UAS and 3′loxP-UAS with thick rectangular arrows mean the Gal4-activatable UAS promoter identified as the activator of the suppression of apoptosis. Dashed rectangular arrows mean that the apoptosis suppressor effect of neither UAS promoter can be determined unequivocally.

Fig. 3. Effect of Gal4-activated suppressor gene mutants and their UAS-deleted derivatives on the p53-induced apoptotic r.e. phenotype. a) Wild-type adult eye. a′) Normal eye of GMR-Gal4/+ heterozygote. b) r.e. phenotype of the GMR-Gal4>UAS-p53. c and d) Apoptosis suppression effect of GMR-Gal4>supprDEP, UAS-p53 combinations. ΔloxP and ΔFRT stand for the UAS-deleted DEP mutant derivatives DEPΔloxP and DEPΔFRT, respectively (see Fig. 1). c) Suppression of r.e. phenotype is caused by 1 of the 2 UASs. d) Deletion of either one or the other UAS promoter results in the same r.e. phenotype, i.e. the apoptosis suppression effect cannot be definitely related to either UAS promoter.

It has to be noted that in all of the different genetic combinations tested, we used every component in heterozygous condition. The GMR-Gal4>UAS-p53 flies showed a strong, characteristic r.e. phenotype that, at the same time, was sensitive enough to be readily modified by the Gal4-activated DEP suppressor mutants in the GMR-Gal4>supprDEP, UAS-p53 heterozygous flies (w1118; GMR-Gal4/+; supprDEP/UAS-p53). These heterozygous combinations were able to detect even the weak combined effect of the genes near the DEP insertion (Fig. 3). To exclude the possibility that the insertions suppress the r.e. phenotype by simply reducing the ability of the GMR-Gal4 driver to activate UAS-p53, we measured the p53 mRNA level in GMR-Gal4>supprDEP, UAS-p53 flies by quantitative PCR and compared the results to that derived from the original p53 overexpressing GMR-Gal4>UAS-p53 flies. As Supplementary Fig. 3 shows, no substantial difference could be detected between the ΔΔCt values of the GMR-Gal4>supprDEP, UAS-p53 genotypes and that of the GMR-Gal4>UAS-p53. The small differences that are still detectable, however, do not correlate with the differences in the strength of suppression shown in Fig. 3. Furthermore, in 3 particular cases (Orct2DEP54, Polr2MDEP105, and stgDEP871), where the gene responsible for the suppressor effect could not be identified unequivocally (see below), in a “counter-screen,” we tested the effect of the insertions on the efficiency of GMR-Gal4 to drive UAS-GFP in the eye-antennal disk of the third instar larvae. Supplementary Fig. 4 shows that there is no difference of substance between representative confocal images of GMR-Gal4>supprDEP, UAS-GFP and GMR-Gal4>UAS-GFP. The quantitative analysis of the confocal images represented by bar chart in Supplementary Fig. 5 shows that strength of the GFP signal in the eye disks from GMR-Gal4>supprDEP, UAS-GFP larvae does not differ substantially from that derived from GMR-Gal4>UAS-GFP larvae.

Altogether, these experiments prove that the suppressing effect of the DEP insertions on r.e. phenotype does not originate from their ability to weaken the strength of GMR-Gal4 activation on UAS-p53.

Determination of the genes responsible for apoptosis suppression

The DEP construct carries 2 outward-directed UAS promoters (Fig. 1), and the Gal4 simultaneously activates transcription from both. As a first assumption, one would expect that the UAS promoter, which initiates downstream transcription of the DEP-bearing gene, is responsible for the suppressor effect. To test this, the promoters were in vivo deleted separately by the FLP or Cre recombinases (see Materials and methods), and the mutant bearing the truncated DEP element (DEPΔFRT or DEPΔloxP) was crossed to homozygous GMR-Gal4; UAS-p53 tester flies to see if the apoptosis suppression effect was lost or retained. As the results show, the mutants can be distributed into 2 groups. In the first one (Pka-R2DEP327, RgaDEP375, crolDEP1004, and FakDEP2017), if deleting one UAS promoter abolishes the suppressor activity, then deleting the other one has weak or no effect (Figs. 2 and 3c). In Pka-R2DEP327 and crolDEP1004, the downstream transcription of the gene responsible for the apoptosis suppression is initiated by the FRT-deletable UASFRT and the Cre-deletable UASloxP promoter, respectively. In the case of RgaDEP375 and FakDEP2017, the orientation of the UAS responsible for the suppression effect points to the upstream direction from the DEP insertion, toward the neighbor genes Atu and spt5, respectively (Fig. 2). In accordance with this, Gal4-induced expression of a UAS-Fak transgene remained ineffective (not shown).

In the mutants of the second group, Orct2DEP54, Polr2MDEP105, and stgDEP871, deletion of either one or the other UAS resulted in some sort of a r.e. phenotype (Fig. 3d). In these cases, we could not assign the suppressor effect unequivocally to one gene or direction. For the further verification of the effective genes, we used RNAi knockdown.

RNAi knockdown of the effective genes alleviates apoptosis suppression

We tested whether a UAS-RNAi transgene, which specifically silences the DEP-bearing gene or one of the neighbor ones, can partly or entirely restore the r.e. phenotype in the GMR-Gal4>UAS-RNAi, supprDEP, UAS-p53 genotype. Therefore, we crossed flies carrying a DEP mutant and a UAS-RNAi construct to the GMR-Gal4; UAS-p53 tester combination, and the results are summarized in Table 1. The r.e. phenotypes were scored according to the r.e. scale (Supplementary Fig. 2). Gal4-induced expression of the RNAi transgenes by themselves did not cause r.e. phenotype (not shown).

Table 1. Effect of RNAi silencing on the apoptosis suppression in the GMR-Gal4>supprDEP, UAS-RNAi, UAS-p53 combination.

DEP insertion mutant	Tested genes in the DEP insertion region	Effective RNAi constructsa (score > 1)	Ineffective RNAi constructsa (score < 1)	
Orct2DEP54	Orct2		VDRC 106681
BDSC 57583	
jar		VDRC 37534
VDRC 37535
VDRC 108221
BDSC 28064	
Polr2MDEP105	PolR2M	BDSC 42917 (1–2)		
CG5250	BDSC 57432 (1–2)		
Pka-R2DEP327	Pka-R2	NIG-FLY 15862R2 (4)
BDSC 27680 (3–4)
BDSC 34983 (4)		
TER94		BDSC 31968	
CG12128		BDSC 33997	
CG1407		BDSC 50601	
RgaDEP375	Rga		BDSC 57549	
asl		BDSC 38220	
Atu	VDRC 106074 (2–3)		
Spec2		BDSC 65206	
stgDEP871	stg	BDSC 36094 (2)		
crolDEP1004	crol		BDSC 44643	
CG14937		BDSC 31483	
CycY		BDSC 34009	
esc		BDSC 31618	
FakDEP2107	Fakl		VDRC 17957
BDSC 29323
BDSC 33617
BDSC 35357	
CalpA		BDSC 29455	
Spt5	NIG-FLY 7626R-3 (3)		
BDSC 34837 (4)		
BDSC, Bloomington Drosophila Stock Center (Bloomington, Indiana); VDRC, Vienna Drosophila Resource Center (Vienna, Austria); NIG-FLY, National Institute of Genetics (Mishima, Japan).

a Only those RNAi constructs were tested, which were located on different chromosomes from the DEP insertions. Specification of the RNAi stocks is given with the stock center name and stock number. The numbers in brackets mean the score of the r.e. phenotype (see Supplementary Fig. 2).

In the case of Pka-R2DEP327, the results were straightforward: all 3 Pka-R2 silencing RNAi transgenes tested restored the r.e. phenotype, verifying that the suppressor effect was really caused by the overexpression of Pka-R2. At the same time, silencing the neighbor genes TER94, CG12128, and CG1407 had no effect (Table 1). In the case of FakDEP2107, the UAS promoter deleting experiments suggested Spt5 to be the gene responsible for the suppressor effect (Fig. 2). Accordingly, RNAi knockdown of Spt5 brought back the r.e. phenotype in the GMR-Gal4>FakDEP2107, UAS-Spt5i, UAS-p53 combination (Table 1). In addition, an Spt5 overexpressing transgene effectively suppressed the r.e. in the GMR-Gal4>UAS-Spt5, UAS-p53 combination (not shown). All these results prove that the Spt5 gene is an apoptosis suppressor.

In the case of RgaDEP375, the UASloxP pointing in the direction of the Atu gene shows the suppressor activity (Fig. 2). In accordance with this, the Atu-silencing RNAi transgene restored the r.e. phenotype but silencing Rga and the neighboring genes asl and Spec2 had no effect (Table 1).

In stgDEP871, the DEP element sits in the first exon near the 5′-end of stg, and the deletion test showed that, to some extent, both UAS promoters were responsible for the apoptosis suppression. The UASFRT initiates transcription toward CG45544, an unknown gene nearby (Fig. 2). There was no RNAi construct available for this gene so we could not test the possible influence of CG45544 on the suppressor effect. However, an RNAi transgene silencing stg moderately reduced the suppressor effect of stgDEP871 (Table 1). We also tested a UAS-stg construct and detected that the overexpression of stg was able, albeit weakly, to suppress the r.e. phenotype in the UAS-stg/GMR-Gal4; UAS-p53/+ combination (not shown). Taken together, one can suppose that in stgDEP871, the simultaneously induced expression of stg and CG45544 could additively suppress apoptosis.

In the case of Polr2MDEP105, the DEP-bearing Polr2M and the neighbor gene CG5250 were separately silenced. As it revealed, both tested RNAi transgenes weakened the suppression of apoptosis to some extent, but their effect was not strong (Table 1). This again suggests an additive suppressive effect of the 2 genes.

RT-qPCR survey of gene activation by the GMR-Gal4 driver

Supposing that the Gal4-induced overexpression of the gene bearing the DEP insertion can spread over the neighbor genes in the region, and their elevated expression may also contribute to the suppressor phenotype, in a RT-qPCR experiment, we systematically tested the expression levels of the nearby genes as well. The results of this survey are summarized in Fig. 4 and Supplementary Fig. 6 and Table 3.

Fig. 4. Gal4-induced activity of the genes bearing the DEP insertion and the genes in the neighborhood. The columns represent the fold change of the gene expression measured in GMR-Gal4>SupprDEP, UAS-p53 vs GMR-Gal4>UAS-p53. For the numerical results, see Supplementary Table 3, *uninduced control: w; Polr2MDEP105/TM3.

In addition to each gene with the DEP insert, Supplementary Table 3 contains the genes in the surrounding region and shows the distances in kb between the genes' transcription start sites and the DEP insertion site, as well as the fold change values of their GMR-Gal4-induced expression levels. The expression levels were measured with UAS-p53 in the background (GMR-Gal4>supprDEP, UAS-p53 vs GMR-Gal4>UAS-p53). For the statistical evaluation of the results, see Supplementary Table 3.

The DEP as a P element derivative mostly inserts itself into or near to the 5′-end of the genes. Consequently, 1 of the 2 UAS promoters can always start the downstream transcription of the gene resulting in a supposedly normal mRNA. Compared to the uninduced “basic activity,” GMR-Gal4 can induce a significantly elevated expression of the DEP-bearing gene, and the activating effect can spread to the nearby genes as well. In general, the level of activation decreased with the growing distance from the DEP insert, but the actual values varied depending on the gene and the region (Fig. 4; Supplementary Fig. 6 and Table 3).

The fold degree of activation largely depended on the basic, uninduced level of the gene activity (see in FlyAtlas, www.flyatlas2.org): when it was very low in general, the Gal4-induced expression could reach high or extremely high relative levels. For example, for stgDEP871, the GMR-Gal4-induced fold change was 146 times, while in the vicinity, CG45544 (distance from DEP insertion site 1.6 kb) and CR45568 (distance 21.8 kb) were induced by 7 × 104 and 4 × 103 times, respectively (Fig. 4; Supplementary Fig. 6 and Table 3).

Apoptosis suppressor mutants in coexpressed gene clusters

We compared the chromosomal location of the genes in the DEP insertion neighborhoods with that of the known coexpressed gene clusters in the Drosophila genome (Spellman and Rubin 2002). Supplementary Table 4 shows that in 3 mutants (Polr2MDEP105, RgaDEP375, and FakDEP2107), the DEP-bearing genes and their neighbors were included in 3 separate coexpressed clusters. In addition, 2 other mutants, Orct2DEP54 and crolDEP1004, are located near the boundary of further 2 clusters. In Polr2MDEP105, the promoter deletion and the RNAi experiments together identified Polr2M and CG5250 genes that were able to suppress the p53-induced apoptosis to some extent, when overexpressed. As it revealed, at least 2 genes of the coexpressed cluster hit by the Polr2MDEP105 insertion could be involved in the process of apoptosis regulation. Whether the other genes in this and other clusters have similar ability or could influence the antiapoptotic activity of the DEP neighborhood genes remains to be seen.

Discussion

In the present study, we identified genes by genomic insertions of the DEP element through their ability to suppress the r.e. phenotype induced by the GMR-Gal4-driven p53. We think that the main cause of the suppressor effect is the suppression of the cell death. However, the p53 as a transcription factor can directly or indirectly influence the expression of many genes, which may contribute to the given phenotype. For example, p53 can induce p21 (Deiry et al. 1993; Fan et al. 2010) that arrests the cell cycle through different pathways (Engeland 2018, 2022) and also regulates other nonapoptotic cell death pathways like ferroptosis, entosis, and paraptosis (Bredesen et al. 2006; Liang et al. 2021; Yu et al. 2021). In addition, it was reported that overexpression of p53 in the eye disturbed the differentiation of R7 photoreceptor neurons and cone cells that also resulted in r.e. phenotype. This suggests that the r.e. is caused by apoptosis and differentiation defects together (Fan et al. 2010). Both these processes can be suppressed by expression of p21/dap (Fan et al. 2010). If such processes are responsible for the r.e. phenotype, the suppressor genes we identified should inhibit some of them.

In the case of 4 DEP insertions, by in vivo selective elimination of one or the other UAS promoter of the DEP element, the gene from which the apoptosis suppression originates could be determined by the loss of its effect, while in the rest 3 cases, the gene responsible for the suppressor effect remained uncertain. It has to be noted that, even in the cases when the suppression of apoptosis could be assigned to 1 gene, the flies having a truncated DEP with the “suppressor UAS” only showed a weaker suppression of the r.e. phenotype than the original mutant bearing the intact DEP element (Fig. 3c). In these cases, the induction of transcription and the possible activation of the neighbor genes were obviously lopsided. This may hint at the possibility that the weaker suppressor effect would either be a result of the missing activity of the neighbor genes on the “silent” side of the truncated DEP insert or, if both UAS promoters are simultaneously activated in the intact DEP element, there is synergy between them, e.g. by mutually loosening up the chromatin structure, which would enhance the level of transcription of the “suppressor” gene.

In the GMR-Gal4 (Glass Multimer Reporter) driver, the Gal4 is mainly expressed in the developing eye disk and the adult eye (Ollmann et al. 2000; Roman and Davis 2002; Yang et al. 2005). However, GMR-Gal4 expression was detected in other tissues as well, namely in the brain, trachea, and leg disks (Li et al. 2012). In addition, Ray and Lakhotya (2015) found that the strong Gal4 expression (e.g. GMR-Gal4 in homozygous) on its own can interfere with normal eye development resulting in some r.e. adult phenotype. To avoid these possible disturbing effects, we used only 1 copy of the GMR-Gal4 driver in heterozygous condition that on its own did not interfere with the normal eye development in the genetic combinations used (Fig. 3a′).

However, if we have only 1 copy of GMR-Gal4 in the combination, the number of the Gal4 binding sites can become critical. If too many UAS motifs compete for the limited amount of Gal4 protein, the Gal4-induced apoptosis and r.e. phenotype would become weaker, mimicking the suppression of apoptosis. In the heterozygous “tester” combination (GMR-Gal4>DEP, UAS-p53), there were 3 UAS motifs sharing the Gal4 and with all of the more than 2000 ineffective DEP insertions the animals showed the r.e. phenotype. If the combination contains 4 UASs (e.g. GMR-Gal4>supprDEP, UAS-RNAi, UAS-p53), the r.e. is still well visible (Table 1). Above this number, however, the r.e. phenotype begins to weaken. Hence, the genetic combinations, we used, contained only 4 UASs at the maximum.

In the case of stgDEP871 mutant, all the experiments, including promoter deletion (Fig. 3), RNAi silencing (Table 1), and overexpression of stg, pointed to the direction that stg, at least in part, is responsible for the suppression of apoptosis. This is in accordance with the fact that stg is the Drosophila ortholog of the cdc25 phosphatase that is a key factor of mitosis progression and reported earlier to be able to inhibit apoptosis (Kylsten and Saint 1997; Fuhrmann et al. 2001; Cho et al. 2015). Interestingly, Ruiz-Losada et al. (2022) recently published their observation that seemingly opposes these above results. They found that overexpressing the stg gene in larval wing disks followed by X-ray irradiation acted in proapoptotic way. The exact relation of stg to apoptosis needs further investigation.

In mutant FakDEP2107, both the promoter deletion and RNAi experiments suggested that the suppressor effect was exerted by Spt5 instead of Fak (Figs. 2 and 3 and Table 1). This observation was not expected, since the mammalian ortholog gene FAK is a potent apoptosis suppressor (Sonoda et al. 2000; Kurenova et al. 2004).

Interestingly, neither of the genes we identified as apoptotic suppressor belongs to the IAP gene family. Only 3 IAP genes, Diap1, Diap2 (Hay et al. 1995), and Bruce (Domingues and Ryoo 2012) were discovered in Drosophila, so the likelihood of a random hit by the DEP is very low, and we did not recover any insertion in them. Similarly, we did not find DEP mutants for other known apoptosis suppressor genes either: Api5 (Morris et al. 2006); the MDM2 ortholog, corp (Chakraborty et al. 2015); and the BCL-2 prosurvival family member, Buffy (Colussi et al. 2000; Brachmann et al. 2000; Quinn et al. 2003). Genes inhibiting cell death are very important, and presently, intensive research is focused on them as potential targets of anticancer drugs like the Bcl-2 inhibitor venetoclax (Fairbrother et al. 2019). We hope that the genes we identified will also contribute to the progress of the field.

On the chromosomes of eukaryotic organisms, there are gene clusters in which the genes are coexpressed (Ben-Shahar et al. 2007; Michalak 2008; De and Babu 2010; Mihelčić et al. 2019). Some of the clusters contain genes with similar functions, while others have genes with diverse functions (Lercher et al. 2002). Such coexpressed gene clusters were found also in Drosophila (Boutanaev et al. 2002; Spellman and Rubin 2002; Stolc et al. 2004).

As it revealed, 3 out of the 7 mutants (Polr2MDEP105, RgaDEP375, and FakDEP2107) and their neighbor genes are located in 3 separate coexpressed clusters, and 2 mutants (Orct2DEP54 and crolDEP1004) are outside but very near to other separate clusters (Supplementary Table 4). This is particularly interesting in the case of Polr2MDEP105 insertion, since we identified both Polr2M and CG5250 in its neighborhood to be able to suppress the p53-induced apoptosis to some extent. It may suggest that at least one of the common goals of the cellular processes, in which the genes of this cluster are involved, could be the suppression of apoptosis, even without the activation of these genes by Gal4. We speculate that this suppression can be an additive effect of the activated genes around the DEP insertion. Whether the other genes in the cluster would exert similar effect, and the genes in the other clusters mentioned above could influence the suppression of apoptosis, needs further investigation.

The question promptly arises whether these genes near the DEP insertion site can really suppress apoptosis or they can influence the regulation of apoptosis in any respect. To this end, we conducted a survey in the literature for the genes tested in the RT-qPCR experiment. As the Drosophila genes are not so well characterized in this respect, we examined their human orthologs as well. The programmed cell death is one of the most important factors blocking the development of cancer; therefore, a lot of information and data can be found about the protein-coding human genes in this respect. Logically, if a gene has any antiapoptotic effect, its overexpression promotes cell proliferation and tumor development while its reduced activity has the opposite effect. Supplementary Table 5 shows the 7 DEP-bearing Drosophila genes and their close neighbors (26 genes) as well as their human orthologs (24 genes), see GeneCards the Human Gene Database (Stelzer et al. 2016). Altogether, according to the literature, 21 of these human genes possibly have antiapoptotic activity, 2 genes are proapoptotic, and 1 gene is uncertain in this respect. Our results in Drosophila call attention to the apoptosis suppressive effect of these genes.

Taken together, as our results suggest, in certain cases, not only the gene examined but other genes in the vicinity can also influence the regulation of the programmed cell death, especially if they are overexpressed ectopically. In general, while the effect of a single gene can be negligible, the combined effect together with the neighbor genes can add up to a significant level.

Supplementary Material

jkae149_Supplementary_Data

Acknowledgments

Stocks were obtained from the Bloomington Drosophila Stock Center (NIH P40OD018537), National Institute of Genetics Fly Stock Center, and Vienna Drosophila Resource Center (VDRC). We are grateful to Rozália Török, Gábor Fazekas, Mária Kopp, and Tünde Tóth for technical assistance.

Data availability

The strains and the DEP transposon are available upon request. All data confirming the conclusions of the article are included in the article, figures, and tables.

Supplemental material available at G3 online.

Funding

This work was supported by the Hungarian Scientific Research Fund (OTKA K69279). BMM and IK were supported by the German Research Foundation (DFG)-Hungarian Academy of Sciences (MTA) Collaboration Program (UNG 436 113/81/0-6). AF was supported by National Research, Development and Innovation Office (NKFIH 138128). MŽ was supported by the European Community’s Program Interreg Bayern Tschechische Republik (BYCZ01-039).

Author contributions

TL and IK designed and constructed the DEP element. IK and TS directed the experimental work. ÉB, OM, IH, EM, EV, and BK isolated the DEP insertion mutants and their UAS-deleted derivatives. IK, ÉB, and IB designed and performed the p53-suppressor screen. TL, KS, IT, and BMM determined the position of DEP insertion sites. BR, LMM, and ZA performed the RNAi experiments. TS, Y-HL, ÁZ, EV, LP, and MŽ designed and performed the RT-qPCR experiments. EV, IK-V, GS, and TS prepared samples and performed confocal microscopy. ZH, TS, and AF performed bioinformatic and statistical analysis. EV edited the figures and tables. IK, TS, and MŽ wrote the manuscript.
==== Refs
Literature cited

Abbas H , DerkaouiDK, JeammetL, AdicéamE, TiollierJ, SicardH, BraunT, PoyetJL. 2024. Apoptosis inhibitor 5: a multifaceted regulator of cell fate. Biomolecules. 14 (1 ):136. doi:10.3390/biom14010136.38275765
Alvarado-Ortiz E , de la Cruz-LópezKG, Becerril-RicoJ, Sarabia-SánchezMA, Ortiz-SánchezE, García-CarrancáA. 2020. Mutant p53 gain-of-function: role in cancer development, progression, and therapeutic approaches. Front Cell Dev Biol. 8 :607670. doi:10.3389/fcell.2020.607670.33644030
Anbarasan T , BourdonJ-C. 2019. The emerging landscape of p53 isoforms in physiology, cancer and degenerative diseases. Int J Mol Sci. 20 (24 ):6257. doi:10.3390/ijms20246257.31835844
Aubrey BJ , JanicA, ChenY, ChangC, LieschkeEC, DiepstratenST, KuehAJ, BernardiniJP, DewsonG, O'ReillyLA, et al 2018a. Mutant TRP53 exerts a target gene-selective dominant-negative effect to drive tumor development. Genes Dev. 32 (21–22 ):1420–1429. doi:10.1101/gad.314286.118.30366906
Aubrey BJ , KellyGL, JanicA, HeroldMJ, StrasserA. 2018b. How does p53 induce apoptosis and how does this relate to p53-mediated tumour suppression? Cell Death Differ. 25 (1 ):104–113. doi:10.1038/cdd.2017.169.29149101
Ben-Shahar Y , NannapaneniK, CasavantTL, ScheetzTE, WelshMJ. 2007. Eukaryotic operon-like transcription of functionally related genes in Drosophila. Proc Natl Acad Sci U S A. 104 (1 ):222–227. doi:10.1073/pnas.0609683104.17190802
Bertheloot D , LatzE, FranklinBS. 2021. Necroptosis, pyroptosis and apoptosis: an intricate game of cell death. Cell Mol Immunol. 18 (5 ):1106–1121. doi:10.1038/s41423-020-00630-3.33785842
Boettcher S , MillerPG, SharmaR, McConkeyM, LeventhalM, KrivtsovAV, GiacomelliAO, WongW, KimJ, ChaoS, et al 2019. A dominant-negative effect drives selection of TP53 missense mutations in myeloid malignancies. Science. 365 (6453 ):599–604. doi:10.1126/science.aax3649.31395785
Boutanaev AM , KalmykovaAI, ShevelyovYY, NurminskyDI. 2002. Large clusters of co-expressed genes in the Drosophila genome. Nature. 420 (6916 ):666–669. doi:10.1038/nature01216.12478293
Brachmann CB , JassimOW, WachsmuthBD, CaganRL. 2000. The Drosophila bcl-2 family member dBorg-1 functions in the apoptotic response to UV-irradiation. Curr Biol. 10 (9 ):547–550. doi:10.1016/s0960-9822(00)00474-7.10801447
Brand AH , PerrimonN. 1993. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Dev Camb Engl. 118 :401–415. doi:10.1242/dev.118.2.401.
Bredesen DE , RaoRV, MehlenP. 2006. Cell death in the nervous system. Nature. 443 (7113 ):796–802. doi:10.1038/nature05293.17051206
Brodsky MH , NordstromW, TsangG, KwanE, RubinGM, AbramsJM. 2000. Drosophila p53 binds a damage response element at the reaper locus. Cell. 101 (1 ):103–113. doi:10.1016/S0092-8674(00)80627-3.10778860
Cetraro P , Plaza-DiazJ, MacKenzieA, Abadía-MolinaF. 2022. A review of the current impact of inhibitors of apoptosis proteins and their repression in cancer. Cancers (Basel). 14 (7 ):1671. doi:10.3390/cancers14071671.35406442
Chakraborty R , LiY, ZhouL, GolicKG. 2015. Corp regulates P53 in Drosophila melanogaster via a negative feedback loop. PLoS Genet. 11 (7 ):e1005400. doi:10.1371/journal.pgen.1005400.26230084
Chakravarti A , ThirimanneHN, BrownS, CalviBR. 2022. Drosophila p53 isoforms have overlapping and distinct functions in germline genome integrity and oocyte quality control. eLife. 11 :e61389. doi:10.7554/eLife.61389.35023826
Cho YC , ParkJE, ParkBC, KimJH, JeongDG, ParkSG, ChoS. 2015. Cell cycle-dependent Cdc25C phosphatase determines cell survival by regulating apoptosis signal-regulating kinase 1. Cell Death Differ. 22 (10 ):1605–1617. doi:10.1038/cdd.2015.2.25633196
Colussi PA , QuinnLM, HuangDC, CoombeM, ReadSH, RichardsonH, KumarS. 2000. Debcl, a proapoptotic Bcl-2 homologue, is a component of the Drosophila melanogaster cell death machinery. J Cell Biol. 148 (4 ):703–714. doi:10.1083/jcb.148.4.703.10684252
D’Brot A , KurtzP, ReganE, JakubowskiB, AbramsJM. 2017. A platform for interrogating cancer-associated p53 alleles. Oncogene. 36 (2 ):286–291. doi:10.1038/onc.2016.48.26996664
De S , BabuMM. 2010. Genomic neighbourhood and the regulation of gene expression. Curr Opin Cell Biol. 22 (3 ):326–333. doi:10.1016/j.ceb.2010.04.004.20493676
Deiry WS , TokinoT, VelculescuVE, LevyDB, ParsonsR, TrentJM, LinD, MercerWE, KinzlerKW, VogelsteinB. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell. 75 (4 ):817–825. doi:10.1016/0092-8674(93)90500-p.8242752
Dietzl G , ChenD, SchnorrerF, SuKC, BarinovaY, FellnerM, GasserB, KinseyK, OppelS, ScheiblauerS, et al 2007. A genome-wide transgenic RNAi library for conditional gene inactivation in Drosophila. Nature. 448 (7150 ):151–156. doi:10.1038/nature05954.17625558
Domingues C , RyooHD. 2012. Drosophila BRUCE inhibits apoptosis through non-lysine ubiquitination of the IAP-antagonist REAPER. Cell Death Differ. 19 (3 ):470–477. doi:10.1038/cdd.2011.116.21886178
Engeland K . 2018. Cell cycle arrest through indirect transcriptional repression by p53: i have a DREAM. Cell Death Differ. 25 (1 ):114–132. doi:10.1038/cdd.2017.172.29125603
Engeland K . 2022. Cell cycle regulation: p53-p21-RB signaling. Cell Death Differ. 29 (5 ):946–960. doi:10.1038/s41418-022-00988-z.35361964
Fairbrother WJ , LeversonJD, SampathD, SouersAJ. 2019. Discovery and development of venetoclax, a selective antagonist of BCL-2. In: Successful Drug Discovery. Hoboken, NJ: John Wiley & Sons, Ltd. p. 225–245.
Fan Y , LeeTV, XuD, ChenZ, LamblinAF, StellerH, BergmannA. 2010. Dual roles of Drosophila p53 in cell death and cell differentiation. Cell Death Differ. 17 (6 ):912–921. doi:10.1038/cdd.2009.182.19960025
Freeman M . 1996. Reiterative use of the EGF receptor triggers differentiation of all cell types in the Drosophila eye. Cell. 87 (4 ):651–660. doi:10.1016/s0092-8674(00)81385-9.8929534
Fuhrmann G , LeisserC, RosenbergerG, GruschM, HuettenbrennerS, HalamaT, MosbergerI, SasgaryS, CerniC, KrupitzaG. 2001. Cdc25A phosphatase suppresses apoptosis induced by serum deprivation. Oncogene. 20 (33 ):4542–4553. doi:10.1038/sj.onc.1204499.11494150
Hay BA , WassarmanDA, RubinGM. 1995. Drosophila homologs of baculovirus inhibitor of apoptosis proteins function to block cell death. Cell. 83 (7 ):1253–1262. doi:10.1016/0092-8674(95)90150-7.8548811
Hou H , SunD, ZhangX. 2019. The role of MDM2 amplification and overexpression in therapeutic resistance of malignant tumors. Cancer Cell Int. 19 (1 ):216. doi:10.1186/s12935-019-0937-4.31440117
Im J-Y , KangM-J, KimB-K, WonM. 2023. DDIAS, DNA damage-induced apoptosis suppressor, is a potential therapeutic target in cancer. Exp Mol Med. 55 (5 ):879–885. doi:10.1038/s12276-023-00974-6.37121974
Jin S , MartinekS, JooWS, WortmanJR, MirkovicN, SaliA, YandellMD, PavletichNP, YoungMW, LevineAJ. 2000. Identification and characterization of a p53 homologue in Drosophila melanogaster. Proc Natl Acad Sci U S A. 97 (13 ):7301–7306. doi:10.1073/pnas.97.13.7301.10860994
Kaloni D , DiepstratenST, StrasserA, KellyGL. 2023. BCL-2 protein family: attractive targets for cancer therapy. Apoptosis. 28 (1–2 ):20–38. doi:10.1007/s10495-022-01780-7.36342579
Kim H , LeeJM, LeeG, BhinJ, OhSK, KimK, PyoKE, LeeJS, YimHY, KimKI, et al 2011. DNA damage-induced RORα is crucial for p53 stabilization and increased apoptosis. Mol. Cell. 44 (5 ):797–810. doi:10.1016/j.molcel.2011.09.023.22152482
Kramer JM , StaveleyBE. 2003. GAL4 causes developmental defects and apoptosis when expressed in the developing eye of Drosophila melanogaster. Genet Mol Res. 2 :43–47.12917801
Kurenova E , XuLH, YangX, BaldwinAS, CravenRJ, HanksSK, LiuZG, CanceWG. 2004. Focal adhesion kinase suppresses apoptosis by binding to the death domain of receptor-interacting protein. Mol Cell Biol. 24 (10 ):4361–4371. doi:10.1128/MCB.24.10.4361-4371.2004.15121855
Kylsten P , SaintR. 1997. Imaginal tissues of Drosophila melanogaster exhibit different modes of cell proliferation control. Dev Biol. 192 (2 ):509–522. doi:10.1006/dbio.1997.8770.9441685
Kyriacou CP . 2000. Drosophila protocols edited by William Sullivan, Michael Ashburner and R. Scott Hawley. Trends Genet. 16 (11 ):524. doi:10.1016/S0168-9525(00)02094-1.
Lercher MJ , UrrutiaAO, HurstLD. 2002. Clustering of housekeeping genes provides a unified model of gene order in the human genome. Nat Genet. 31 (2 ):180–183. doi:10.1038/ng887.11992122
Li W-Z , LiS-L, ZhengHY, ZhangS-P, XueL. 2012. A broad expression profile of the GMR-GAL4 driver in Drosophila melanogaster. Genet Mol Res. 11 (3 ):1997–2002. doi:10.4238/2012.August.6.4.22911584
Liang J , NiuZ, ZhangB, YuX, ZhengY, WangC, RenH, WangM, RuanB, QinH, et al 2021. p53-dependent elimination of aneuploid mitotic offspring by entosis. Cell Death Differ. 28 (2 ):799–813. doi:10.1038/s41418-020-00645-3.33110215
Livak KJ , SchmittgenTD. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25 (4 ):402–408. doi:10.1006/meth.2001.1262.11846609
Lukacsovich T , AsztalosZ, AwanoW, BabaK, KondoS, NiwaS, YamamotoD. 2001. Dual-tagging gene trap of novel genes in Drosophila melanogaster. Genetics. 157 (2 ):727–742. doi:10.1093/genetics/157.2.727.11156992
Mehta S , CampbellH, DrummondCJ, LiK, MurrayK, SlatterT, BourdonJC, BraithwaiteAW. 2021. Adaptive homeostasis and the p53 isoform network. EMBO Rep. 22 (12 ):e53085. doi:10.15252/embr.202153085.34779563
Michalak P . 2008. Coexpression, coregulation, and cofunctionality of neighboring genes in eukaryotic genomes. Genomics. 91 (3 ):243–248. doi:10.1016/j.ygeno.2007.11.002.18082363
Mihelčić M , ŠmucT, SupekF. 2019. Patterns of diverse gene functions in genomic neighborhoods predict gene function and phenotype. Sci Rep. 9 (1 ):19537. doi:10.1038/s41598-019-55984-0.31863070
Morris EJ , MichaudWA, JiJY, MoonNS, RoccoJW, DysonNJ. 2006. Functional identification of Api5 as a suppressor of E2F-dependent apoptosis in vivo. PLoS Genet. 2 (11 ):e196. doi:10.1371/journal.pgen.0020196.17112319
Neufeld TP , de la CruzAF, JohnstonLA, EdgarBA. 1998. Coordination of growth and cell division in the Drosophila wing. Cell. 93 (7 ):1183–1193. doi:10.1016/s0092-8674(00)81462-2.9657151
Ollmann M , YoungLM, Di ComoCJ, KarimF, BelvinM, RobertsonS, WhittakerK, DemskyM, FisherWW, BuchmanA, et al 2000. Drosophila p53 is a structural and functional homolog of the tumor suppressor p53. Cell. 101 (1 ):91–101. doi:10.1016/S0092-8674(00)80626-1.10778859
Öztürk-Çolak A , MarygoldSJ, AntonazzoG, AttrillH, Goutte-GattatD, JenkinsVK, MatthewsBB, MillburnG, Dos SantosG, TaboneCJ. 2024. FlyBase: updates to the Drosophila genes and genomes database. Genetics. 227 :iyad211. doi:10.1093/genetics/iyad211.38301657
Pakos-Zebrucka K , KorygaI, MnichK, LjujicM, SamaliA, GormanAM. 2016. The integrated stress response. EMBO Rep. 17 (10 ):1374–1395. doi:10.15252/embr.201642195.27629041
Pardi N , VámosE, UjfaludiZ, KomonyiO, BodaiL, BorosIM. 2011. In vivo effects of abolishing the single canonical sumoylation site in the C-terminal region of Drosophila p53. Acta Biol Hung. 62 (4 ):397–412. doi:10.1556/ABiol.62.2011.4.6.22119869
Peng F , LiaoM, QinR, ZhuS, PengC, FuL, ChenY, HanB. 2022. Regulated cell death (RCD) in cancer: key pathways and targeted therapies. Signal Transduct Target Ther. 7 (1 ):286. doi:10.1038/s41392-022-01110-y.35963853
Quinn L , CoombeM, MillsK, DaishT, ColussiP, KumarS, RichardsonH. 2003. Buffy, a Drosophila Bcl-2 protein, has anti-apoptotic and cell cycle inhibitory functions. EMBO J. 22 (14 ):3568–3579. doi:10.1093/emboj/cdg355.12853472
Ray M , LakhotiaSC. 2015. The commonly used eye-specific sev-GAL4 and GMR-GAL4 drivers in Drosophila melanogaster are expressed in tissues other than eyes also. J Genet. 94 (3 ):407–416. doi:10.1007/s12041-015-0535-8.26440079
Rizzotto D , EnglmaierL, VillungerA. 2021. At a crossroads to cancer: how p53-induced cell fate decisions secure genome integrity. Int J Mol Sci. 22 (19 ):10883. doi:10.3390/ijms221910883.34639222
Robertson HM , PrestonCR, PhillisRW, Johnson-SchlitzDM, BenzWK, EngelsWR. 1988. A stable genomic source of P element transposase in Drosophila melanogaster. Genetics. 118 (3 ):461–470. doi:10.1093/genetics/118.3.461.2835286
Roman G , DavisRL. 2002. Conditional expression of UAS-transgenes in the adult eye with a new gene-switch vector system. Genes (Basel). 34 (1–2 ):127–131. doi:10.1002/gene.10133.
Rørth P . 1996. A modular misexpression screen in Drosophila detecting tissue-specific phenotypes. Proc Natl Acad Sci U S A. 93 (22 ):12418–12422. doi:10.1073/pnas.93.22.12418.8901596
Ruiz-Losada M , GonzálezR, PeropadreA, Gil-GálvezA, TenaJJ, BaonzaA, EstellaC. 2022. Coordination between cell proliferation and apoptosis after DNA damage in Drosophila. Cell Death Differ. 29 (4 ):832–845. doi:10.1038/s41418-021-00898-6.34824391
Sammons MA , NguyenT-AT, McDadeSS, FischerM. 2020. Tumor suppressor p53: from engaging DNA to target gene regulation. Nucleic Acids Res. 48 (16 ):8848–8869. doi:10.1093/nar/gkaa666.32797160
Schindelin J , Arganda-CarrerasI, FriseE, KaynigV, LongairM, PietzschT, PreibischS, RuedenC, SaalfeldS, SchmidB, et al 2012. Fiji: an open-source platform for biological-image analysis. Nat Methods. 9 (7 ):676–682. doi:10.1038/nmeth.2019.22743772
Shilova VY , GarbuzDG, MyasyankinaEN, ChenB, Evgen'EvMB, FederME, ZatsepinaOG. 2006. Remarkable site specificity of local transposition into the Hsp70 promoter of Drosophila melanogaster. Genetics. 173 (2 ):809–820. doi:10.1534/genetics.105.053959.16582443
Singh R , LetaiA, SarosiekK. 2019. Regulation of apoptosis in health and disease: the balancing act of BCL-2 family proteins. Nat Rev Mol Cell Biol. 20 (3 ):175–193. doi:10.1038/s41580-018-0089-8.30655609
Sonoda Y , MatsumotoY, FunakoshiM, YamamotoD, HanksSK, KasaharaT. 2000. Anti-apoptotic role of focal adhesion kinase (FAK). Induction of inhibitor-of-apoptosis proteins and apoptosis suppression by the overexpression of FAK in a human leukemic cell line, HL-60. J Biol Chem. 275 (21 ):16309–16315. doi:10.1074/jbc.275.21.16309.10821872
Spellman PT , RubinGM. 2002. Evidence for large domains of similarly expressed genes in the Drosophila genome. J Biol. 1 (1 ):5. doi:10.1186/1475-4924-1-5.12144710
Stelzer G , RosenN, PlaschkesI, ZimmermanS, TwikM. 2016. The GeneCards suite: from gene data mining to disease genome sequence analyses. Curr Protoc Bioinforma. 54 :1.30.1–1.30.33. doi:10.1002/cpbi.5.
Stolc V , GauharZ, MasonC, HalaszG, Van BatenburgMF, RifkinSA, HuaS, HerremanT, TongprasitW, BarbanoPE, et al 2004. A gene expression map for the euchromatic genome of Drosophila melanogaster. Science. 306 (5696 ):655–660. doi:10.1126/science.1101312.15499012
Toba G , OhsakoT, MiyataN, OhtsukaT, SeongKH, AigakiT. 1999. The gene search system. A method for efficient detection and rapid molecular identification of genes in Drosophila melanogaster. Genetics. 151 (2 ):725–737. doi:10.1093/genetics/151.2.725.9927464
Voss AK , StrasserA. 2020. The essentials of developmental apoptosis. F1000Res. 9 :148. doi:10.12688/f1000research.21571.1.
Wang Z , BurigottoM, GhettiS, VaillantF, TanT, CapaldoBD, PalmieriM, HirokawaY, TaiL, SimpsonDS, et al 2024. Loss-of-function but not gain-of-function properties of mutant TP53 are critical for the proliferation, survival, and metastasis of a broad range of cancer cells. Cancer Discov. 14 (2 ):362–379. doi:10.1158/2159-8290.CD-23-0402.37877779
Yan HF , ZouT, TuoQZ, XuS, LiH, BelaidiAA, LeiP. 2021. Ferroptosis: mechanisms and links with diseases. Signal Transduct Target Ther. 6 :49. doi:10.1038/s41392-020-00428-9.33536413
Yang Z , EdenbergHJ, DavisRL. 2005. Isolation of mRNA from specific tissues of Drosophila by mRNA tagging. Nucleic Acids Res. 33 (17 ):e148. doi:10.1093/nar/gni149.16204451
Yu P , ZhangX, LiuN, TangL, PengC, ChenX. 2021. Pyroptosis: mechanisms and diseases. Signal Transduct Target Ther. 6 (1 ):128. doi:10.1038/s41392-021-00507-5.33776057
Zhang B , MehrotraS, NgWL, CalviBR. 2014. Low levels of p53 protein and chromatin silencing of p53 target genes repress apoptosis in Drosophila endocycling cells. PLoS Genet. 10 (9 ):e1004581. doi:10.1371/journal.pgen.1004581.25211335
Zhang B , RotelliM, DixonM, CalviBR. 2015. The function of Drosophila p53 isoforms in apoptosis. Cell Death Differ. 22 (12 ):2058–2067. doi:10.1038/cdd.2015.40.25882045
Zhou L . 2019. P53 and apoptosis in the Drosophila model. Adv Exp Med Biol. 1167 :105–112. doi:10.1007/978-3-030-23629-8_6.31520351
