
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

39227948
4191
10.1186/s12917-024-04191-9
Research
Tryptophan regulates the expression of IGFBP1 in bovine endometrial epithelial cells in vitro via the TDO2-AHR pathway
Wang Peng-Chao wpc@sxau.edu.cn

1
Liu Ze-Kun 1
Li Jia-Rong 1
Zhao Zi-Hui 1
Chang Qian-Wen 1
Guo Xiao-Min 1
Jin Lin 1
Hu Yong-Ting 1245728338@qq.com

1
Yang Zhenshan zhenshan.yang@med.lu.se

2
1 https://ror.org/05e9f5362 grid.412545.3 0000 0004 1798 1300 College of Veterinary Medicine, Shanxi Agricultural University, Taigu, 030801 China
2 https://ror.org/012a77v79 grid.4514.4 0000 0001 0930 2361 Division of Oncology, Department of Clinical Sciences Lund, Lund University, Lund, 22381 Sweden
4 9 2024
4 9 2024
2024
20 39027 4 2024
15 7 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

This study aimed to identify the roles of L-tryptophan (Trp) and its rate-limiting enzymes on the receptivity of bovine endometrial epithelial cells. Real-time PCR was conducted to analyze the differential expression of genes between different groups of bovine endometrial epithelial cells. Western blot was performed to detect Cyclooxygenase-2 (COX2) expression after treatment with Trp or kynurenine (the main metabolites of Trp). The kynurenine assay was used to examine if Trp or prostaglandin E2 (PGE2) can increase the production of kynurenine in the bovine endometrial epithelial cells.

Results

Trp significantly stimulates insulin growth factor binding protein 1 (IGFBP1) expression, a common endometrial marker of conceptus elongation and uterus receptivity for ruminants. When bovine endometrial epithelial cells are treated with Trp, tryptophan hydroxylase-1 remains unchanged, but tryptophan 2,3-dioxygenase 2 (TDO2) is significantly increased, suggesting tryptophan is mainly metabolized through the kynurenine pathway. Kynurenine significantly stimulates IGFBP1 expression. Furthermore, Trp and kynurenine significantly increase the expression of aryl hydrocarbon receptor (AHR). CH223191, an AHR inhibitor, abrogates the induction of Trp and kynurenine on IGFBP1. PGE2 significantly induces the expression of TDO2, AHR, and IGFBP1.

Conclusions

The regulation between Trp / kynurenine and PGE2 may be crucial for the receptivity of the bovine uterus.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12917-024-04191-9.

Keywords

Bovine
Kynurenine
PGE2
Tryptophan
Uterine receptivity
the Fundamental Research Program of Shanxi ProvinceNo. 202203021222172 the University Science and Technology Innovation Project of the Shanxi ProvinceNo. 2021L170 Shanxi Province Excellent Doctoral Work Award-Scientific Research ProjectNo. SXBYKY2021040 the Science and Technology Innovation Program of Shanxi Agricultural UniversityNo. 2021BQ05 issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcBackground

The success rate of fertilization in ruminants after mating or artificial insemination is high. However, the birth rate was significantly lower due to embryo loss and embryo implantation failure in early pregnancy [1]. Conceptus implantation is a process of conceptus-endometrium crosstalk during early pregnancy [2–5]. Receptive endometrium is essential for conceptus implantation and successful pregnancy [4]. Scientists explored some genes as potential early pregnancy diagnostic markers in the endometrium. Insulin growth factor binding proteins (IGFBPs) are likely to play an essential role in regulating a uterine environment that promotes the growth and development of the conceptus to implantation [6, 7]. IGFBP1, one of the mammalian IGFBPs family, is a standard endometrial marker of uterine receptivity and conceptus elongation for ruminants [8]. PGE2 plays a pivotal role in endometrial receptivity [9]. Furthermore, PGE2 participated in the growth and elongation of the ruminant conceptus [10]. However, there is poorly defined information underlying the molecular mechanism of PGE2 in regulating uterine receptivity and endometrial epithelial cell markers in ruminants.

Adequate maternal nutrition is vital for embryonic development and maternal fertility [11–13]. As nutrients, various amino acids are taken from the maternal uterus to promote conceptus growth during bovine early pregnancy [14]. Tryptophan (Trp), as a nutrient and essential amino acid, is involved in protein synthesis and many critical physiological functions, including decidualization, embryo immune tolerance, and fetal growth [15–17]. Only 5% Trp is formed to serotonin (5-HT) by tryptophan hydroxylase 1 (TPH1) in the 5-hydroxytryptamine pathway during tryptophan metabolism [16]. 95% tryptophan is metabolized to kynurenine through the rate-limiting enzyme of indoleamine 2,3-dioxygenase (IDO) and tryptophan 2,3-dioxygenase (TDO) in the kynurenine pathway [17]. As a ligand, kynurenine can bind and activate aryl hydrocarbon receptors (AHR) and induce tolerance [16, 18]. However, the regulation and function of tryptophan and kynurenine for uterus receptivity are still poorly understood. AHR is regulated by progesterone and estradiol in the uterus [19]. Moreover, AHR regulates the embryo’s nourishment and maintains pregnancy [20]. The mechanisms by which the AHR regulates bovine uterus receptivity are poorly unknown.

This study examined the effects of tryptophan and kynurenine on bovine endometrial epithelial cells. Our data indicated that tryptophan and kynurenine promote IGFBP1 expression to enhance endometrial receptivity via PGE2-TDO2-AHR signaling.

Results

IGFBP1 expression in the bovine endometrial tissue

We first used real-time PCR to detect IGFBP1 mRNA in the bovine uteri of repeat breeder and normal. As a marker of potential ruminant endometrial [8], IGFBP1 mRNA abundances were remarkably greater for normal cows than repeat breeder cows in endometrial (Fig. 1).

Fig. 1 Comparison of IGFBP1 mRNA isolated from repeat breeder and healthy bovine in uterus endometrium. *P < 0.05. Data were normalized with GAPDH

Effect of Tryptophan treatment on the expression of IGFBP1 in bEECs

To investigate whether tryptophan affects the gene that regulates endometrial receptivity processes in cattle, we treated bEECs with tryptophan. We found that IGFBP1, a reliable marker for bovine in uterine receptivity [8], was remarkably upregulated by tryptophan (Fig. 2A). To explore the tryptophan metabolism, we examined TPH1 (a key enzyme for the serotonin pathway) and IDO1 /TDO2 (key rate-limiting enzymes for the kynurenine pathway) in tryptophan-treated cells. After epithelial cells were treated with tryptophan, TPH1 mRNA remained unchanged (Fig. 2B). The mRNA levels of IDO1 and TDO2 were significantly increased (Fig. 2C and D), suggesting that tryptophan may be mainly metabolized to kynurenine. As an amino acid transporter, solute carrier family 7 member 5 (SLC7A5) could transport tryptophan from the extracellular to the intracellular of the cell [21]. In the cattle, expression of SLC7A5 was increased in the endometrium as the estrous cycle [22]. So, we wonder whether tryptophan affects the expression of SLC7A5. Our results suggested that SLC7A5 expression was significantly stimulated by tryptophan (Fig. 2E). Kynurenine concentration was also increased in the tryptophan treatment group (Fig. 2F). These data may suggest that tryptophan may be transported to the intracellular by SLC7A5 and metabolized through the kynurenine pathway in bEECs.

Fig. 2 Effects of Tryptophan in bEECs. (A) The level of IGFBP1 mRNA. (B) The level of TPH1 mRNA. (C) The level of IDO1 mRNA. (D) The level of TDO2 mRNA. (E) The level of SLC7A5 mRNA. (F) Kynurenine concentration. *P < 0.05. Every experiment was repeated at least thrice independently. Con, control; Trp, tryptophan

Effect of kynurenine on the endometrial receptivity in bEECs

As a critical tryptophan metabolite, kynurenine is AHR’s endogenous ligand and the most robust activator in the kynurenine pathway [21]. BEECs were treated with kynurenine. IGFBP1 expression was significantly upregulated by kynurenine (Fig. 3A). Kynurenine could promote AHR expression (Fig. 3B). Meanwhile, kynurenine treatment also upregulated CYP1B1 of the AHR target gene (Fig. 3B). Furthermore, tryptophan could stimulate the expression of AHR and CYP1B1 (Fig. 3C).

Fig. 3 Effects of tryptophan metabolites in bEECs. (A) The level of IGFBP1 mRNA after bEECs were treated with kynurenine. (B) The mRNA levels of AHR and CYP1B1 after treatment with kynurenine. (C) The mRNA levels of AHR and CYP1B1 after treatment with Tryptophan. *P < 0.05. Every experiment was repeated at least thrice independently. Con, control; Kyn, L-kynurenine; Trp, tryptophan

Effect of tryptophan/kynurenine on the AHR pathway in bEECs

We investigated the role of the AHR in tryptophan-induced IGFBP1 by suppressing AHR with the specific AHR inhibitor CH223191. Treatment with the AHR inhibitor CH223191 significantly reduced the effect of tryptophan on IGFBP1 expression (Fig. 4A). CH223191 treatment also reduced the mRNA levels of AHR and CYP1B1 (Fig. 4B). Similarly, CH223191 abolished the effect of kynurenine on the expression of IGFBP1, AHR, and CYP1B1(Fig. 4C and D). CH223191 did not affect the expression of IGFBP1 and AHR alone, while it decreased the expression of CYP1B1 (Fig. 4E–G). We also checked the expression of TPH1, IDO1, TDO2, SLC7A5, AHR, and CYP1B1 in the bovine uteri of healthy and repeat breeders. All these genes were decreased in the repeat breeder compared with healthy bovine (Supplementary material 2). Taken together, these findings indicated that tryptophan and kynurenine regulated IGFBP1 expression by activating the AHR pathway.

PGE2 regulated the expression of IGFBP1 through the AHR pathway

COX2 plays a vital regulatory role during implantation and development of the conceptus in ovine and bovine [23–25]. As a biomarker for embryonic implantation, PGE2 may be involved in regulating endometrial receptivity, blastocyst expansion, and developmental competence during the window of implantation [25, 26]. To determine whether PGE2 alters uterus receptivity, we measured the level of IGFBP1 in bEECs. PGE2 stimulated IGFBP1 expression (Fig. 5A). However, PGE2-induced IGFBP1 was inhibited by CH223191 (Fig. 5A). PGE2 treatment also increased the expression of AHR and CYP1B1, which was remarkably suppressed by CH223191 (Fig. 5B, C). These data suggested that PGE2-induced IGFBP1 promotes uterus receptivity through activating the AHR pathway.

Fig. 4 Effects of tryptophan and kynurenine on AHR and its target genes in bEECs. (A) The level of IGFBP1 mRNA after treatment with tryptophan and CH223191. (B) The mRNA levels of AHR and CYP1B1 after treatment with tryptophan and CH223191. (C) The level of IGFBP1 mRNA after treatment with kynurenine and CH223191. (D) The mRNA levels of AHR and CYP1B1 after treatment with kynurenine and CH223191. (E-G) IGFBP1, AHR, and CYP1B1 mRNA levels after treatment with CH223191. *P < 0.05. Every experiment was repeated at least thrice independently. Con, control; Kyn, kynurenine; Trp, tryptophan; CH223191, AHR inhibitor

Fig. 5 Effects of PGE2 on AHR pathway in bEECs. (A) Effects of CH223191 on PGE2-induced IGFBP1. (B) Effects of CH223191 on PGE2-induced AHR expression. (C) Effects of CH223191 on PGE2-induced CYP1B1 expression. *P < 0.05. Every experiment was repeated at least thrice independently. Con, control; CH223191, AHR inhibitor

The regulatory relationship between PGE2 and tryptophan-kynurenine pathway

We next investigated whether a relationship existed between PGE2 and the tryptophan-kynurenine pathway, which regulated each other. IDO1 was slightly upregulated, but TDO2 mRNA level was significantly increased by PGE2 (Fig. 6A, B). Meanwhile, kynurenine concentration was increased dramatically by PGE2 (Fig. 6C). Tryptophan treatment upregulated the expression of COX2 and microsomal prostaglandin E synthase (mPGES1) (Fig. 6D, F, and G). Similarly, kynurenine treatment also increased the expression of COX2 and mPGES1 (Fig. 6E–G). These data suggested that PGE2 might promote tryptophan metabolism toward kynurenine production through increasing expression TDO2 and IDO1, which kynurenine may return increased COX2 and mPGES1 to promote PGE2 secretion.

Fig. 6 The regulation between PGE2 and tryptophan-kynurenine pathway. (A) The level of IDO1 mRNA after treatment with PGE2. (B) The level of TDO2 mRNA after treatment with PGE2. (C) Kynurenine concentration after treatment with PGE2. (D) The level of mPGES1 mRNA after treatment with tryptophan. (E) The level of mPGES1 mRNA after treatment with kynurenine. (F, G) The COX2 protein level after treatment with tryptophan and kynurenine. *P < 0.05. Every experiment was repeated at least thrice independently. Con, control; Kyn, kynurenine; Trp, tryptophan

Discussion

IGFBP1 stimulates endometrial receptivity to implantation of the conceptus [8]. The IGFBP1 mRNA was detected in the luminal epithelium and expressed higher during bovine early pregnancy [6]. The IGFBP expression was lesser for repeat breeder cows with subclinical endometritis than normal cows [27]. Similarly, our study showed that IGFBP1 expression is higher in normal cow uteri compared with repeat breeders. As a uterine receptivity marker, IGFBP1 low expression may be the reason for repeat breeder cow syndrome. Furthermore, PGE2 promotes the growth and elongation of the ruminant conceptus in a paracrine manner [10]. In this study, PGE2 enhanced IGFBP1 expression to promote endometrial receptivity. Thus, embryo implantation and fertility are improved and maintained during bovine early pregnancy.

Repeat breeder cows repeatedly fail to be pregnant at least three or more times despite the absence of apparent anatomical abnormalities, normal estrous cycles, or infectious diseases [28]. Nutritional deficiencies, especially Trp deficiencies, can affect the reproductive process in repeat breeder cows [28, 29]. Tryptophan increases the demand for maternal protein synthesis and fetal requirements during pregnancy [15]. Furthermore, the tryptophan content of uterine luminal fluid is stable and increased through the neutral amino acid transporter SLC7A5 during the peri-implantation period of normal pregnancy in cattle [22]. Meanwhile, higher SLC7A5 expression is mounting up transfer tryptophan in the endometrium of the estrous cycle and early pregnancy [22]. Although tryptophan and its metabolites are involved in the maintenance of pregnancy [30], the underlying role is still unclear. This study showed that uterus receptivity may be enhanced by tryptophan and kynurenine via the AHR pathway. Abnormal tryptophan metabolism may affect maternal-fetal interface’s immune tolerance in pregnancy [18]. The lower levels of IDO expression and kynurenine in repeat breeder cows may result in tryptophan catabolism disorder and subfertility [29]. Blocking the IDO enzyme that catabolizes tryptophan along the kynurenine may reduce trophoblast cell proliferation and migration [31]. AHR deletion may be insufficient to support the hormone synthesis needed during pregnancy and lactation, resulting in reproductive deficiencies in AHR −/− mice [32]. Moreover, AHR was activated by kynurenine and participated in human decidualization during early pregnancy [33]. Therefore, the tryptophan/kynurenine-AHR pathway plays a role in the capacity of the uterus to support pregnancy maintenance.

During the early pregnancy of the mouse, AHR expression was detected in implanted blastocysts and surrounding luminal epithelia and decidual cells [34]. AHR localization was distinct in the endometrium of pregnant compared with non-pregnant rabbits. In pregnant uteri, AHR was found in the whole cytoplasm and nuclei of endometrial epithelial cells, while AHR was only localized in a small cytoplasmic area in non-pregnant rabbits [35]. These may indicate the functional role of AHR in embryonic implantation and uterus receptivity. In porcine, Trp mediates the proliferation of trophectoderm cells by activating the AHR signaling pathway [36]. Kynurenine encourages the NK cytotoxic cells by AHR signal during early pregnancy [37]. Furthermore, Trp and kynurenine activate AHR signaling to stimulate decidualization during human early pregnancy [16]. In our study, Trp and kynurenine also stimulated the AHR pathway to promote IGFBP1 in bovine endometrial epithelial cells.

PGE2 is involved in every aspect of mammalian female fertility, including ovulation, fertilization, blastocyst implantation, and development [38]. PGE2 was mediated decidualization through PTGER2-dependent PKA activation in vitro human endometrial fibroblasts [39, 40]. Furthermore, PGE2 is involved in maternal recognition of pregnancy in the pig [41]. PGE2 stimulates progesterone-induced IGFBP1 to promote trophectoderm cell migration and attachment in sheep uterus during early pregnancy [42]. PGE2 upregulates TDO-mediated kynurenine release in human malignant glioma [43]. In our study, PGE2 also stimulated TDO2 to promote IGFBP1 expression and increase uterine receptivity in bovine.

Conclusion

In conclusion, our data indicate that tryptophan regulates the expression of IGFBP1 in bovine endometrial epithelial cells via the PGE2-TDO2-AHR pathway. Meanwhile, PGE2 upregulated kynurenine secretion, stimulating IGFBP1 expression to increase uterus receptivity in bovine.

Methods

Bovine endometrial tissue collection

The Institutional Animal Care and Use Committee of Shanxi Agricultural University reviewed and approved the animal study (SXAU–EAW–2022B.ZT.012005154). Holstein cows housed at a large commercial dairy farm in Jinzhong, Shanxi in China, were used. All animal experiments are conducted in compliance with the ARRIVE guidelines. The present study used healthy cows (4–10 years old, average 600 kg) and repeat breeder cows (4–8 years old, average 620 kg). All animals were fed a total mixed ratio, including hay, silage, and a multivitamin integrator three times a day. The growing environment and feeding management conditions are the same. All were subjected to at least three artificial inseminations. The healthy cows were pregnant and delivered previously. Repeat breeder cows did not become pregnant after three or more breeding attempts, although they have normal estrous cycles. Endometrial tissues from this experiment (healthy (n = 10) and repeat breeder cows (n = 12)) were collected at the local abattoir.

Culture and treatment of bovine endometrial epithelial cells

Bovine endometrial epithelial cell line (bEEC, ATCC® CRL-2398™) was obtained from ATCC (Manassas, VA). Frozen bEEC cells were resuscitated onto 100 mm plates and cultured with DMEM-F12 containing 10% FBS and 10% horse serum at 37℃ with 5% CO2. bEEC cells were used in experiments in passages 3–7.

Cells (5*105 / plate) were treated with reagents (tryptophan, 500µM; kynurenine, 500µM; PGE2, 20 µM) in 12-well plates for 48 h. For the AHR inhibition study, We preincubated bEEC cells with CH223191 (5µM) for 1 h before the treatment.

Real-time PCR

Real-time PCR was conducted to analyze the differential expression of genes as previously described [44]. Tissues and cells were extracted to isolate total RNAs with Trizol reagent (TaKaRa, China). The RNAs (62.5 ng/µL) were reversed transcribed into cDNAs with the NovoScript®Plus All-in-one 1st Strand cDNA Synthesis SuperMix (Novoprotein, China). ChamQ SYBR qPCR Master Mix (Vazyme Biotech, China) was used for Real-time PCR on the CFX96 Touch Real-Time PCR Detection System (Bio-Rad, USA). The primer sequences in this study are listed in Table 1. The gene expression data of Real-Time PCR were employed to analyze relative changes using the − 2 ΔΔCT method and normalized to GAPDH [45]. Statistical analysis was conducted and followed by the MIQE guidelines [46].

Table 1 Primers used in this study

Gene	Primer sequences (5’-3’)	Accession number	Size(bp)	
IGFBP1	AGCAGCAGAAGGCAGGAGACAA	NM_174554.3	126	
	AGACACACCAACAGAGCCCAGG			
IDO1	CGCAGCCCAAAGCAGCATCT	NM_001101866.2	134	
	TGTGGTGAGCTGGTGGCATGTA			
TDO2	GATCACCCGAATGCACCGAGTG	NM_001046313.1	85	
	GTCCAAGGCTGTCATGGTCTCC			
TPH1	CCAACCCATGCTTGCAGAGAGT	XM_005216077.4	150	
	GTAACCAGCCACAGGACGGATG			
SLC7A5	TGGAGTGTGGCATCGGCTTCA	NM_174613.2	125	
	CTGGCACAGGACCGTCGTAGAA			
AHR	TAAGCCTGCCTTCGGGTGTTCA	NM_001206026.1	144	
	TGCTGCTGCTGCTCCACTGT			
GAPDH	ACGGCACAGTCAAGGCAGAGA	NM_001034034.2	120	
	CCACCACATACTCAGCACCAGC			
CYP1B1	GACTTGACAGGCAGCGTGATGG	NM_001192294.2	111	
	GCACTGGTGAGCAAGGATGGAG			
mPGES1	CCAAGTGAGGCTGCGGAAGAAG	NM_174443.2	98	
	AGCGTTCCACATCTGGGTCGTT			

Western blot

Western blot was performed as previously described [47]. Briefly, treated cells were lysed in the RIPA lysis buffer (150 mM NaCl, 50 mM Tris-HCl, pH 7.5, 2 mM Na3VO4, 0.25% sodium deoxycholate, 1 mM NaF, 1% Triton X-100 and complete protease inhibitor cocktail [Roche]). Protein lysates (10 µg) were electrophoresed using 10% SDS-PAGE gel and transferred onto PVDF membranes. Then, membranes were blocked with 5% non-fat milk and incubated with rabbit anti-COX2 primary (1:2000; Abcam, ab179800, Cambridge, MA, USA) antibody or rabbit anti-ACTB primary antibody (1:2000; Abcam, ab8226, Cambridge, MA, USA) overnight. After the membranes were incubated with HRP-conjugated secondary antibody (1:5000, Invitrogen), we detected the signals by ECL kit.

Kynurenine assay

Kynurenine was measured as previously described [16]. The supernatant of tryptophan-treated cultures was incubated with 30% trichloroacetic acid for 30 min at 50 °C. Then, the supernatant was mixed with an equal volume of freshly Ehrlich reagent (2% p-dimethylaminobenzaldehyde in glacial acetic acid) and incubated for 15 min. The absorbance was measured at 492 nm and normalized with a calibration curve obtained with L-kynurenine.

Statistical analysis

All results of the experiments were repeated at least three times independently, except for in vivo study. All analyses were performed using the GraphPad Prism® 5.0 software (GraphPad Software Inc., San Diego, CA). The data were presented as the mean ± standard deviation. Statistical comparisons between the two groups were conducted using Student’s t-test. For multiple comparisons, a one-way ANOVA followed by Tukey post hoc test was performed. Significance was set at P < 0.05.

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Author contributions

Peng-Chao Wang: Conceptualization, Data curation, Formal analysis, Funding acquisition, Methodology, Supervision, Visualization, Writing - original draft, Writing - review & editing. Ze-Kun Liu and Jia-Rong Li: Investigation, Validation, Writing - original draft. Xiao-Min Guo and Zi-Hui Zhao: Methodology, Visualization, Writing - original draft. Lin Jin and Qian-Wen Chang: Software, Supervision, Writing - original draft. Yong-Ting Hu and Zhenshan Yang: Visualization, Supervision, Writing - original draft; and Writing - review & editing.

Funding

This work was supported by the Fundamental Research Program of Shanxi Province (Grant No. 202203021222172), the University Science and Technology Innovation Project of the Shanxi Province (Grant No. 2021L170), the Shanxi Province Excellent Doctoral Work Award-Scientific Research Project (Grant No. SXBYKY2021040) and the Science and Technology Innovation Program of Shanxi Agricultural University (Grant No. 2021BQ05).

Data availability

All data generated or analyzed during this study are included in this published article.

Declarations

Ethics approval and consent to participate

All cow protocols were approved by the Institutional Animal Care and Use Committee of Shanxi Agricultural University.

Consent for publication

We confirm that the manuscript has been read and approved by all named authors. We further confirm that the order of authors listed in the manuscript has been approved by all of us.

Competing interests

The authors declare no competing interests.

Abbreviations

Trp L-tryptophan

IGFBP1 Insulin growth factor binding protein 1

TDO2 tryptophan 2, 3-dioxygenase 2

AHR Aryl hydrocarbon receptor

IGFBPs Insulin growth factor binding proteins

PGE2 Prostaglandin E2

5-HT Serotonin

TPH1 Tryptophan hydroxylase 1

IDO Indoleamine 2,3-dioxygenase

TDO Tryptophan 2,3-dioxygenase

bEEC Bovine endometrial epithelial cell line

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Diskin M Morris D Embryonic and early foetal losses in cattle and other ruminants Reprod Domest Anim 2008 43 260 7 10.1111/j.1439-0531.2008.01171.x 18638133
Diskin M, Morris D. Embryonic and early foetal losses in cattle and other ruminants. Reprod Domest Anim. 2008;43:260–7.18638133 10.1111/j.1439-0531.2008.01171.x
2. Wang PC Chen ST Yang ZM Effects of Aurora kinase A on mouse decidualization via Stat3-plk1-cdk1 pathway Reproductive Biology Endocrinol 2021 19 1 162 10.1186/s12958-021-00847-5
Wang PC, Chen ST, Yang ZM. Effects of Aurora kinase A on mouse decidualization via Stat3-plk1-cdk1 pathway. Reproductive Biology Endocrinol. 2021;19(1):162.10.1186/s12958-021-00847-5
3. Forde N Lonergan P Interferon-tau and fertility in ruminants Reproduction 2017 154 5 F33 43 10.1530/REP-17-0432 28887326
Forde N, Lonergan P. Interferon-tau and fertility in ruminants. Reproduction. 2017;154(5):F33–43.28887326 10.1530/REP-17-0432
4. Davenport KM Ortega MS Johnson GA Seo H Spencer TE Review: implantation and placentation in ruminants Animal 2023 17 Suppl 1 100796 10.1016/j.animal.2023.100796 37567669
Davenport KM, Ortega MS, Johnson GA, Seo H, Spencer TE. Review: implantation and placentation in ruminants. Animal. 2023;17(Suppl 1):100796.37567669 10.1016/j.animal.2023.100796
5. Spencer TE Johnson GA Bazer FW Burghardt RC Palmarini M Pregnancy recognition and conceptus implantation in domestic ruminants: roles of progesterone, interferons and endogenous retroviruses Reprod Fertil Dev 2007 19 1 65 78 10.1071/RD06102 17389136
Spencer TE, Johnson GA, Bazer FW, Burghardt RC, Palmarini M. Pregnancy recognition and conceptus implantation in domestic ruminants: roles of progesterone, interferons and endogenous retroviruses. Reprod Fertil Dev. 2007;19(1):65–78.17389136 10.1071/RD06102
6. Robinson RS Mann GE Gadd TS Lamming GE Wathes DC The expression of the IGF system in the bovine uterus throughout the oestrous cycle and early pregnancy J Endocrinol 2000 165 2 231 43 10.1677/joe.0.1650231 10810287
Robinson RS, Mann GE, Gadd TS, Lamming GE, Wathes DC. The expression of the IGF system in the bovine uterus throughout the oestrous cycle and early pregnancy. J Endocrinol. 2000;165(2):231–43.10810287 10.1677/joe.0.1650231
7. McCarthy S Roche J Forde N Temporal changes in endometrial gene expression and protein localization of members of the IGF family in cattle: effects of progesterone and pregnancy Physiol Genom 2012 44 2 130 40 10.1152/physiolgenomics.00106.2011
McCarthy S, Roche J, Forde N. Temporal changes in endometrial gene expression and protein localization of members of the IGF family in cattle: effects of progesterone and pregnancy. Physiol Genom. 2012;44(2):130–40.10.1152/physiolgenomics.00106.2011
8. Simmons R Erikson D Kim J Burghardt R Bazer F Johnson G Spencer T Insulin-like growth factor binding protein-1 in the ruminant uterus: potential endometrial marker and regulator of conceptus elongation Endocrinology 2009 150 9 4295 305 10.1210/en.2009-0060 19497977
Simmons R, Erikson D, Kim J, Burghardt R, Bazer F, Johnson G, Spencer T. Insulin-like growth factor binding protein-1 in the ruminant uterus: potential endometrial marker and regulator of conceptus elongation. Endocrinology. 2009;150(9):4295–305.19497977 10.1210/en.2009-0060
9. Arosh J Banu S Kimmins S Chapdelaine P Maclaren L Fortier M Effect of interferon-tau on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2 Endocrinology 2004 145 11 5280 93 10.1210/en.2004-0587 15308607
Arosh J, Banu S, Kimmins S, Chapdelaine P, Maclaren L, Fortier M. Effect of interferon-tau on prostaglandin biosynthesis, transport, and signaling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2. Endocrinology. 2004;145(11):5280–93.15308607 10.1210/en.2004-0587
10. Sandra O, Charpigny G, Galio L, Hue I. Preattachment embryos of domestic animals: insights into Development and Paracrine secretions. Annu Rev Anim Biosci 2017 5:205–28.
11. Crouse MS McLean KJ Greseth NP Crosswhite MR Pereira NN Ward AK Reynolds LP Dahlen CR Neville BW Borowicz PP Maternal nutrition and stage of early pregnancy in beef heifers: impacts on expression of glucose, fructose, and cationic amino acid transporters in utero-placental tissues J Anim Sci 2017 95 12 5563 72 10.2527/jas2017.1983 29293768
Crouse MS, McLean KJ, Greseth NP, Crosswhite MR, Pereira NN, Ward AK, Reynolds LP, Dahlen CR, Neville BW, Borowicz PP, et al. Maternal nutrition and stage of early pregnancy in beef heifers: impacts on expression of glucose, fructose, and cationic amino acid transporters in utero-placental tissues. J Anim Sci. 2017;95(12):5563–72.29293768 10.2527/jas2017.1983
12. Greseth NP Crouse MS McLean KJ Crosswhite MR Pereira NN Dahlen CR Borowicz PP Reynolds LP Ward AK Neville BW The effects of maternal nutrition on the messenger ribonucleic acid expression of neutral and acidic amino acid transporters in bovine uteroplacental tissues from day sixteen to fifty of gestation J Anim Sci 2017 95 10 4668 76 10.2527/jas2017.1713 29108050
Greseth NP, Crouse MS, McLean KJ, Crosswhite MR, Pereira NN, Dahlen CR, Borowicz PP, Reynolds LP, Ward AK, Neville BW, et al. The effects of maternal nutrition on the messenger ribonucleic acid expression of neutral and acidic amino acid transporters in bovine uteroplacental tissues from day sixteen to fifty of gestation. J Anim Sci. 2017;95(10):4668–76.29108050 10.2527/jas2017.1713
13. Serrano-Pérez B Molina E Noya A López-Helguera I Casasús I Sanz A Villalba D Maternal nutrient restriction in early pregnancy increases the risk of late embryo loss despite no effects on peri-implantation interferon-stimulated genes in suckler beef cattle Res Vet Sci 2020 128 69 75 10.1016/j.rvsc.2019.10.023 31731220
Serrano-Pérez B, Molina E, Noya A, López-Helguera I, Casasús I, Sanz A, Villalba D. Maternal nutrient restriction in early pregnancy increases the risk of late embryo loss despite no effects on peri-implantation interferon-stimulated genes in suckler beef cattle. Res Vet Sci. 2020;128:69–75.31731220 10.1016/j.rvsc.2019.10.023
14. Crouse MS Greseth NP McLean KJ Crosswhite MR Pereira NN Ward AK Reynolds LP Dahlen CR Neville BW Borowicz PP Maternal nutrition and stage of early pregnancy in beef heifers: impacts on hexose and AA concentrations in maternal and fetal fluids1 J Anim Sci 2019 97 3 1296 316 10.1093/jas/skz013 30649334
Crouse MS, Greseth NP, McLean KJ, Crosswhite MR, Pereira NN, Ward AK, Reynolds LP, Dahlen CR, Neville BW, Borowicz PP, et al. Maternal nutrition and stage of early pregnancy in beef heifers: impacts on hexose and AA concentrations in maternal and fetal fluids1. J Anim Sci. 2019;97(3):1296–316.30649334 10.1093/jas/skz013
15. Badawy AA Tryptophan metabolism, disposition and utilization in pregnancy Biosci Rep 2015 35 5 e00261 10.1042/BSR20150197 26381576
Badawy AA. Tryptophan metabolism, disposition and utilization in pregnancy. Biosci Rep. 2015;35(5):e00261.26381576 10.1042/BSR20150197
16. Wang PC Chen ST Hong ZK Li SY Yang ZS Quan S Yang ZM Tryptophan and kynurenine stimulate human decidualization via activating Aryl hydrocarbon receptor Reprod Toxicol 2020 96 282 92 10.1016/j.reprotox.2020.07.011 32781018
Wang PC, Chen ST, Hong ZK, Li SY, Yang ZM. Tryptophan and kynurenine stimulate human decidualization via activating Aryl hydrocarbon receptor. Reprod Toxicol. 2020;96:282–92.32781018 10.1016/j.reprotox.2020.07.011
17. Silvano A Seravalli V Strambi N Cecchi M Tartarotti E Parenti A Tommaso MD Tryptophan metabolism and immune regulation in the human placenta J Reprod Immunol 2021 147 103361 10.1016/j.jri.2021.103361 34365162
Silvano A, Seravalli V, Strambi N, Cecchi M, Tartarotti E, Parenti A, Tommaso MD. Tryptophan metabolism and immune regulation in the human placenta. J Reprod Immunol. 2021;147:103361.34365162 10.1016/j.jri.2021.103361
18. Ott TL. Symposium review: immunological detection of the bovine conceptus during early pregnancy. J Dairy Sci. 2019;102(4):3766–77.
19. Rataj F Möller FJ Jähne M Hönscheid P Zierau O Vollmer G Kretzschmar G Progesterone, as well as 17β-estradiol, is important for regulating AHR battery homoeostasis in the rat uterus Arch Toxicol 2015 89 3 393 404 10.1007/s00204-014-1261-3 24777823
Rataj F, Möller FJ, Jähne M, Hönscheid P, Zierau O, Vollmer G, Kretzschmar G. Progesterone, as well as 17β-estradiol, is important for regulating AHR battery homoeostasis in the rat uterus. Arch Toxicol. 2015;89(3):393–404.24777823 10.1007/s00204-014-1261-3
20. Hernández-Ochoa I Karman BN Flaws JA The role of the aryl hydrocarbon receptor in the female reproductive system Biochem Pharmacol 2009 77 4 547 59 10.1016/j.bcp.2008.09.037 18977336
Hernández-Ochoa I, Karman BN, Flaws JA. The role of the aryl hydrocarbon receptor in the female reproductive system. Biochem Pharmacol. 2009;77(4):547–59.18977336 10.1016/j.bcp.2008.09.037
21. Iizuka T Yin P Zuberi A Kujawa S Coon JS Björvang RD Damdimopoulou P Pacyga DC Strakovsky RS Flaws JA Mono-(2-ethyl-5-hydroxyhexyl) phthalate promotes uterine leiomyoma cell survival through tryptophan-kynurenine-AHR pathway activation Proc Natl Acad Sci USA 2022 119 47 e2208886119 10.1073/pnas.2208886119 36375056
Iizuka T, Yin P, Zuberi A, Kujawa S, Coon JS, Björvang RD, Damdimopoulou P, Pacyga DC, Strakovsky RS, Flaws JA, et al. Mono-(2-ethyl-5-hydroxyhexyl) phthalate promotes uterine leiomyoma cell survival through tryptophan-kynurenine-AHR pathway activation. Proc Natl Acad Sci USA. 2022;119(47):e2208886119.36375056 10.1073/pnas.2208886119
22. Forde N Simintiras CA Sturmey R Mamo S Kelly AK Spencer TE Bazer FW Lonergan P Amino acids in the uterine luminal fluid reflects the temporal changes in transporter expression in the endometrium and conceptus during early pregnancy in cattle PLoS ONE 2014 9 6 e100010 10.1371/journal.pone.0100010 24960174
Forde N, Simintiras CA, Sturmey R, Mamo S, Kelly AK, Spencer TE, Bazer FW, Lonergan P. Amino acids in the uterine luminal fluid reflects the temporal changes in transporter expression in the endometrium and conceptus during early pregnancy in cattle. PLoS ONE. 2014;9(6):e100010.24960174 10.1371/journal.pone.0100010
23. Kim S Choi Y Spencer TE Bazer FW Effects of the estrous cycle, pregnancy and interferon tau on expression of cyclooxygenase two (COX-2) in ovine endometrium Reprod Biol Endocrinol 2003 1 58 10.1186/1477-7827-1-58 12956885
Kim S, Choi Y, Spencer TE, Bazer FW. Effects of the estrous cycle, pregnancy and interferon tau on expression of cyclooxygenase two (COX-2) in ovine endometrium. Reprod Biol Endocrinol. 2003;1:58.12956885 10.1186/1477-7827-1-58
24. Gómez E Caamaño JN Bermejo-Alvarez P Díez C Muñoz M Martín D Carrocera S Gutiérrez-Adán A Gene expression in early expanded parthenogenetic and in vitro fertilized bovine blastocysts J Reprod Dev 2009 55 6 607 14 10.1262/jrd.09-077M 19700929
Gómez E, Caamaño JN, Bermejo-Alvarez P, Díez C, Muñoz M, Martín D, Carrocera S, Gutiérrez-Adán A. Gene expression in early expanded parthenogenetic and in vitro fertilized bovine blastocysts. J Reprod Dev. 2009;55(6):607–14.19700929 10.1262/jrd.09-077M
25. Saint-Dizier M Guyader-Joly C Charpigny G Grimard B Humblot P Ponter AA Expression of enzymes involved in the synthesis of prostaglandin E2 in bovine in vitro-produced embryos Zygote 2011 19 3 277 83 10.1017/S0967199410000596 21232167
Saint-Dizier M, Guyader-Joly C, Charpigny G, Grimard B, Humblot P, Ponter AA. Expression of enzymes involved in the synthesis of prostaglandin E2 in bovine in vitro-produced embryos. Zygote. 2011;19(3):277–83.21232167 10.1017/S0967199410000596
26. Vilella F Ramirez L Berlanga O Martínez S Alamá P Meseguer M Pellicer A Simón C PGE2 and PGF2α concentrations in human endometrial fluid as biomarkers for embryonic implantation J Clin Endocrinol Metab 2013 98 10 4123 32 10.1210/jc.2013-2205 23979956
Vilella F, Ramirez L, Berlanga O, Martínez S, Alamá P, Meseguer M, Pellicer A, Simón C. PGE2 and PGF2α concentrations in human endometrial fluid as biomarkers for embryonic implantation. J Clin Endocrinol Metab. 2013;98(10):4123–32.23979956 10.1210/jc.2013-2205
27. Kasimanickam R Kasimanickam V Kastelic JP Mucin 1 and cytokines mRNA in endometrium of dairy cows with postpartum uterine disease or repeat breeding Theriogenology 2014 81 7 952 e958952 10.1016/j.theriogenology.2014.01.018 24576715
Kasimanickam R, Kasimanickam V, Kastelic JP. Mucin 1 and cytokines mRNA in endometrium of dairy cows with postpartum uterine disease or repeat breeding. Theriogenology. 2014;81(7):952–e958952.24576715 10.1016/j.theriogenology.2014.01.018
28. Pérez-Marín CC Quintela LA Current insights in the repeat Breeder cow syndrome Animals 2023 13 13 2187 10.3390/ani13132187 37443985
Pérez-Marín CC, Quintela LA. Current insights in the repeat Breeder cow syndrome. Animals. 2023;13(13):2187.37443985 10.3390/ani13132187
29. Funeshima N Miura R Katoh T Yaginuma H Kitou T Yoshimura I Konda K Hamano S Shirasuna K Metabolomic profiles of plasma and uterine luminal fluids from healthy and repeat breeder Holstein cows BMC Vet Res 2021 17 1 54 10.1186/s12917-021-02755-7 33509174
Funeshima N, Miura R, Katoh T, Yaginuma H, Kitou T, Yoshimura I, Konda K, Hamano S, Shirasuna K. Metabolomic profiles of plasma and uterine luminal fluids from healthy and repeat breeder Holstein cows. BMC Vet Res. 2021;17(1):54.33509174 10.1186/s12917-021-02755-7
30. Murthi P Wallace EM Walker DW Altered placental tryptophan metabolic pathway in human fetal growth restriction Placenta 2017 52 62 70 10.1016/j.placenta.2017.02.013 28454699
Murthi P, Wallace EM, Walker DW. Altered placental tryptophan metabolic pathway in human fetal growth restriction. Placenta. 2017;52:62–70.28454699 10.1016/j.placenta.2017.02.013
31. Zong S Li C Luo C Zhao X Liu C Wang K Jia W Bai M Yin M Bao S Dysregulated expression of IDO may cause unexplained recurrent spontaneous abortion through suppression of trophoblast cell proliferation and migration Sci Rep 2016 6 19916 10.1038/srep19916 26814137
Zong S, Li C, Luo C, Zhao X, Liu C, Wang K, Jia W, Bai M, Yin M, Bao S, et al. Dysregulated expression of IDO may cause unexplained recurrent spontaneous abortion through suppression of trophoblast cell proliferation and migration. Sci Rep. 2016;6:19916.26814137 10.1038/srep19916
32. Pocar P Fischer B Klonisch T Hombach-Klonisch S Molecular interactions of the aryl hydrocarbon receptor and its biological and toxicological relevance for reproduction Reproduction 2005 129 4 379 89 10.1530/rep.1.00294 15798013
Pocar P, Fischer B, Klonisch T, Hombach-Klonisch S. Molecular interactions of the aryl hydrocarbon receptor and its biological and toxicological relevance for reproduction. Reproduction. 2005;129(4):379–89.15798013 10.1530/rep.1.00294
33. Luo JM Zhang TT He YY Luo HN Hong YQ Yang ZM Human chorionic gonadotropin-stimulated Interleukin-4-Induced-1 (IL4I1) promotes human decidualization via Aryl Hydrocarbon Receptor Int J Mol Sci 2023 24 4 3163 10.3390/ijms24043163 36834576
Luo JM, Zhang TT, He YY, Luo HN, Hong YQ, Yang ZM. Human chorionic gonadotropin-stimulated Interleukin-4-Induced-1 (IL4I1) promotes human decidualization via Aryl Hydrocarbon Receptor. Int J Mol Sci. 2023;24(4):3163.36834576 10.3390/ijms24043163
34. Kitajima M Khan KN Fujishita A Masuzaki H Koji T Ishimaru T Expression of the arylhydrocarbon receptor in the peri-implantation period of the mouse uterus and the impact of dioxin on mouse implantation Arch Histol Cytol 2004 67 5 465 74 10.1679/aohc.67.465 15781987
Kitajima M, Khan KN, Fujishita A, Masuzaki H, Koji T, Ishimaru T. Expression of the arylhydrocarbon receptor in the peri-implantation period of the mouse uterus and the impact of dioxin on mouse implantation. Arch Histol Cytol. 2004;67(5):465–74.15781987 10.1679/aohc.67.465
35. Hasan A Fischer B Hormonal control of arylhydrocarbon receptor (AhR) expression in the preimplantation rabbit uterus Anat Embryol (Berl) 2001 204 3 189 96 10.1007/s004290100209 11681798
Hasan A, Fischer B. Hormonal control of arylhydrocarbon receptor (AhR) expression in the preimplantation rabbit uterus. Anat Embryol (Berl). 2001;204(3):189–96.11681798 10.1007/s004290100209
36. Xu K Fu Y Gao H Bai M Liu H Duan Y L-Tryptophan activates the aryl hydrocarbon receptor and induces cell cycle arrest in porcine trophectoderm cells Theriogenology 2021 171 137 46 10.1016/j.theriogenology.2021.05.012 34058506
Xu K, Fu Y, Gao H, Bai M, Liu H, Duan Y. L-Tryptophan activates the aryl hydrocarbon receptor and induces cell cycle arrest in porcine trophectoderm cells. Theriogenology. 2021;171:137–46.34058506 10.1016/j.theriogenology.2021.05.012
37. Yang SL Tan HX Niu TT Li DJ Wang HY Li MQ Kynurenine promotes the cytotoxicity of NK cells through aryl hydrocarbon receptor in early pregnancy J Reprod Immunol 2021 143 103270 10.1016/j.jri.2020.103270 33421663
Yang SL, Tan HX, Niu TT, Li DJ, Wang HY, Li MQ. Kynurenine promotes the cytotoxicity of NK cells through aryl hydrocarbon receptor in early pregnancy. J Reprod Immunol. 2021;143:103270.33421663 10.1016/j.jri.2020.103270
38. Niringiyumukiza JD Cai H Xiang W Prostaglandin E2 involvement in mammalian female fertility: ovulation, fertilization, embryo development and early implantation Reproductive Biology Endocrinol 2018 16 1 43 10.1186/s12958-018-0359-5
Niringiyumukiza JD, Cai H, Xiang W. Prostaglandin E2 involvement in mammalian female fertility: ovulation, fertilization, embryo development and early implantation. Reproductive Biology Endocrinol. 2018;16(1):43.10.1186/s12958-018-0359-5
39. Stadtmauer DJ Wagner GP Single-cell analysis of prostaglandin E2-induced human decidual cell in vitro differentiation: a minimal ancestral deciduogenic signal Biol Reprod 2022 106 1 155 72 10.1093/biolre/ioab183 34591094
Stadtmauer DJ, Wagner GP. Single-cell analysis of prostaglandin E2-induced human decidual cell in vitro differentiation: a minimal ancestral deciduogenic signal. Biol Reprod. 2022;106(1):155–72.34591094 10.1093/biolre/ioab183
40. Fitzgerald HC Kelleher AM Ranjit C Schust DJ Spencer TE Basolateral secretions of human endometrial epithelial organoids impact stromal cell decidualization Mol Hum Reprod 2023 29 4 gaad007 10.1093/molehr/gaad007 36821428
Fitzgerald HC, Kelleher AM, Ranjit C, Schust DJ, Spencer TE. Basolateral secretions of human endometrial epithelial organoids impact stromal cell decidualization. Mol Hum Reprod. 2023;29(4):gaad007.36821428 10.1093/molehr/gaad007
41. Waclawik A Jabbour HN Blitek A Ziecik AJ Estradiol-17beta, prostaglandin E2 (PGE2), and the PGE2 receptor are involved in PGE2 positive feedback loop in the porcine endometrium Endocrinology 2009 150 8 3823 32 10.1210/en.2008-1499 19359378
Waclawik A, Jabbour HN, Blitek A, Ziecik AJ. Estradiol-17beta, prostaglandin E2 (PGE2), and the PGE2 receptor are involved in PGE2 positive feedback loop in the porcine endometrium. Endocrinology. 2009;150(8):3823–32.19359378 10.1210/en.2008-1499
42. Dorniak P Bazer FW Wu G Spencer TE Conceptus-derived prostaglandins regulate endometrial function in sheep Biol Reprod 2012 87 1 9 10.1095/biolreprod.112.100487 22517622
Dorniak P, Bazer FW, Wu G, Spencer TE. Conceptus-derived prostaglandins regulate endometrial function in sheep. Biol Reprod. 2012;87(1):9.22517622 10.1095/biolreprod.112.100487
43. Ochs K Ott M Rauschenbach KJ Deumelandt K Sahm F Opitz CA von Deimling A Wick W Platten M Tryptophan-2,3-dioxygenase is regulated by prostaglandin E2 in malignant glioma via a positive signaling loop involving prostaglandin E receptor-4 J Neurochem 2016 136 6 1142 54 10.1111/jnc.13503 26708701
Ochs K, Ott M, Rauschenbach KJ, Deumelandt K, Sahm F, Opitz CA, von Deimling A, Wick W, Platten M. Tryptophan-2,3-dioxygenase is regulated by prostaglandin E2 in malignant glioma via a positive signaling loop involving prostaglandin E receptor-4. J Neurochem. 2016;136(6):1142–54.26708701 10.1111/jnc.13503
44. Wang PC Yang ZS Gu XW Effect of Aurora kinase B on polyploidy and decidualization in mouse uterus Am J Reprod Immunol 2023 90 5 e13793 10.1111/aji.13793 37881124
Wang PC, Yang ZS, Gu XW. Effect of Aurora kinase B on polyploidy and decidualization in mouse uterus. Am J Reprod Immunol. 2023;90(5):e13793.37881124 10.1111/aji.13793
45. Livak KJ Schmittgen TD Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method Methods 2001 25 4 402 8 10.1006/meth.2001.1262 11846609
Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods. 2001;25(4):402–8.11846609 10.1006/meth.2001.1262
46. Bustin SA Benes V Garson JA Hellemans J Huggett J Kubista M Mueller R Nolan T Pfaffl MW Shipley GL The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments Clin Chem 2009 55 4 611 22 10.1373/clinchem.2008.112797 19246619
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, et al. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem. 2009;55(4):611–22.19246619 10.1373/clinchem.2008.112797
47. Chen ST Shi WW Lin YQ Yang ZS Wang Y Li MY Li Y Liu AX Hu Y Yang ZM Embryo-derive TNF promotes decidualization via fibroblast activation Elife 2023 12 e82970 10.7554/eLife.82970 37458359
Chen ST, Shi WW, Lin YQ, Yang ZS, Wang Y, Li MY, Li Y, Liu AX, Hu Y, Yang ZM. Embryo-derive TNF promotes decidualization via fibroblast activation. Elife. 2023;12:e82970.37458359 10.7554/eLife.82970
