
==== Front
Int J Med Sci
Int J Med Sci
ijms
International Journal of Medical Sciences
1449-1907
Ivyspring International Publisher Sydney

10.7150/ijms.99992
ijmsv21p2215
Research Paper
Integration of proteomics and transcriptomics to construct a prognostic signature of renal clear cell carcinoma
Cheng Guangyang 1#
Zhou Zhaokai 123#
Li Shiqi 1#
Ye Zhuo 1
Wang Yan 1
Wen Jianguo 123
Ren Chuanchuan 1✉
1 Department of Urology, The First Affiliated Hospital of Zhengzhou University, Henan, Zhengzhou 450052, China.
2 Henan Joint International Pediatric Urodynamic Laboratory, The First Affiliated Hospital of Zhengzhou University, Henan, Zhengzhou 450052, China.
3 Bladder Structure and Function Reconstruction Henan Engineering Laboratory, The First Affiliated Hospital of Zhengzhou University, Henan, Zhengzhou 450052, China.
✉ Corresponding author: Chuanchuan Ren. Department of Urology, The First Affiliated Hospital of Zhengzhou University, Zhengzhou 450052, China (E-mail: cc_ren@zzu.edu.cn).
#These authors contributed equally to this work.

Competing Interests: The authors have declared that no competing interest exists.

2024
19 8 2024
21 11 22152232
23 6 2024
6 8 2024
© The author(s)
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See https://ivyspring.com/terms for full terms and conditions.
Background: Protein information is often replaced by RNA data in studies to understand cancer-related biological processes or molecular functions, and proteins of prognostic significance in Kidney clear cell carcinoma (KIRC) remain to be mined.

Methods: The cancer genome atlas program (TCGA) data was utilized to screen for proteins that are prognostically significant in KIRC. Machine learning algorithms were employed to develop protein prognostic models. Additionally, immune infiltration abundance, somatic mutation differences, and immunotherapeutic responses were analyzed in various protein risk subgroups. Ultimately, the validation of protein-coding genes was confirmed by utilizing an online database and implementing quantitative real-time PCR (qRT-PCR).

Results: The patients were divided into two risk categories based on prognostic proteins, and notable disparities in both overall survival (OS) and progression free interval (PFI) were observed between the two groups. The OS was more unfavorable in the high-risk group, and there was a noteworthy disparity in the level of immune infiltration observed between the two groups. In addition, the nomogram showed high accuracy in predicting survival in KIRC patients.

Conclusion: In this research, we elucidated the core proteins associated with prognosis in terms of survival prediction, immunotherapeutic response, somatic mutation, and immune microenvironment. Additionally, we have developed a reliable prognostic model with excellent predictive capabilities.

Proteomics
Transcriptomics
Renal clear cell carcinoma
Prognostic signature
tumor microenvironment
==== Body
pmcIntroduction

Renal cancer is the most frequently occurring tumor of the urinary system1, and also has the highest mortality rate in urological tumors2. Around 85% of tumors in the kidneys are renal cell carcinomas, with about 70% being clear cell carcinomas of the kidney. Renal cell carcinoma (RCC) makes up around 3.8% of all newly diagnosed cancers, typically affecting individuals at a median age of 64 years3. However, those with distant metastases experience a significantly lower 5-year survival rate of 0% to 10%4. Despite the utilization of molecularly targeted treatments like inhibitors of tyrosine kinase and rapamycin for advanced renal cancer5, 6, finding a solution to enhance the OS and progression-free survival (PFS) of patients remains a Gordian knot. Constructing novel prognostic models could weigh better treatment modalities based on patient conditions to maximize clinical benefit and provide novel insights for precision medicine treatment decisions.

Proteins, as important mediators in biological processes and also responsible for the gene coding functions of cells, are demonstrated as a nexus with tumorigenesis and progression7. In most research, protein expression data are replaced by RNA sequencing data, but often with poor expected results8. To bridge the gap between genomic data and functional proteins, it is necessary to utilize proteomics and convert this information9. Recently, proteomic studies have enhanced insights into the biological basis and prognostic assessment of KIRC and revealed potential therapeutic targets10, 11. Therefore, further proteomic studies in KIRC, especially biomarker discovery, could provide novel prognostic molecular markers and effective treatment to win the war against KIRC.

For this research, we conducted transcriptomic and proteomic examinations from the TCGA-KIRC data. Comprehensive data analyses revealed different proteomic isoforms of KIRC, and a seven-protein-based prognostic model was constructed by linking the proteomic features of KIRC to clinical outcomes. In addition, we analyzed the relationship of protein prognostic models with immune infiltration and immune microenvironment. These results may provide a basis for predicting the outcome and therapeutic effects of KIRC.

Materials and methods

Data acquisition

The proteomic data, RNA-seq data, and clinical data of KIRC were downloaded from the genomic data commons (GDC) website. Missing values in the protein expression data were interpolated using the "impute" R package, and expression values for the same protein were averaged. For RNA-seq data, genes with overall low expression were removed and expression values for the same genes were averaged. For clinical data, patients with missing essential data were removed. The clinical characteristics of these samples are detailed in Supplementary Table S1.

Screening and validation of model proteins

The "caret" R package was used to randomly divide 474 patients into training and test groups according to 5:5. Proteins that showed a significant correlation with prognosis were identified through COX regression analysis (p<0.01) in the training group. Subsequently, proteins were selected from the pool of prognosis-related proteins using least absolute shrinkage and selection operator (LASSO) regression. In the end, a multivariate COX regression model was built and the proteins for the final model were obtained through stepwise regression. Risk scores were calculated after screening the modeled proteins using the following formula: , where k and denote the relative expression level of the protein and the regression coefficient. The sample was divided into two risk groups using the median of the prognostic protein risk score as the cutoff value.

Construction of nomogram

To facilitate the clinical application of prognostic models, we plotted nomogram using the "rms" and "regplot" R packages, along with calibration curves and receiver operating characteristic (ROC) curves.

Consistent cluster analysis of prognostic proteins

The samples were typed according to the expression of prognostic proteins using the "ConsensusClusterPlus" R package, and the number of samples typed was determined according to the optimal K-value.

Immune infiltration analysis, gene set enrichment analysis (GSEA), and tumor immune iysfunction and ixclusion (TIDE)

GSEA analysis was performed using the "clusterProfiler" R package, and GSEA analysis using the “c2.cp.kegg.symbols” gene set downloaded from the molecular signatures database (MSigDB) database. CIBERSORT was utilized to conduct immune infiltration analysis, and a boxplot illustrating the variations in immune cell infiltration among various subgroups was generated. Immunotherapy responses were analyzed using the TIDE website.

Online database to validate expression of prognostic proteins and protein-coding genes

The human protein atlas (HPA) database was utilized to confirm the expression of prototype proteins in both normal and KIRC tissues. Additionally, the tumor immune single-cell hub (TISCH) database was employed to observe the expression of genes encoding proteins in various cell clusters. Furthermore, the cancer single-cell state atlas (CancerSEA) database was utilized to examine the relationship between the function of cancer cells and genes encoding proteins at the individual cell level. The BEST website was utilized to analyze the differential expression of genes.

Cell culture

Human renal cortical proximal tubular epithelial cells (HK-2) and human renal cell adenocarcinoma cells (769-P, 786-O, and ACHN) were used for this study, both provided by Servicebio, Ltd (Wuhan, China). Among them, HK-2 and ACHN were cultured in MEM medium containing 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). 769-P and 786-O were cultured in RPMI 1640 medium containing 10% FBS and 1% P/S in a humidified incubator at 37°C with 5% CO2.

RNA extraction and qRT-PCR

Total RNA was extracted from cells using RNAeasy™ Animal RNA Extraction Kit (RR0026, Beyotime, Shanghai, China). cDNA synthesis was performed using PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, Takara, Beijing, China), and real-time quantitative PCR was performed using TB Green® Premix Ex Taq™ II (RR820A, Takara, Beijing, China). qPCR primers were synthesized by Sangon Biotech, Ltd (Shanghai, China) (Table 1). β-actin was used as a standardized internal reference gene. The relative gene expression levels were calculated using the 2-ΔΔCt method.

Statistical analysis

The prognostic significance was evaluated through Kaplan-Meier (K-M) analysis and COX analysis, comparing groups using the Wilcoxon test for numerical variables and the chi-square test for categorical variables. R4.3.2 was utilized for statistical analyses, with significance defined as p<0.05 unless stated otherwise.

Results

KIRC prognosis-related protein screening

Firstly, we analyzed the proteomics data of TCGA-KIRC, and after screening, we finally obtained 474 valid samples and 36 prognostic proteins that were significantly correlated out of survival (p<0.01) and visualized the results on volcano and forest plots (Figure 1A-B). Subsequently, the LASSO and COX regression model was constructed to further screen prognostic proteins, and the final model identified the best performance when 7 proteins (ACC1, P21, P70S6K_pT389, SMAC, BRAF_pS445, MIG6, PEA15) were identified (Figure 1C-D). Patients were categorized into two groups based on the calculated risk score for each patient using regression coefficients, with the median risk score serving as the cutoff value. Principal component analysis (PCA) found that risk score could cluster samples well (Figure 1E-F).

Prognostic protein model validation

To verify the precision of the model, we also computed the risk scores for the validation group. Next, we conducted a survival analysis on the two groups and illustrated the disparities in survival using K-M curves. To assess the precision of the model, the corresponding ROC graphs were generated. In all cohorts, it was discovered that the high-risk score group had a considerably worse prognosis (Figure 2A-C, G-I). According to the ROC curves, the prognostic protein model exhibited a positive predictive performance for OS and PFI (OS-5 Year: Train Cohort: 0.810, Test Cohort: 0.775, TCGA whole Cohort: 0.788, PFI-5 Year: Train Cohort: 0.784, Test Cohort: 0.721, TCGA Whole Cohort: 0.743, Figure 2D-F, Figure 3A-C). Moreover, we plotted the sample distribution of risk scores for the three cohorts according to subgroups, and the expression of the modeled proteins is shown in the heatmap (Figure 3D-F). Finally, we examined the variations in survival rates among different risk subgroups based on clinical factors. The findings indicated that high-risk patients had unfavorable survival outcomes in subgroups categorized by age (≤ 65 and > 65), gender, tissue Grade levels, clinical stages, and TNM stages (p<0.001, Figure S1A-E). However, the survival differences were not statistically significant in the N1 stage (p=0.082, Figure S1F) and M1 stage (p=0.057, Figure S1G).

Somatic mutation profile of tumor samples

To uncover genetic changes in the subgroups with high and low risks, and understand the connection between genetic mutations and patient survival, we conducted a waterfall plot analysis using copy number variation (CNV) data for TCGA-KIRC (Figure 4A-B). The findings indicated that both subgroups with high and low risk demonstrated elevated rates of mutation. After classifying patients based on the median tumor mutational load (TMB), we observed that the high TMB group exhibited a more unfavorable prognosis compared to the low TMB group (Figure 4C). The final combined survival analysis of TMB grouping and risk score grouping showed that the high TMB and high-risk score group had the most unfavorable prognosis (Figure 4D).

Clinical correlation of prognostic proteins

To further investigate the correlation between the 7 model proteins and the prognosis of KIRC, survival analyses were further performed. The results showed that high expression of SMAC, P21, PEA15, and ACC1 showed a more inferior prognosis (Figure 5B). In contrast, high expression of MIG6, P70S6K_pT389, and BRAF_pS445 showed a favorable prognosis (Figure 5A). This further demonstrated the feasibility of these seven proteins as prognostic markers. Clinical correlation analysis between the two risk subgroups showed that Grade, Stage, T, and M were significantly different between the two subgroups (Figure 5C). Co-expression analysis of the 7 predictive proteins revealed a total of 39 proteins that were significantly co-expressed (r>0.5 and p<0.001) (Figure S2A). The correlation analysis of the 7 prognostic proteins is visualized in the ring diagram (Figure S2B).

Construction of nomogram

To better predict the prognosis of patients with KIRC, we performed uni- and multivariate Cox regression analysis, and the results showed that risk score, Age, Grade, and Stage were significantly correlated with the prognosis (Figure 6A). Subsequently, we utilized these clinical characteristics and risk scores to construct a nomogram. Calculating the total score from the scores of each independent factor in the nomogram could accurately predict the survival of patients (Figure 6B). The nomogram exhibits a promising predictive performance, as indicated by the calibration curves and ROC curves (Figure 6C, D).

Evaluation of prognostically relevant protein subgroups

We performed a consistent clustering analysis based on the expression of model proteins to further identify the subgroups of model proteins. We found that the intra-group correlation was the most obvious and the inter-group correlation was lower when k=2 (Figure 7A-C). Afterward, an analysis of survival was conducted on the two subgroups of prognostic proteins. The results showed that the C1 group had a considerably more favorable prognosis (Figure 7D). Heatmaps illustrate the expression of model proteins and protein-coding genes across various subgroups. (Figure 7E-F).

Immune cell infiltration and immune checkpoint analysis

The examination of the distribution of immune subtypes in prognostic protein groupings, which were categorized into six subtypes in previous studies, revealed that the high-risk group had a higher prevalence of C1 (healing of wounds), C2 (dominated by IFN-g), C4 (depleted of lymphocytes), and C6 (dominated by TGF-b). Additionally, the low-risk group had a higher percentage of C3 (inflammatory) (Fig. 8A). Similar differences were found between prognostic protein C1 and C2 subgroups (Figure 8B). Immune infiltration analysis of transcriptomic data using CIBERSORT and MCPcounter showed significant differences in both risk subgroups and protein subgroups (p<0.05, Figure 7C-F). According to the tumor micro-environment (TME) analysis, the high-risk group exhibited considerably elevated immune scores (p < 0.05, Figure 8C). Additionally, the stromal scores of the C1 subgroup were significantly higher than those of the C2 subgroup (p<0.001, Figure 8D). TIDE analysis showed a high percentage of immunotherapy nonresponse in high-risk patients and the C2 subgroup (Figure S1H).

Meanwhile, notable variations in immune checkpoint manifestation were observed among the two risk groups as well as the protein subgroups (p<0.05, Figure 8G, H). In the high-risk group, GSEA revealed enrichment of complement and coagulation cascades, cytokine receptor interaction, ECM receptor interaction, hematopoietic cell lineage, and p53 signaling pathway (Figure 9A). In addition, fatty acid metabolism, neurotrophic protein signaling pathways, propionic acid metabolism, type II diabetes, and valine, leucine, and isoleucine degradation pathways were enriched in the low-risk group (Figure 9B). Figure 9C shows that the prognostic protein C1 subgroup had enriched pathways including focal adhesion, interaction of neuroactive ligands and receptors, neurotrophin signaling pathway, pathways related to cancer, and contraction of vascular smooth muscle. In Figure 9D, the complement and coagulation cascades, oxidative phosphorylation, steroid hormone biosynthesis, and vibrio cholerae infection pathways were found to be more abundant in the C2 subgroup.

The relationship between the expression of prognostic protein-coding genes and prognosis

We performed a survival analysis of these seven genes, which showed that all seven genes were significantly associated with prognosis, with high expression of DIABLO (encodes the SMAC protein) and ACACA (encodes the ACC1 protein) showing worse prognosis, while low expression of PEA15 (encodes the PEA15 protein), CDKN1A (encodes P21 protein), ERRFI1 (which encodes MIG6 protein), RPS6KB1 (encodes the P70S6K_pT389 protein) and BRAF (encodes the BRAF_pS445 protein), showed worse prognosis (p<0.05, Figure 10A-B). To examine the predictive effect of the seven protein-coding genes on prognosis, we constructed the Cox proportional hazards model using these seven genes. The survival analysis indicated that the model built using these seven genes exhibited outstanding predictive ability. K-M survival analysis showed worse prognostic performance in the high-risk score group (p<0.05, Figure 10C-D). Analysis of 47 immune checkpoints revealed that 32 of these immune checkpoint genes exhibited distinct expression patterns (p<0.05, Figure 10E). The analysis of ESTIMATE showed that the immune score and stromal score were higher in the high-risk group (p<0.05, Figure 10F).

Analysis of prognostic protein-coding genes using online databases

We examined the HPA database to analyze the expression of protein-coding genes. The results indicated that ACACA exhibited low expression in KIRC tissues, while BRAF, CDKN1A, DIABLO, PEA15, and RPS6KB1 showed high expression in KIRC tissues (Figure 11). To examine the variations in gene expression across various cell profiles, we utilized the TISCH database's KIRC_GSE111360 and KIRC_GSE159115 datasets to detect the expression levels of protein-coding genes (Figure 12A-B). The correlation between protein-coding genes and the functional status of tumor cells was analyzed using the CancerSEA database. The results revealed that ACACA was negatively correlated with the cell cycle (r=-0.35, p<0.05, Figure 12C), CDKN1A was positively associated with metastasis (r=0.33, p<0.01, Figure 12D), RPS6KB1 was negatively related to invasion (r=-0.38, p<0.001, Figure 12E), BRAF was positively linked to Stemness (r =0.39, p<0.001, Figure 12F), ERRFI1 was positively connected to epithelial-mesenchymal transition (EMT) (r=0.51, p<0.01, Figure 12G), and PEA15 was positively correlated with Quiescence (r=0.43, p< 0.01, Figure 12H).

Verification of protein-coding genes by qRT-PCR

We analyzed the differences in expression of seven protein-coding genes between tumor and normal samples at the BEST website (Figure 13A-B). To further investigate the manifestation of these seven protein-encoding genes in cellular models, we analyzed their presence in four different cell lines, namely HK-2, ACHN, 786-O, and 769-P, through the utilization of qRT-PCR. The results show that BRAF, CDKN1A, DIABLO, PEA15, ERRFI1, and RPS6KB1 are highly expressed in tumor cell lines, which is the same as in the TCGA database. Nevertheless, the cellular expression of ACACA varied from that observed in TCGA, potentially due to the disparity in sample size (Figure 13C).

Discussion

KIRC has an insidious onset, is heterogeneous, and is insensitive to conventional radiotherapy12, 13. Partial or radical nephrectomy is the primary approach for treating non-metastatic KIRC. After undergoing surgical treatment, around 25%~50% of patients still experience either local recurrence or distant metastasis14-16. At present, focused immunotherapies are employed for advanced renal cancer that has spread to distant areas17, although the effectiveness of these treatments for KIRC patients remains restricted18. In this particular situation, healthcare professionals require more accurate biological indicators to establish risk categorization for anticipating patient prognosis and response to immunotherapy, as well as to offer direction for clinical diagnosis and treatment.

By conducting survival analysis and LASSO on the training cohort, we developed a prognostic model that consists of seven proteins. The model's predictive performance was validated in the test cohort, showcasing its exceptional accuracy. Furthermore, the nomogram was developed to forecast survival by amalgamating the risk scores of the prognostic proteins with clinical factors including age, gender, tumor stage, and grading.

Earlier studies on the proteomic characterization of KIRC have demonstrated a strong association between proteomics and the tumor immune microenvironment. These studies have also revealed that distinct immune subtypes exhibit diverse clinical characteristics, prognoses, and responses to treatment10. Hence, we conducted analyses on immune cell infiltration and immune checkpoint expression in various risk groups and subtype subgroups, revealing noteworthy disparities among the different subgroups. Analysis of prognostic protein subtypes also indicated that the C1 cluster exhibited a significantly more favorable prognosis compared to the C2 cluster. There are also studies showing that the Pearson correlation between protein and mRNA data was higher than 0.75 in immune and stromal-derived features19. Hence, we additionally conducted a survival assessment on predictive protein-coding genes and developed a reliable prognostic model using them, demonstrating strong predictive accuracy.

There are often intrinsic mechanisms underlying the prognostic differences between risk groups20, and our GSEA results showed significant enrichment of complement and coagulation cascades, cytokine receptor interactions, ECM receptor interactions, hematopoietic cell lineage, and p53 signaling pathway in the high-risk group. Activation of the complement system and coagulation cascade in the tumor microenvironment promotes inflammatory response and tumor progression21, 22. Cytokine receptor interactions regulate immune responses and inflammatory processes23, while ECM receptor interactions play a key role in tumor growth and metastasis24, and finally, p53 is an important tumor suppressor gene25, which suggests that dysfunction of p53 may be present in the high-risk group, and that the above results may be associated with a poorer prognosis in the high-risk group. In contrast, the low-risk group was significantly enriched in metabolism-related signaling pathways, suggesting that the metabolic status of patients in the low-risk group may be associated with their better prognosis26. We suggest further studies to determine whether these pathways may serve as new therapeutic targets or biomarkers.

Among the prognostic protein-coding genes, ACACA played a crucial role in lipid metabolism as a significant enzyme and as a key enzyme in regulating the initial production of fatty acids 27. Bioactive lipids could promote or inhibit the development and metastasis of renal cancer by regulating the stability and transcriptional activity of HIF-2α, thus affecting the proliferation, migration, angiogenesis, immune escape, and other processes of renal cancer cells28, 29. It has been shown that ACACA-induced lipid synthesis and lipid accumulation led to hepatocellular carcinoma progression30, whereas inhibition of ACACA similarly inhibited hepatocellular carcinoma progression31. The research focused on ACACA and kidney cancer has not made significant advancements. However, compounds that inhibit lipid absorption or transportation have demonstrated anti-cancer effects in laboratory and animal studies. Furthermore, a number of these medications have progressed to clinical trials 32. The p21 protein, encoded by the gene CDKN1A, interacted with a variety of proteins involved in cell cycle inhibition, as well as cell differentiation, and migration, thereby acting as an oncogenic or pro-oncogenic agent33, 34. Up-regulation of P21 signaling or p21 mRNA stability was found to inhibit the growth of KIRC 35, 36. Immunohistochemical analysis of tissue microarrays from 366 KIRC patients showed that p21 might contribute to prognosis and play different biological functions in limited and metastatic renal cell carcinoma37. The RPS6KB1 gene encodes ribosomal protein S6 kinase (p70S6K), which is used to control cell survival, proliferation, and metabolism through the PI3K/mTOR signaling pathway38. Several studies have shown that p70S6K is associated with the pathophysiology of various tumors such as prostate and colorectal cancers39-41. Smac was a pro-apoptotic mitochondrial protein, and phospholipid metabolism and phosphatidylethanolamine synthesis regulated by Smac and phosphatidylethanolamine interactions were critical for cancer cell proliferation42, 43. Studies have demonstrated that patients with RCC who exhibited low levels of Smac expression had a fourfold increase in the risk of death compared to patients with high expression44.

BRAF functioned as a serine/threonine kinase that played a role in controlling the MAPK signaling pathway. BRAF was mutated in a variety of cancers, leading to aberrant activation of the signaling pathway. Currently, the FDA has approved small molecule inhibitors that target BRAF for the treatment of advanced melanoma and non-small cell lung cancer45, 46. ERRFI1 acts as a suppressor of EGFR by directly attaching to EGFR, restraining the enzymatic function of EGFR, and facilitating the degradation of EGFR in lysosomes47. Research has indicated that ERRFI1 is significant in the development of lung cancer, endometrial cancer, and breast cancer48. PEA15 was widely expressed in breast cancer, and studies have shown that PEA15 dephosphorylation might be associated with breast cancer progression and drug resistance49, 50.

Although our model exhibits excellent predictive performance, there are still certain constraints in our research. Our study was based on the analysis and validation of data collected through public databases, the inclusion of corresponding external validation data may give better results, and prospective studies are needed to further evaluate the model. Moreover, it is crucial to conduct thorough functional experiments to clarify the interrelated mechanisms of the seven prognostic proteins.

Conclusion

In general, we created a proteomics-driven framework that can forecast the outlook, immune surroundings, and medication reactions of patients with KIRC. The model relies on 7 prognostic proteins and clinical factors. The model's potential for reliable prognostic prediction in KIRC was demonstrated through validation against the HPA database and qRT-PCR experiments.

Supplementary Material

Supplementary figures and table.

Funding

This work was supported by the National Natural Science Foundation of China (Grant numbers [82000724]).

Data availability

Public data used in this work can be acquired from the TCGA Research Network portal, the HPA database, the TISCH database, CancerSEA database and the TIDE database.

Author contributions

Guangyang Cheng: Writing - review & editing, Writing - original draft, Methodology, Data curation, Software. Zhaokai Zhou: Writing - review & editing, Investigation, Visualization. Shiqi Li: Writing - review & editing, Validation. Zhuo Ye: Writing - review & editing. Yan Wang: Writing - review & editing. Jianguo Wen: Writing - review & editing, Resources. Chuanchuan Ren: Writing - review & editing, Resources, Supervision.

Abbreviations

KIRC Kidney clear cell carcinoma

TCGA The Cancer Genome Atlas Program

qRT-PCR Quantitative Real-time PCR

OS Overall survival

PFI Progression Free Interval

RCC Renal cell carcinoma

PFS Progression-free survival

GDC Genomic Data Commons

LASSO Least absolute shrinkage and selection operator

ROC Receiver Operating Characteristic

GSEA Gene set enrichment analysis

TIDE Tumor Immune Dysfunction and Exclusion

HPA Human Protein Atlas

TISCH Tumor Immune Single-cell Hub

CancerSEA Cancer Single-cell State Atlas

FBS Fetal bovine serum

P/S Penicillin-streptomycin

K-M Kaplan-Meier

PCA Principal component analysis

CNV Copy number variation

TMB Tumor mutational load

CDF Cumulative Distribution Function

TME Tumor micro-environment

EMT Epithelial-Mesenchymal Transition

Figure 1 KIRC prognosis-related protein screening. A: COX regression analysis of protein prognostic volcano plots. B: Forest plot of prognostic-related proteins. C-D: Results of LASSO regression analysis and cross-validation. E-F: PCA analysis of risk scores. (***p<0.001).

Figure 2 KIRC prognosis-related protein survival analysis. A-C: K-M survival curves for OS between the two groups in the training, test, and overall groups. D-F: ROC curves predicting OS in the training, test, and overall groups. G-I: K-M survival curves for PFI between the two groups in the training, test, and overall groups.

Figure 3 Distribution of risk score. A-C: Predicted ROC curves for PFI in the training, test, and overall groups. D-F: Distribution of risk scores across cohorts.

Figure 4 Somatic mutation analysis and survival analysis of model proteins in two risk subgroups. A-B: Gene mutations in the two risk subgroups. C: K-M survival curves for OS between high and low TMB groups. D: K-M survival curves for OS between the two TMB groups and the two risk groups.

Figure 5 Survival analysis and interaction analysis of seven prognosis-related proteins. A: K-M survival curves between SMAC, P21, PEA15, and ACC1 expression and OS. B: K-M survival curves between MIG6, P70S6K_pT389, and BRAF_pS445 expression and OS. C: Correlation between the two risk score groups and clinical factors.

Figure 6 Nomogram construction and performance tests. A: Uni-variate and multi-variate COX regression analysis of clinical factors and risk score. B: Nomogram for predicting patient survival. C: Calibration curves for nomogram. D: Nomogram of ROC curves for OS prediction.

Figure 7 Consistency clustering analysis of prognostic proteins. A: Consistency clustering analysis cumulative distribution function (CDF) curve. B: K-means algorithm. C: Unsupervised clustering of seven model proteins and optimal consensus matrix with k = 2. D: Survival analysis of two prognostic protein subgroups. E-F: Heatmaps depicting the expression patterns of seven model proteins and protein-coding genes in two prognostic protein subgroups.

Figure 8 Immune infiltrates and subtypes of prognostic protein subgroups. A: Distribution of immune subtypes in risk subgroups. B: Immunosubtype distribution of prognostic protein subgroups C1 and C2. C: Divergences in the ratio of CIBERSORT immune cell infiltrations and TME scores among risk subgroups. D: Differences in proportions of CIBERSORT immune cell infiltration and TME scores for prognostic protein C1 and C2 subgroups. E: Divergences in the ratio of MCPcounter immune cell penetration among risk subgroups. F: The difference in the proportion of MCPcounter immune cell infiltration between prognostic protein C1 and C2 subgroups. G: Variations in the expression of immune checkpoint molecules among risk subgroups. H: Differences in immune checkpoint expression between prognostic protein C1 and C2 subgroups. (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

Figure 9 GSEA analysis of prognostic protein groupings. A-B: GSEA analysis of risk subgroups. C-D: GSEA analysis of protein subgroups.

Figure 10 Survival analysis of TCGA-KIRC prognostic protein-encoding genes. A-B: K-M survival curves of prognostic protein-encoding genes for survival analysis. C: K-M survival curves and ROC curves for OS survival analysis for protein-coding genes. D: K-M survival curves and ROC curves for PFI survival analysis for protein-coding genes. E: Differential evaluation of immune checkpoint expression for risk subgroups of protein-coding genes. F: Analysis of immune infiltration in risk subgroups of protein-coding genes. (*p<0.05, **p<0.01, ***p<0.001, ****p<0.0001).

Figure 11 Expression of prognostic protein-encoding genes in tumor tissues and normal tissues in the HPA database. A: ACACA. B: BRAF. C: CDKN1A. D: DIABLO. E: PEA15. F: RPS6KB1.

Figure 12 TISCH database and CancerSEA database analysis of protein-coding genes. A: Gene expression from the KIRC-GSE111360 dataset in the TISCH database. B: Gene expression from the KIRC-GSE159115 dataset in the TISCH database. C-H: Correlation of prognostic protein-encoding genes with cancer cell functional status at the single-cell level.

Figure 13 qRT-PCR of seven protein-coding genes. A: Gene expression from the TCGA-KIRC dataset in the BEST website. B: Gene expression from the GSE167573 dataset in the BEST website. C: Expression of seven protein-coding genes in cell lines examined by qRT-PCR.

Table 1 Primers for qRT-PCR.

Gene	Forward Primer Sequence (5' to 3')	Reverse Primer Sequence (5' to 3')	
ERRFI1	GGGCAGGGTATCCATTCT	TCCCTCAACAAGACGCA	
RPS6KB1	ATATTTGCCATGAAGGTGCT	CGATGAAGGGATGCTTTACT	
CDKN1A	CTGGCCCCTCAAATCGT	CCGCTGCTAATCAAAGTGC	
ACACA	GAAGGGGTTTTCACTGTCC	GAGGATCGTATGGGGTCTT	
BRAF	CAAATTCTCACCAGTCCGT	GGTCTCGTTGCCCAAAT	
ACTB	TCTCCCAAGTCCACACAGG	GGCACGAAGGCTCATCA	
PEA15	TGAGGAGGATGAGCTGGA	GGGAGTGGTCTGATGAAGG	
DIABLO	CCTACCTGCGTGAGGATTG	GGATCTGCCGCCTCTTC
==== Refs
1 Znaor A Lortet-Tieulent J Laversanne M Jemal A Bray F International variations and trends in renal cell carcinoma incidence and mortality Eur Urol 2015 67 519 30 25449206
2 Dy GW Gore JL Forouzanfar MH Naghavi M Fitzmaurice C Global Burden of Urologic Cancers, 1990-2013 Eur Urol 2017 71 437 46 28029399
3 Motzer RJ Jonasch E Agarwal N Alva A Baine M Beckermann K Kidney Cancer, Version 3.2022, NCCN Clinical Practice Guidelines in Oncology J Natl Compr Canc Netw 2022 20 71 90 34991070
4 Linehan WM Schmidt LS Crooks DR Wei D Srinivasan R Lang M The Metabolic Basis of Kidney Cancer Cancer Discov 2019 9 1006 21 31088840
5 Escudier B Eisen T Stadler WM Szczylik C Oudard S Staehler M Sorafenib for treatment of renal cell carcinoma: Final efficacy and safety results of the phase III treatment approaches in renal cancer global evaluation trial J Clin Oncol 2009 27 3312 8 19451442
6 Motzer RJ Escudier B Oudard S Hutson TE Porta C Bracarda S Efficacy of everolimus in advanced renal cell carcinoma: a double-blind, randomised, placebo-controlled phase III trial Lancet 2008 372 449 56 18653228
7 Nusinow DP Szpyt J Ghandi M Rose CM McDonald ER 3rd Kalocsay M Quantitative Proteomics of the Cancer Cell Line Encyclopedia Cell 2020 180 387 402 e16 31978347
8 Liu Y Beyer A Aebersold R On the Dependency of Cellular Protein Levels on mRNA Abundance Cell 2016 165 535 50 27104977
9 Tan HT Lee YH Chung MCM Cancer proteomics Mass Spectrometry Reviews 2012 31 583 605 22422534
10 Qu Y Feng J Wu X Bai L Xu W Zhu L A proteogenomic analysis of clear cell renal cell carcinoma in a Chinese population Nat Commun 2022 13 2052 35440542
11 Clark DJ Dhanasekaran SM Petralia F Pan J Song X Hu Y Integrated Proteogenomic Characterization of Clear Cell Renal Cell Carcinoma Cell 2019 179 964 83 e31 31675502
12 Blanco AI Teh BS Amato RJ Role of radiation therapy in the management of renal cell cancer Cancers (Basel) 2011 3 4010 23 24213122
13 Li Y Lih TM Dhanasekaran SM Mannan R Chen L Cieslik M Histopathologic and proteogenomic heterogeneity reveals features of clear cell renal cell carcinoma aggressiveness Cancer Cell 2023 41 139 63 e17 36563681
14 Ghatalia P Gordetsky J Kuo F Dulaimi E Cai KQ Devarajan K Prognostic impact of immune gene expression signature and tumor infiltrating immune cells in localized clear cell renal cell carcinoma J Immunother Cancer 2019 7 139 31138299
15 Janzen NK Kim HL Figlin RA Belldegrun AS Surveillance after radical or partial nephrectomy for localized renal cell carcinoma and management of recurrent disease Urol Clin North Am 2003 30 843 52 14680319
16 Jian Y Yang K Sun X Zhao J Huang K Aldanakh A Current Advance of Immune Evasion Mechanisms and Emerging Immunotherapies in Renal Cell Carcinoma Front Immunol 2021 12 639636 33767709
17 Barata PC Rini BI Treatment of renal cell carcinoma: Current status and future directions CA Cancer J Clin 2017 67 507 24 28961310
18 Hsieh JJ Le VH Oyama T Ricketts CJ Ho TH Cheng EH Chromosome 3p Loss-Orchestrated VHL, HIF, and Epigenetic Deregulation in Clear Cell Renal Cell Carcinoma J Clin Oncol 2018 36 JCO2018792549 30372397
19 Clark DJ Dhanasekaran SM Petralia F Pan J Song X Hu Y Integrated Proteogenomic Characterization of Clear Cell Renal Cell Carcinoma Cell 2020 180 207 31923397
20 Wang J Ling S Ni J Wan Y Novel gammadelta T cell-based prognostic signature to estimate risk and aid therapy in hepatocellular carcinoma BMC Cancer 2022 22 638 35681134
21 Wang MJ Sun Y Song Y Ma JN Wang ZQ Ding XQ Mechanism and Molecular Targets of Ejiao Siwu Decoction for Treating Primary Immune Thrombocytopenia Based on High-Performance Liquid Chromatograph, Network Pharmacology, Molecular Docking and Cytokines Validation Front Med (Lausanne) 2022 9 891230 35911404
22 Wang Y Miao X Jiang Y Wu Z Zhu X Liu H The synergistic antitumor effect of IL-6 neutralization with NVP-BEZ235 in hepatocellular carcinoma Cell Death Dis 2022 13 146 35165269
23 Xie B Li K Zhang H Lai G Li D Zhong X Identification and validation of an immune-related gene pairs signature for three urologic cancers Aging (Albany NY) 2022 14 1429 47 35143414
24 Kakkassery V Gemoll T Kraemer MM Sauer T Tura A Ranjbar M Protein Profiling of WERI-RB1 and Etoposide-Resistant WERI-ETOR Reveals New Insights into Topoisomerase Inhibitor Resistance in Retinoblastoma Int J Mol Sci 2022 23 4058 35409416
25 Richardson JS Sethi G Lee GS Malek SN Chalepin: isolated from Ruta angustifolia L. Pers induces mitochondrial mediated apoptosis in lung carcinoma cells BMC Complement Altern Med 2016 16 389 27729078
26 Liu T Chen L Gao G Liang X Peng J Zheng M Development of a Gene Risk Signature for Patients of Pancreatic Cancer J Healthc Eng 2022 2022 4136825 35035831
27 Hunkeler M Hagmann A Stuttfeld E Chami M Guri Y Stahlberg H Structural basis for regulation of human acetyl-CoA carboxylase Nature 2018 558 470 4 29899443
28 Stepanovska Tanturovska B Manaila R Fabbro D Huwiler A Lipids as Targets for Renal Cell Carcinoma Therapy Int J Mol Sci 2023 24 3272 36834678
29 Heravi G Yazdanpanah O Podgorski I Matherly LH Liu W Lipid metabolism reprogramming in renal cell carcinoma Cancer Metastasis Rev 2022 41 17 31 34741716
30 Peng JY Cai DK Zeng RL Zhang CY Li GC Chen SF Upregulation of Superenhancer-Driven LncRNA FASRL by USF1 Promotes De Novo Fatty Acid Biosynthesis to Exacerbate Hepatocellular Carcinoma Adv Sci (Weinh) 2022 10 e2204711 36307901
31 Lally JSV Ghoshal S DePeralta DK Moaven O Wei L Masia R Inhibition of Acetyl-CoA Carboxylase by Phosphorylation or the Inhibitor ND-654 Suppresses Lipogenesis and Hepatocellular Carcinoma Cell Metab 2019 29 174 82 e5 30244972
32 Jeong DW Lee S Chun YS How cancer cells remodel lipid metabolism: strategies targeting transcription factors Lipids Health Dis 2021 20 163 34775964
33 Xiong Y Hannon GJ Zhang H Casso D Kobayashi R Beach D p21 is a universal inhibitor of cyclin kinases Nature 1993 366 701 4 8259214
34 Kreis NN Louwen F Yuan J The Multifaceted p21 (Cip1/Waf1/CDKN1A) in Cell Differentiation, Migration and Cancer Therapy Cancers (Basel) 2019 11 1220 31438587
35 Zhu L Wang J Kong W Huang J Dong B Huang Y LSD1 inhibition suppresses the growth of clear cell renal cell carcinoma via upregulating P21 signaling Acta Pharm Sin B 2019 9 324 34 30972280
36 Di J Wang H Zhao Z Zhao G Qin X Han Z CPEB4 Inhibit Cell Proliferation via Upregulating p21 mRNA Stability in Renal Cell Carcinoma Front Cell Dev Biol 2021 9 687253 34976999
37 Weiss RH Borowsky AD Seligson D Lin PY Dillard-Telm L Belldegrun AS p21 is a prognostic marker for renal cell carcinoma: implications for novel therapeutic approaches J Urol 2007 177 63 8 discussion 8-9 17162001
38 Bahrami BF Ataie-Kachoie P Pourgholami MH Morris DL p70 Ribosomal protein S6 kinase (Rps6kb1): an update J Clin Pathol 2014 67 1019 25 25100792
39 An HJ Park M Kim J Han YH miR-5191 functions as a tumor suppressor by targeting RPS6KB1 in colorectal cancer Int J Oncol 2019
40 Cai C Chen QB Han ZD Zhang YQ He HC Chen JH miR-195 Inhibits Tumor Progression by Targeting RPS6KB1 in Human Prostate Cancer Clin Cancer Res 2015 21 4922 34 26080838
41 Wang-Bishop L Chen Z Gomaa A Lockhart AC Salaria S Wang J Inhibition of AURKA Reduces Proliferation and Survival of Gastrointestinal Cancer Cells With Activated KRAS by Preventing Activation of RPS6KB1 Gastroenterology 2019 156 662 75 e7 30342037
42 Pandey SK Paul A Shteinfer-Kuzmine A Zalk R Bunz U Shoshan-Barmatz V SMAC/Diablo controls proliferation of cancer cells by regulating phosphatidylethanolamine synthesis Mol Oncol 2021 15 3037 61 33794068
43 Arbiser JL Diablo: A Double-Edged Sword in Cancer? Mol Ther 2018 26 678 9 29472100
44 Martinez-Ruiz G Maldonado V Ceballos-Cancino G Grajeda JP Melendez-Zajgla J Role of Smac/DIABLO in cancer progression J Exp Clin Cancer Res 2008 27 48 18822137
45 Zaman A Wu W Bivona TG Targeting Oncogenic BRAF: Past, Present, and Future Cancers (Basel) 2019 11
46 El-Nassan HB Recent progress in the identification of BRAF inhibitors as anti-cancer agents Eur J Med Chem 2014 72 170 205 24424304
47 Cui M Liu D Xiong W Wang Y Mi J ERRFI1 induces apoptosis of hepatocellular carcinoma cells in response to tryptophan deficiency Cell Death Discov 2021 7 274 34608122
48 Xu D Li C Gene 33/Mig6/ERRFI1, an Adapter Protein with Complex Functions in Cell Biology and Human Diseases Cells 2021 10 1574 34206547
49 Li L Wang N Xiong Y Guo G Zhu M Gu Y Transcription Factor FOSL1 Enhances Drug Resistance of Breast Cancer through DUSP7-Mediated Dephosphorylation of PEA15 Mol Cancer Res 2022 20 515 26 34907034
50 Park J Tacam MJ Chauhan G Cohen EN Gagliardi M Iles LR Nonphosphorylatable PEA15 mutant inhibits epithelial-mesenchymal transition in triple-negative breast cancer partly through the regulation of IL-8 expression Breast Cancer Res Treat 2021 189 333 45 34241740
