
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39227650
70769
10.1038/s41598-024-70769-w
Article
Differential effects of hypoxia on motility using various in vitro models of lung adenocarcinoma
Surguta Sára Eszter surguta.sara@ext.oncol.hu

12
Baranyi Marcell 3
Svajda Laura 12
Cserepes Mihály 1
Ranđelović Ivan 1
Tátrai Enikő 1
Hegedűs Balázs 34
Tóvári József 12
1 https://ror.org/02kjgsq44 grid.419617.c 0000 0001 0667 8064 Department of Experimental Pharmacology and the National Tumor Biology Laboratory, National Institute of Oncology, Budapest, 1122 Hungary
2 https://ror.org/01g9ty582 grid.11804.3c 0000 0001 0942 9821 School of Ph.D. Studies, Semmelweis University, Budapest, 1085 Hungary
3 https://ror.org/01g9ty582 grid.11804.3c 0000 0001 0942 9821 Department of Pathology, Forensic and Insurance Medicine, Semmelweis University, Budapest, 1091 Hungary
4 https://ror.org/04mz5ra38 grid.5718.b 0000 0001 2187 5445 Department of Thoracic Surgery, University Medicine Essen - Ruhrlandklinik, University Duisburg-Essen, 45239 Essen, Germany
3 9 2024
3 9 2024
2024
14 2048220 2 2024
21 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Lung cancer is the leading cause of cancer-related death globally. Metastasis is the most common reason of mortality in which hypoxia is suggested to have a pivotal role. However, the effect of hypoxia on the metastatic potential and migratory activity of cancer cells is largely unexplored and warrants detailed scientific investigations. Accordingly, we analyzed changes on cell proliferation and migratory activity both in single-cell migration and invasion under normoxic and hypoxic conditions in lung adenocarcinoma cell lines. Alterations in crucial genes and proteins associated with cellular response to hypoxia, epithelial-mesenchymal transition, proliferation and apoptosis were also analyzed. Generally, we observed no change in proliferation upon hypoxic conditions and no detectable induction of apoptosis. Interestingly, we observed that single-cell motility was generally reduced while invasion under confluent conditions using scratch assay was enhanced by hypoxia in most of the cell lines. Furthermore, we detected changes in the expression of EMT markers that are consistent with enhanced motility and metastasis-promoting effect of hypoxia. In summary, our study indicated cell line-, time of exposure- and migrational type-dependent effects of hypoxia in cellular proliferation, motility and gene expression. Our results contribute to better understanding and tackling cancer metastasis.

Subject terms

Cancer
Lung cancer
Metastasis
http://dx.doi.org/10.13039/501100012550 Nemzeti Kutatási, Fejlesztési és Innovaciós Alap KDP-2020-1018567 Surguta Sára Eszter http://dx.doi.org/10.13039/501100011019 Nemzeti Kutatási Fejlesztési és Innovációs Hivatal TKP2021-EGA-44 Semmelweis UniversityOpen access funding provided by Semmelweis University.

issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Lung cancer is the most common cancer type and the leading cause of death related to cancer worldwide1. Furthermore, despite the advances in lung cancer therapies, 5 year survival rate remains low at 5–15%2. Poor prognosis is largely due to the lack of obvious symptoms in the early stage and consequent late diagnosis of the advanced, metastatic disease3. The most common reason of disease progression and mortality for lung cancer patients is metastasis4. Metastasis is a complex process upon which the malignant cells acquire the ability to migrate from the primary tumor, invade surrounding tissues, enter the circulatory system, and form secondary tumors in distant organs. Studies focusing on tumor progression and metastasis suggest that hypoxia may be an important contributing factor to this process5.

Therefore, investigation of the molecular mechanisms behind the development of lung cancer under hypoxia is crucial to establish more rational therapeutic approaches for the treatment of lung adenocarcinoma (LUAD) patients.

Hypoxia (oxygen deprivation) is a prevalent occurrence in the majority of malignant solid tumors. Several factors influence the oxygen levels in tumors such as tumor size, stage, the heterogeneity of the tumor and the initial oxygenation of the tissue6,7. For example, the median oxygen level of the lung in physoxia is 5.6% O2 whereas the hypoxic tumor tissue of lung cancer patients is between 1.9 and 2.2% O28.

Generally, three types of tumor hypoxia can be distinguished in the tumor microenvironment based on its duration: acute, chronic, and intermittent hypoxia. Although there is a lack of consent in the exact definitions, acute hypoxia can be defined by short-term, less than 24 h of exposure to an environment with 1% O2 or less9. On the other hand, chronic hypoxia is defined by long exposure for more than 48 h to low oxygen levels. Both acute and chronic hypoxia can be observed in an intermittent phase by reoxygenation of hypoxic tissue and hypoxic-oxic cycles10.

Regarding hypoxia-induced molecular changes, a family of transcriptional regulators known as hypoxia-inducible factors (HIFs) were identified as the primary mediators of cellular response to hypoxia three decades ago11. It was found that under hypoxia, HIF-1α accumulate in response to decreased cellular oxygen levels. Conversely, in normoxia they undergo degradation via proteasome12. All three HIF family members—HIF-1, HIF-2, and HIF-3 -13 have the ability to bind to hypoxia-response elements (HREs). This binding activates distinct transcriptional responses, contributing to the regulation of hypoxia signaling and maintaining oxygen homeostasis within cells14,15. One major metastasis-promoting process that can be modulated by hypoxia is the epithelial-mesenchymal transition (EMT). In general, during EMT, cells lose the expression of certain epithelial markers such as E-cadherin, while increasing the expression of mesenchymal markers like N-cadherin or vimentin16,17. Cells that undergo epithelial-mesenchymal transition gain mesenchymal-like behavior, facilitating their migration away from the primary tumor site through various migration strategies18, including multicellular, collective, and single-cell mesenchymal migration19.

Numerous studies aimed to investigate the effects of hypoxia on cell motility in vitro; however, these findings are often conflicting and utilized varying experimental setups20. Thus, further studies are urgently needed for better understanding of this crucial process in tumor progression.

In this study, our aim was to examine the impact of chronic hypoxia on expression of EMT markers, proliferation and motility in a panel of human lung adenocarcinoma cell lines. We found that chronic hypoxia may act as an acute stressor for the cells based on reduced expression of proliferation markers. We also demonstrated that changes in the expression of EMT markers in several cell lines are consistent with the metastasis-promoting effect of hypoxia. Also, we demonstrated that vimentin shows EMT-related morphology under hypoxic conditions in lung adenocarcinoma cells. Furthermore, we found differential motility responses that depended on the cellular density. More specifically, we found a general decrease of motility upon analysis of single-cell movement, while hypoxia enhanced migratory activity under confluent conditions. In conclusion, our study provides an extensive analysis of the differential effects of hypoxic conditions on lung cancer cell viability and migratory potential and warrants further studies to understand its role in shaping the tumor progression.

Results

The effect of hypoxia and CoCl2 on apoptosis and proliferation

In this study, we selected a panel of lung adenocarcinoma cell lines harboring major mutations commonly found in LUAD tumors, more specifically mutations of EGFR (H1975), KRAS (PF139) and BRAF (PF901) oncoproteins, furthermore, we also included one cell line with no known driver mutations (H838).

To examine main cellular responses to hypoxia, we performed immunoblot analysis of changes in HIF-1α, proliferation marker p-Histone H3 and apoptosis based on the presence of cleaved PARP in in vitro cultured LUAD cells that were exposed to CoCl2 treatment or hypoxic conditions (1% O2) (Fig. 1). As a generic signaling hub induced by hypoxia, HIF-1α was upregulated in all cell lines upon exposure to hypoxia or CoCl2 (Fig. 1a). Notably, CoCl2 is a hypoxia-mimetic agent, that blocks physiological HIF-1α protein degradation leading to its stabilization and accumulation. Regarding cell proliferation, we did not detect any significant changes based on SRB viability tests (Fig. 1b), however, we observed reduced p-Histone H3 protein expression under hypoxia (Fig. 1c,d). Neither condition induced apoptosis in any of the cell lines based on the lack of detectable cleaved PARP signal.Fig. 1 Effect of hypoxia and CoCl2 treatment on hypoxia, proliferation, and apoptosis-related protein expression. Cells were exposed for 48 h to normoxic (21% O2 control) or hypoxic (1% O2) conditions or 200 µM CoCl2 treatment (under 21% O2). (a) Representative Western blot images showing protein level changes upon different conditions. (b) Graph show the proliferation data obtained from SRB viability assay. (c) Graph shows the densitometric evaluation of investigated-Histone H3 protein, normalized to total protein and expressed relative to control (normoxic sample). (d) Representative Western blot images showing p-Histone H3 protein level changes upon hypoxic conditions. Data derived from three independent experiments plotted as mean ± SD. Asterisks show statistically significant differences. Statistical significance was established using unpaired t-test with Welch correction at p < 0.05. Uncropped blots can be found at supplementary information file.

Effects of hypoxia and CoCl2 on single-cell migration ability

To characterize the effects of hypoxia on single-cell migratory activity of the four tumor cell lines, we performed time-lapse videomicroscopy. Tumor cells were allowed to migrate for 48 h under normoxic (21%O2), 200 µM CoCl2 (21%O2), and hypoxic (1%O2) conditions. Notably, pronounced differences could be observed in the migratory capacities of the four cell lines (Fig. 2a). Generally, CoCl2 treatment had no effect on cellular motility in any of the cell lines. However, in the case of hypoxic conditions, diverse, cell line-dependent changes could be observed.Fig. 2 Effects of hypoxia on single-cell motility. (a) Motility of individual cells in the last 12 h frame of the 48 h-long exposure to normoxia (21% O2), 200 µM CoCl2, and hypoxia (1% O2). Only cells that were presented on the video for the whole time period were included in the analysis. The distance from the origin and the total length are plotted. (b) Images shows trajectories of the corresponding cells shown in the left panel (a). Trajectories that show higher speed than a cut-off value (showed in each image, adjusted to the speed of the given cell line) are colored red. Note the differences in baseline motility of the distinct cell lines. Asterisks mark statistically significant differences at p < 0.05. Data is derived from three independent experiments. Two independent wells were monitored for each experiment for normoxia and 200 µM CoCl2 treatment, while four independent wells were monitored for hypoxia. Normality was tested with the Shapiro-Wilk test. If the normal distribution was confirmed, one-way ANOVA with Tukey’s Multiple Comparison test was applied, otherwise Kruskal-Wallis test was used followed by Dunn’s multiple comparison post-test. Data plotted as mean ± SEM.

In case of H838, which is the least motile cell line in this panel, there was an initial significant increase in motility in the first 24 h compared to the control, however, migratory activity dropped in the last 12 h of the experiment (Supplementary Fig. 1). No differences were seen in H1975 cell line between distinct conditions. Hypoxia significantly reduced single-cell migration of PF139 and PF901 cell lines throughout the experiment (Fig. 2, Supplementary Fig. 1, 3–4). Regarding PF139, it can be observed that there was a decrease in both distance from the origin and total length from the starting point (Supplementary Fig. 3). However, in the last 12 h, a significant difference was only observed in the total length under hypoxic conditions as compared to the control. PF901, the fastest cell line, showed a reduction in hypoxia over the entire study period in terms of total length (Supplementary Fig. 4). Moreover, in the last 12 h, both measured motility parameters were significantly reduced under hypoxic conditions (Fig. 2).

Differential effect of hypoxia on invasion under confluent conditions

For further analysis of the effect of a hypoxic environment on tumor cells, we characterized migratory activity under confluent conditions using a wound-healing assay under normoxic and hypoxic (1%O2) conditions. Notably, hypoxic conditions induced significantly faster wound closure in case of H838, H1975 and PF901 cell lines compared to normoxia. Interestingly, PF139 cell line was not able to completely close the wound under hypoxia, while the scratch was closed under normal oxygen levels within 60 h (Fig. 3).Fig. 3 Effects of hypoxia on migratory activity under confluent conditions. Wound closure of the four lung tumor cell lines under normoxic (21% O2) and hypoxic (1%O2) conditions. a) Representative images of wound closure under normoxic and hypoxic conditions. b) Graphs show normalized data of scratch assay experiments. The images were captured every 6 h on a 72 h time frame. Hypoxia induced faster wound closure in all cell lines except for PF139. Asterisks indicate statistically significant differences at p < 0.05. Data were analyzed using non-linear regression and compared with sum-of-squares F test comparing Hillslope and LogIC50 data. Data are derived from three independent experiments. One independent well was monitored for each experiment. Data plotted as mean ± SEM.

Cell-line dependent changes in the mRNA expression levels and evaluation of EMT markers under hypoxic conditions

To study the molecular response to hypoxia on motility we measured the mRNA levels of main EMT markers, namely vimentin, N-cadherin, and E-cadherin in our panel of lung adenocarcinoma cell lines. Analysis of the basal expression of these genes revealed a slight expression difference between the cell lines for vimentin and E-cadherin. At the same time, both PF139 and PF901 showed significantly higher N-cadherin expression, especially compared to H838 with slow baseline motility (Supplementary Fig. 5).

N-cadherin and vimentin levels increased in H838 in both CoCl2 treatment and hypoxia, while CoCl2 treatment reduced E-cadherin expression (Fig. 4). CoCl2 treatment reduced the expression of all genes tested in H1975 (Supplementary Fig. 6), while hypoxia slightly increased vimentin expression with a parallel strong reduction of E-cadherin level. In PF139, the levels of vimentin and N-cadherin were slightly increased upon CoCl2 treatment (Supplementary Fig. 6), but none of the genes were affected by hypoxia. Hypoxia strongly reduced E-cadherin, and slightly increased vimentin level in PF901 cells, while the level of N-cadherin showed no change.Fig. 4 mRNA expression of EMT marker genes under normoxic and hypoxic conditions. Graphs depict the relative mRNA expression values of vimentin, N-cadherin, and E-cadherin obtained by real-time PCR. Cells were exposed for 48 h to normoxic (21% O2, control) or hypoxic (1% O2) conditions. Hypoxia induced cell line-dependent changes. Data shown was obtained from three independent experiments, plotted as mean ± SEM. RPLP0 was used as the endogenous internal control.

Also, we investigated a number of signaling pathways that was connected with hypoxia and migratory activity previously (Supplementary Fig. 8). Interestingly, phosphorylation of SRC protooncogene, and p38 protein was reduced under hypoxic conditions (Supplementary Fig. 8). Notably, autophosphorylation of focal adhesion kinase (FAK) was only increased in PF139 cell line under hypoxia (Supplementary Fig. 8).

Next, we asked whether the intracellular distribution of vimentin, a key intermedier filament protein connected to mesenchymal phenotype, changes upon hypoxia. To address this, we performed immunofluorescence analysis, where we observed that vimentin showed uneven distribution, often localized around the nucleus under normoxic conditions. However, vimentin filaments drastically changed morphology with even distribution fitting the shape of the cells after incubation with low oxygen concentrations. (Fig. 5a) Notably, area of vimentin expression in the individual cells were significantly larger under hypoxic conditions. Also, shape of the binary masks of vimentin signal showed lower circularity under hypoxic conditions, indicating a shift towards a more mesenchymal phenotype (Fig. 5b,c). Notably, these findings are in accordance with previous reports describing a EMT-related redistribution of vimentin in various cell types21,22.Fig. 5 Vimentin expression and morphology under normoxic and hypoxic conditions. (a) Pictures show representative images of fluorescently labeled vimentin of lung adenocarcinoma cell lines under normoxic (N) and hypoxic (H) conditions. (b) Binary masks created from vimentin expression using ImageJ Fiji software. (c) Evaluation of changes in binary masks area and circularity (shape) of the individual cells. Data shown derives from three independent experiments (Mean, + /-SEM). Asterisks marks statistically significant differences. Significant differences were established using Mann-Whitney U test at p < 0.05.

Discussion

Lung cancer is the most deadly form of malignant diseases globally. This malignancy is associated with a poor prognosis due to late diagnosis of an already advanced stage of metastatic disease23,24. Metastasis is a process whereby malignant cells leave the primary tumor, infiltrate neighboring tissues, enter the circulatory system, and establish secondary tumors in distant organs. Metastasis is the leading cause of mortality in lung cancer patients4, making it crucial to understand the underlying processes. Hypoxia, an environmental condition that is commonly found in tumors due to the unmatured vascularization, characterized by low levels of oxygen, has been associated with the progression of tumor and the development of metastasis5. Investigating the effects of tumor hypoxia in clinical setting is a challenging process complexified by tumor heterogeneity. Accordingly, we addressed tumor heterogeneity by investigating cells harboring major mutations that are commonly found in lung adenocarcinoma, utilizing H1975 (EGFR L858R and T790M), PF901 (BRAF V600E), PF139 (KRAS G12C), and H838 (triple wild type with no known driver mutation) cell lines.

Detailed scientific investigation of hypoxia has revealed that hypoxia inducible factors (HIFs) are the major regulatory proteins mediating cellular response to low oxygen conditions. Notably, previous research has indicated that elevated levels of HIF-1α and HIF-2α in non-small cell lung cancer (NSCLC) are correlated with an unfavorable prognosis for patients25,26. However, in certain malignancies, elevated HIF-1α levels are associated with lower cancer stage or decreased patient mortality, highlighting context-dependent functions for HIF-1α27. Stabilization of HIF occurs in most cases as a response to hypoxic conditions, therefore the examination of this protein plays a central role in hypoxia research28. Indeed, we observed dramatically high expression of HIF-1α protein after 48 h exposure to hypoxic conditions. Although HIF-1 is crucial in hypoxic response, many studies only focus on the stabilization of HIF-1α by chemical agents rather than achieving real hypoxic conditions. An example of hypoxia mimicking agents is CoCl2, one of the most commonly used HIF-1α stabilizer, which, in our case, induced higher HIF-1α protein level in all cell lines compared to hypoxic conditions. Nevertheless, no equation should be made between hypoxia and HIF stabilization. Despite this, a wide range of diverse and sometimes contradictory effects of “hypoxia” have been described in in vitro studies based on hypoxia mimicking agents. Thus, strictly validated studies investigating effects of hypoxia on tumor progression is urgently needed.

In order to obtain a general overview of how hypoxia affects cells, we first examined changes in the protein levels of the proliferation marker p-Histone H3 and the level of cleaved PARP, indicating apoptosis induction. Interestingly, we noted reduction of p-Histone H3 levels in most of the cell lines which suggests hypoxia to be a cellular stressor in this tested time exposure. In the meantime, no change could be observed in the proliferation of tumor cells under hypoxic conditions using a direct viability test. Our findings are in accordance with prior studies suggesting that reduced oxygen concentrations may either decrease29 or exhibit no impact on the proliferation of various tumor cells30. Notably, we found no changes in the level of cleaved PARP compared to normoxic condition, indicating that hypoxia does not induce apoptosis in this panel of lung adenocarcinoma cell lines.

However, the most significant effects of tumor hypoxia are thought to be related to tumor cell migration and metastasis and most of the studies focus on the hypoxia-induced pro-motility effects31–33, accordingly, we also investigated cellular motility via time-lapse videomicroscopy. In a previous study, we demonstrated that the HT168-M1 melanoma cell line exhibited increased migration and metastasis formation under hypoxia, indicating heightened aggressiveness20. Lehmann and colleagues found that HIF stabilization led to an increased number of metastatic events in an in vivo lung colonization model with murine breast cancer34. To our surprise, we observed that single-cell haptotactic motility was inhibited in 3 out of 4 cell lines upon 48 h of exposure to hypoxic conditions. To present, there is limited research available on the effects of in vitro hypoxia on the migratory activity of lung adenocarcinoma cell lines. However, hypoxia or hypoxia mimicking agents generally enhances the migration of lung tumor cell lines, although none of them were investigated the single-cell motility utilizing time-lapse video microscopy33,35–37. Additionally, most of these studies are focusing on the motility of A549 cell line. However, a recent study revealed heightened cellular motility in the H838 cell line following a 24 h exposure to hypoxia37. In accordance with this result, we also found increased migratory activity in the initial 24 h time interval for H838 cells.

As tumor cells may use numerous strategies for local invasion utilizing distinct types of migration, we also investigated invasion of tumor cells by scratch assay. Notably, most of the studies investigating hypoxia effects utilize this motility assay for evaluation of tumor migration. Surprisingly, we found that hypoxia significantly enhanced wound closure in three out of four cell lines including H838 and PF901 cell lines, that exhibited reduced single cell motility in hypoxic conditions. Accordingly, we sought to examine the underlying molecular mechanisms, investigating changes in the EMT markers that may contribute to the observed effects.

Notably, we observed significant differences in the basal expression of N-cadherin in our cell panel, that showed significantly higher expression in two cell lines. Of note, literature suggests that N-cadherin may promote motility and invasion of tumor cells and its overexpression is associated with shorter overall survival in non-small cell lung cancer patients38.

Interestingly, we observed changes in the expression of EMT markers in our cell panel that were consistent with the metastasis-promoting effect of hypoxia. These included decreased E-cadherin expression under hypoxic conditions in PF901 and H1975 cell lines and increased N-cadherin expression in H838. No changes were observed in EMT markers in PF139, the only cell line that exhibited slower migratory activity in scratch assay upon hypoxic conditions. Furthermore, this was the only cell line that showed increased FAK autophosphorylation in hypoxic conditions (Supplementary Fig. 7). This finding may indicate interference with the dynamic assembly-disassembly of focal adhesions as FAK activation is indispensable for both event, therefore it is crucial for proper migratory activity39. Interestingly, there is growing evidence for a tumor suppressor role of HIF-1alpha in certain cases40,41. Furthermore, a recent study has shown that ablation of HIF-1α in KRAS G12D mice resulted in increased invasion, metastasis formation and decreased survival42. The fact that PF139 also harbors KRAS mutation may also raise interesting questions about the association of oncogenic KRAS and HIF1α in tumor progression.

Last, we also investigated vimentin expression using immunofluorescent staining. In line with RNA data described above, we found that hypoxia exerted pronounced effects on vimentin morphology. In normoxia, vimentin showed uneven, varying distribution within cell boundaries, many times localized near to the nucleus. However, under hypoxic conditions, vimentin exhibited more homogenic, filamentous distribution in all cell lines that showed more mesenchymal morphology. Notably, similar changes were described previously on various cell types by EMT induction using TGF-β22.

Overall, we demonstrated cell-line and time-dependent effects of hypoxia in cell migration. Notably, hypoxia either not changed or slightly reduced cellular proliferation, based on viability tests and investigation of proliferation markers. Notably, we found that hypoxia mimicking CoCl2 failed to phenocopy effect of hypoxic conditions on single-cell motility. Importantly, we found that invasion under confluent conditions using scratch assay was enhanced in hypoxia in most of the cell lines, even in those that exhibited lower migratory activity in single-cell tracking in hypoxic conditions. In addition, we found that changes in EMT markers were in line with enhanced migration observed in scratch assay. Although the exact mechanism underlying different effect of hypoxia on single cell motility and wound closure is yet to be fully elucidated, distinct pattern of cell–cell and cell-ECM contacts is probably a major influencing factor, probably through modulation of transition from epithelial to mesenchymal phenotype.

Our study gives important insight into hypoxia- and HIF-related response of a wide variety of common lung adenocarcinoma models in terms of motility and proliferation, as well as apoptotic activity. As the high variance of cellular response might be the major underlying treatment obstacle, leading to failure of clinical use of HIF-inhibitors, further studies are warranted for better understanding of impact of hypoxia on cancer progression23.

Limitations

As most of the scientific works, this study also has some limitations. 3D migrational methods and in vivo metastatic studies are of higher relevance and more closely predict distinct steps of the metastatic cascade. However, this study only utilized 2D in vitro experiments, single cell motility and scratch assay, for migrational studies. Interestingly, these methodologies revealed differences between single-cell migration and invasion under confluent conditions, however, the mechanistic results obtained in our experiments do not allow us to distinguish between single and confluent cells. This limitation makes it challenging to precisely attribute the observed phenomena to specific cellular EMT gene and protein expression.

Methods

Cell culture

Human lung adenocarcinoma cell lines PF901, PF139, H838 and H1975 were cultured in DMEM (Dulbecco’s Modified Eagle Medium; Lonza, Basel, Switzerland); containing 4500 mg/dm3 glucose, pyruvate and L-glutamine) supplemented with 10% FBS (Fetal Bovine Serum; EuroClone, Pero, MI, Italy), 1% antibiotic–antimycotic solution (Lonza) and incubated at 37 °C in a humidified 5% CO2 atmosphere. For hypoxia measurements, cells were cultured in 1% O2, 5% CO2 and 94% N2 to stimulate the hypoxic environment. H838 cells were purchased from Horizon Discovery Ltd, while H1975 cells derived from ATCC. PF139 and PF901 cells were established from malignant pleural effusion samples in cooperation with the West German Biobank Essen as described earlier43,44. The patients provided written informed consent and the experiments were approved by the Ethics Committee of the University Hospital Essen (#18-8208-BO). Otherwise, this study does not include experimental animals or human participants. All experiments were performed in accordance with relevant guidelines and regulations.

Videomicroscopy

Videomicroscopy was performed with 4000 cells/well seeding concentration in 24-well cell culture plates (Greiner AG, Kremsmünster, Austria). The day after the cells were plated, medium was replaced with fresh medium with or without 200 µM CoCl2 (Sigma-Aldrich, St. Louis, Missouri, USA). Preliminary experiments had shown that no cytotoxicity occurred at this concentration. Three independent wells were used for each treatment group (normoxia; normoxia + CoCl2; hypoxia). One field of view per well was imaged every 10 min during the 48 h treatment period using a zenCellowl incubator microscope (innoME, Espelkamp, Germany).

For cell migration, videos were analyzed using CellTracker_v1_1_1 Standalone Version free software available at http://celltracker.website/index.html. Migratory activity of cells was measured using the semi-automatic tracking function of the software (Vignetting correction settings: Bicubic interpolation; Block size = 100; Maximum allowed displacement = 20; Semi-automatic tracking settings: Template matching; Maximum allowed displacement = 20; Cell diameter = 50). The resulting trajectories were checked and corrected if necessary using the manual function of the software. Following this step, data generated by the software were exported to an excel spreadsheet for further analysis. Results from three independent experiments were used for the calculations. Data were divided into 12 h intervals (1–72, 73–144, 145–216, 217–288 frames) and were further analyzed using the free software Chemotaxis and Migration Tool (Ibidi, Gräfelfing, Germany). Briefly, distance from origin and total length data were obtained from trajectories of the cells that remained in the field of view through the given time interval. The results were plotted and statistically evaluated using GraphPad Prism 5 software (La Jolla, San Diego, CA, USA). Representative videos can be found at the supplementary videos.

Cytotoxic sulforhodamine-B (SRB) assay

In brief, the cells were seeded in a 96-well plate at a concentration of 1 × 102 or 1 × 203 cells/well in 200 µL fresh DMEM (Lonza) supplemented with 10% FBS (EuroClone), 1% antibiotic–antimycotic solution (Lonza) and left to attach to the plates for 24 h. Then, cells were incubated at 37 °C in a humidified 5% CO2 atmosphere or for hypoxic conditions, cells were incubated in 1% O2, 5% CO2 and 94% N2 for 48 h. After that, the cells were washed and fixed with 100 µL cold 10% Trichloroacetic acid (TCA) for 1 h at 4 ℃. The wells were then washed 2 times with distilled water and stained for 15 min at room temperature with 70 µL 0.4% SRB dissolved in 1% acetic acid. Then, cells were washed with 1% acetic acid 3 times. The plates were air-dried and the dye was solubilized with 200 µl/well of 10 mM tris base (pH 10.5) for 10 min. The optical density (O.D.) of each well was measured spectrophotometrically at 570 nm with BioTek 800 microplate reader (Agilent, Santa Clara, CA) with automatic shaking for 30 s before reading. The mean background absorbance was subtracted automatically and mean values for each conditions were calculated.

Scratch assay

Scratch assays were prepared using the MuviCyte™ live-cell Imaging System (PerkinElmer, Waltham, MA, USA) supplied with a MuviCyte™ scratcher (PerkinElmer) to perform standardized scratches on 96 well plates following the manufacturer’s instructions. Briefly, cells were seeded at 40.000 cells/well density and left for overnight to attach. The next day, scratches were made using the MuviCyte™ scratcher device and wells were washed with DPBS to remove debris. DPBS was replaced with fresh medium. Wound closure was monitored in four parallel wells for each cell line for 72 h period. Pictures were taken from every well in every 6 h. Analysis of wound closure were performed using a modified script from Suarez-Arnedo, A. and colleges45 for ImageJ Fiji software. The script automatically measures the area of the scratch for different time points. Data were normalized and expressed as percentage of the starting scratch area. For each experiment, data from the four independent wells for each cell line were averaged and used as a single replicate, graphed in GraphPad Prism 5 software. Three independent biological replicates were performed. T1/2 wound closure data was calculated with GraphPad Prism 5 software using nonlinear regression (log [inhibitor] vs normalized response, variable slope). Representative videos can be found at the supplementary materials.

Western blot

The effects of CoCl2 treatment or hypoxia on protein expression and activation were investigated by immunoblot analysis. Cells were plated on 6-well plates (Greiner AG) at 200.000 cell/well density and were exposed to normoxia, normoxia + 200 µM CoCl2 treatment or hypoxia for 48 h. At the end of the treatment period, cells were washed with DPBS and were fixed with 6% trichloroacetic acid for 1 h at 4 °C. Cells were then mechanically scraped and centrifuged at 6000 RCF for 15 min. The precipitated protein was dissolved in a modified Läemmli-type buffer containing 0.02% bromophenol blue, 10% glycerol, 2% SDS, 100 mM dithiothreitol (DTT), 5 mM EDTA, 125 mg/ml urea, 90 mM Tris–HCl, pH 7.9. A Qubit fluorometer (Invitrogen™ Waltham, Massachusetts, USA) was used to determine protein concentration. Following this step, equal amounts of protein (20 µg/lane) from each sample were loaded to a 10% polyacrylamide gel and blotted onto PVDF membranes after electrophoretic separation using 10% precast polyacrilamide gels and Turbo-Blot system (BIO-RAD). Hypoxic response was evaluated by assessing changes in the protein level of HIF-1α (D5F3M, Cell Signaling Technology Danvers, MA, US), PARP (9542, Cell Signaling Technology),p-Histone H3 (9701S, Cell Signaling Technology), p-FAK (3283 Cell Signaling Technology), FAK (3285 T, Cell Signaling Technology), p38 (8690S, Cell Signaling Technology), p-p38 (4511, Cell Signaling Technology) (primary antibodies were used to detect changes in apoptosis and cell proliferation, respectively. β-tubulin (2128 T, Cell Signaling Technology) primary antibody was used as the internal control. All antibodies were dissolved in 5% BSA (bovine serum albumin) or nonfat dry milk in 1 × TTBS (Tris-buffered saline supplemented with 1% Tween80) buffer according to the manufacturer’s instructions. Membranes were blocked at room temperature (RT) for one hour in 5% milk dissolved in 1 × TTBS and incubated overnight at 4 °C with primary antibodies. HRP-conjugated rabbit secondary antibody (1:10000, 1 h, RT) and Pierce ECL Western Blotting Substrate (Thermo Fisher Scientific, Waltham, MA, USA) were used for signal development. Ponceau total protein staining was used for normalization. Quantitation was performed using ImageLab (Bio-Rad Hercules, CA, USA) software. Densitometric evaluations were always performed on the original blots. For the figures in the article, brightness and contrast adjustments were made for better visualization. All four cell lines were analyzed in 3 biological replicates. Uncropped original blots can be found at supplementary info file.

Real-time reverse transcription PCR

Samples were isolated in TRIzol reagent (Ambion, Life Technologies, Carlsbad, CA, USA) and the Direct-zol™ RNA MiniPrep (Zymo Research) kit was used to isolate RNA according to the manufacturer’s protocol. The concentration and purity of the RNA were determined using spectrophotometry at 260/280 and 260/230 nm (NanoDrop One, ThermoFisher Scientific, Madison, WI, USA). The RNA was then reverse transcribed using a Reverse Transcription System (Promega Corporation, Madison, WI, USA) according to the manufacturer's instructions. The resulting cDNA samples were stored at −80 °C until further use. Quantitative real-time PCR reactions were performed using SsoAdvanced Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) in a CFX96™ Real-Time PCR System according to the manufacturer’s instructions. The following target genes were studied: vimentin (F: 5′–AGTCCACTGAGTACCGGAGAC and R: 5′-CATTTCACGCATCTGGCGTTC), E-Cadherin (F: 5′–ATTTTTCCCTCGACACCCGAT and R: 5′-TCCCAGGCGTAGACCAAGA), N-Cadherin (F: 5′–AGCCAACCTTAACTGAGGAGT and R: 5′-GGCAAGTTGATTGGAGGGATG). RPLPO (F: 5′–AGCCCAGAACACTGGTCTC and R: 5′-ACTCAGGATTTCAATGGTG) was used as the internal control. The mRNA expression was analyzed by relative quantification, threshold cycle (Ct) values and 2−ΔΔCt method.

Immunofluorescent analysis

For immunofluorescent analysis, cells were seeded on glass immunohistological slides in 10% FBS + DMEM droplets. Next day, scratches were made in all colonies and then cells were cultured for 48 h in normoxic or hypoxic conditions, then were fixed for 20 min in 4% formaldehyde. Cells were then repeatedly washed with PBS, then permeabilized with 0.01% TritonX100 for 5 min. Following additional washing steps after permeabilization, cells were incubated with vimentin primary antibody Clone V9 (Agilent, USA) for an hour at RT according to the manufacturer’s instructions, then were washed in PBS and probed for half an our with anti-Mouse IgG (H + L) Secondary Antibody, Alexa Fluor™ 488 (A-11029, Thermo Fisher Scientific, USA). Nuclei was stained with DAPI, and slides was covered with ProLong Gold antifade reagent (P36930, Thermo Fisher Scientific), then were visualized using an Eclipse E600 (Nikon Optoteam, Vienna, Austria) fluorescent microscope with a CCD camera.

Pictures of cells were analyzed in ImageJ Fiji open-source software. Briefly, a top-hat filter were applied (50 px radius), then resulting pictures were convert to binary mask. “Median” command of binary transformations were applied (3 px radius), then particles (binary representatives of vimentin expression of each cells) were analyzed (Particle size: 100–4000 pxs). Results were manually revised and segmented if necessary, based on the original fluorescent images. Area and circularity data were collected from three independent experiments and were graphed with GraphPad Prism 5 software.

Statistical analysis

Statistical analysis were performed by Graphpad Prism 5 software. Briefly, single-cell motility data were analyzed for normal distribution using Shapiro-Wilk test. As number of data points were too small for Shapiro-Wilk test in case of proliferation data, we employed the Kolmogorov-Smirnov test to examine the normal distribution for this dataset. Datasets with normal distribution were analyzed by ANOVA followed by Tukey’s Multiple Comparison test, otherwise Kruskal-Wallis test were applied followed by Dunn’s Multiple Comparison test. Data from scratch assays were analyzed using non-linear regression and compared with sum-of-squares F test comparing Hillslope and logIC50 data. RNA and protein expression data was analyzed using unpaired t-test with Welch correction.

Supplementary Information

Supplementary Figures.

Supplementary Figures.

Supplementary Information.

Supplementary Information.

Supplementary Video.

Supplementary Information

The online version contains supplementary material available at 10.1038/s41598-024-70769-w.

Acknowledgements

This study was funded by the National Research, Development and Innovation Office (NRDIO) and Innovation Fund of the Ministry of Culture and Innovation, in frame of the Hungarian Thematic Excellence Program (project: TKP2021-EGA-44) and the National Laboratories Program (project: National Tumor Biology Laboratory (2022-2.1.1-NL-2022-00010). Project no. 1018567 has been implemented with the support provided by the Ministry of Culture and Innovation of Hungary from the National Research, Development and Innovation Fund, financed under the KDP-2020 funding scheme (S.E.S). The study was supported by NRDIO’s grants: NKFIH PD142272 (M.CS.) and K-147410 (J.T.).

Author contributions

MB, JT and SES designed the study, PF901 and PF139 cell lines were established and provided by BH, PCR and western blot measurements were performed by MCS, LS, IR, SES, BM, single-cell motility tests and scratch assays were performed by MCS, ET, MB and SES, statistical analysis was performed by MB, IR and JT; the manuscript was written by SES and BM, and was reviewed by MCS, LS, IR, BH, ET and JT. All authors have read and agreed to the published version of the manuscript.

Funding

Open access funding provided by Semmelweis University.

Data availability

All data acquired in experiments are either presented in this study or are available at the corresponding author upon reasonable request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Sung H Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer J. Clin. 2021 71 209 249 10.3322/caac.21660 33538338
Sung, H. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J. Clin. 71, 209–249. 10.3322/caac.21660 (2021).33538338 10.3322/caac.21660
2. Molina JR Yang P Cassivi SD Schild SE Adjei AA Non-small cell lung cancer: Epidemiology, risk factors, treatment, and survivorship Mayo Clin. Proc. 2008 83 584 594 10.4065/83.5.584 18452692
Molina, J. R., Yang, P., Cassivi, S. D., Schild, S. E. & Adjei, A. A. Non-small cell lung cancer: Epidemiology, risk factors, treatment, and survivorship. Mayo Clin. Proc. 83, 584–594. 10.4065/83.5.584 (2008).18452692 10.4065/83.5.584
3. Zarogoulidis P Effective early diagnosis for NSCLC: An algorithm Expert Rev. Respir. Med. 2021 15 1437 1445 10.1080/17476348.2021.1969916 34403620
Zarogoulidis, P. et al. Effective early diagnosis for NSCLC: An algorithm. Expert Rev. Respir. Med. 15, 1437–1445. 10.1080/17476348.2021.1969916 (2021).34403620 10.1080/17476348.2021.1969916
4. Nichols L Saunders R Knollmann FD Causes of death of patients with lung cancer Arch. Pathol. Lab. Med. 2012 136 1552 1557 10.5858/arpa.2011-0521-OA 23194048
Nichols, L., Saunders, R. & Knollmann, F. D. Causes of death of patients with lung cancer. Arch. Pathol. Lab. Med. 136, 1552–1557. 10.5858/arpa.2011-0521-OA (2012).23194048 10.5858/arpa.2011-0521-OA
5. Hanahan D Weinberg RA Hallmarks of cancer: The next generation Cell 2011 144 646 674 10.1016/j.cell.2011.02.013 21376230
Hanahan, D. & Weinberg, R. A. Hallmarks of cancer: The next generation. Cell 144, 646–674. 10.1016/j.cell.2011.02.013 (2011).21376230 10.1016/j.cell.2011.02.013
6. Muz B de la Puente P Azab F Azab AK The role of hypoxia in cancer progression, angiogenesis, metastasis, and resistance to therapy Hypoxia (Auckland) 2015 3 83 92 10.2147/HP.S93413
Muz, B., de la Puente, P., Azab, F. & Azab, A. K. The role of hypoxia in cancer progression, angiogenesis, metastasis, and resistance to therapy. Hypoxia (Auckland) 3, 83–92. 10.2147/HP.S93413 (2015).10.2147/HP.S93413
7. McKeown SR Defining normoxia, physoxia and hypoxia in tumours-implications for treatment response Br. J. Radiol. 2014 87 20130676 10.1259/bjr.20130676 24588669
McKeown, S. R. Defining normoxia, physoxia and hypoxia in tumours-implications for treatment response. Br. J. Radiol. 87, 20130676. 10.1259/bjr.20130676 (2014).24588669 10.1259/bjr.20130676
8. Le QT An evaluation of tumor oxygenation and gene expression in patients with early stage non-small cell lung cancers Clin. Cancer Res. 2006 12 1507 1514 10.1158/1078-0432.CCR-05-2049 16533775
Le, Q. T. et al. An evaluation of tumor oxygenation and gene expression in patients with early stage non-small cell lung cancers. Clin. Cancer Res. 12, 1507–1514. 10.1158/1078-0432.CCR-05-2049 (2006).16533775 10.1158/1078-0432.CCR-05-2049
9. Saxena K Jolly MK Acute vs. chronic vs. cyclic hypoxia: Their differential dynamics, molecular mechanisms, and effects on tumor progression Biomolecules 2019 10.3390/biom9080339 31382593
Saxena, K. & Jolly, M. K. Acute vs. chronic vs. cyclic hypoxia: Their differential dynamics, molecular mechanisms, and effects on tumor progression. Biomolecules10.3390/biom9080339 (2019).31382593 10.3390/biom9080339
10. Liu Q Palmgren VAC Danen EH Le Devedec SE Acute vs. chronic vs. intermittent hypoxia in breast cancer: A review on its application in in vitro research Mol. Biol. Rep. 2022 49 10961 10973 10.1007/s11033-022-07802-6 36057753
Liu, Q., Palmgren, V. A. C., Danen, E. H. & Le Devedec, S. E. Acute vs. chronic vs. intermittent hypoxia in breast cancer: A review on its application in in vitro research. Mol. Biol. Rep. 49, 10961–10973. 10.1007/s11033-022-07802-6 (2022).36057753 10.1007/s11033-022-07802-6
11. Semenza GL Wang GL A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation Mol. Cell Biol. 1992 12 5447 5454 10.1128/mcb.12.12.5447-5454.1992 1448077
Semenza, G. L. & Wang, G. L. A nuclear factor induced by hypoxia via de novo protein synthesis binds to the human erythropoietin gene enhancer at a site required for transcriptional activation. Mol. Cell Biol. 12, 5447–5454. 10.1128/mcb.12.12.5447-5454.1992 (1992).1448077 10.1128/mcb.12.12.5447-5454.1992
12. Maxwell PH The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis Nature 1999 399 271 275 10.1038/20459 10353251
Maxwell, P. H. et al. The tumour suppressor protein VHL targets hypoxia-inducible factors for oxygen-dependent proteolysis. Nature 399, 271–275. 10.1038/20459 (1999).10353251 10.1038/20459
13. Al Tameemi W Dale TP Al-Jumaily RMK Forsyth NR Hypoxia-modified cancer cell metabolism Front. Cell Dev. Biol. 2019 7 4 10.3389/fcell.2019.00004 30761299
Al Tameemi, W., Dale, T. P., Al-Jumaily, R. M. K. & Forsyth, N. R. Hypoxia-modified cancer cell metabolism. Front. Cell Dev. Biol. 7, 4. 10.3389/fcell.2019.00004 (2019).30761299 10.3389/fcell.2019.00004
14. Berchner-Pfannschmidt U Frede S Wotzlaw C Fandrey J Imaging of the hypoxia-inducible factor pathway: Insights into oxygen sensing Eur. Respir. J. 2008 32 210 217 10.1183/09031936.00013408 18591338
Berchner-Pfannschmidt, U., Frede, S., Wotzlaw, C. & Fandrey, J. Imaging of the hypoxia-inducible factor pathway: Insights into oxygen sensing. Eur. Respir. J. 32, 210–217. 10.1183/09031936.00013408 (2008).18591338 10.1183/09031936.00013408
15. Mole DR Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts J. Biol. Chem. 2009 284 16767 16775 10.1074/jbc.M901790200 19386601
Mole, D. R. et al. Genome-wide association of hypoxia-inducible factor (HIF)-1alpha and HIF-2alpha DNA binding with expression profiling of hypoxia-inducible transcripts. J. Biol. Chem. 284, 16767–16775. 10.1074/jbc.M901790200 (2009).19386601 10.1074/jbc.M901790200
16. Tirpe AA Gulei D Ciortea SM Crivii C Berindan-Neagoe I Hypoxia: Overview on hypoxia-mediated mechanisms with a focus on the role of HIF genes Int. J. Mol. Sci 2019 10.3390/ijms20246140 31817513
Tirpe, A. A., Gulei, D., Ciortea, S. M., Crivii, C. & Berindan-Neagoe, I. Hypoxia: Overview on hypoxia-mediated mechanisms with a focus on the role of HIF genes. Int. J. Mol. Sci10.3390/ijms20246140 (2019).31817513 10.3390/ijms20246140
17. Lamouille S Xu J Derynck R Molecular mechanisms of epithelial-mesenchymal transition Nat. Rev. Mol. Cell Biol. 2014 15 178 196 10.1038/nrm3758 24556840
Lamouille, S., Xu, J. & Derynck, R. Molecular mechanisms of epithelial-mesenchymal transition. Nat. Rev. Mol. Cell Biol. 15, 178–196. 10.1038/nrm3758 (2014).24556840 10.1038/nrm3758
18. Thiery JP Epithelial-mesenchymal transitions in tumour progression Nat. Rev. Cancer 2002 2 442 454 10.1038/nrc822 12189386
Thiery, J. P. Epithelial-mesenchymal transitions in tumour progression. Nat. Rev. Cancer 2, 442–454. 10.1038/nrc822 (2002).12189386 10.1038/nrc822
19. Friedl P Wolf K Tumour-cell invasion and migration: Diversity and escape mechanisms Nat. Rev. Cancer 2003 3 362 374 10.1038/nrc1075 12724734
Friedl, P. & Wolf, K. Tumour-cell invasion and migration: Diversity and escape mechanisms. Nat. Rev. Cancer 3, 362–374. 10.1038/nrc1075 (2003).12724734 10.1038/nrc1075
20. Tatrai E Cell type-dependent HIF1 alpha-mediated effects of hypoxia on proliferation, migration and metastatic potential of human tumor cells Oncotarget 2017 8 44498 44510 10.18632/oncotarget.17806 28562340
Tatrai, E. et al. Cell type-dependent HIF1 alpha-mediated effects of hypoxia on proliferation, migration and metastatic potential of human tumor cells. Oncotarget 8, 44498–44510. 10.18632/oncotarget.17806 (2017).28562340 10.18632/oncotarget.17806
21. Liu T Regulation of vimentin intermediate filaments in endothelial cells by hypoxia Am. J. Physiol. Cell Physiol. 2010 299 C363 373 10.1152/ajpcell.00057.2010 20427712
Liu, T. et al. Regulation of vimentin intermediate filaments in endothelial cells by hypoxia. Am. J. Physiol. Cell Physiol. 299, C363-373. 10.1152/ajpcell.00057.2010 (2010).20427712 10.1152/ajpcell.00057.2010
22. Maier J Traenkle B Rothbauer U Real-time analysis of epithelial-mesenchymal transition using fluorescent single-domain antibodies Sci. Rep. 2015 5 13402 10.1038/srep13402 26292717
Maier, J., Traenkle, B. & Rothbauer, U. Real-time analysis of epithelial-mesenchymal transition using fluorescent single-domain antibodies. Sci. Rep. 5, 13402. 10.1038/srep13402 (2015).26292717 10.1038/srep13402
23. Salem A Targeting Hypoxia to Improve Non-Small Cell Lung Cancer Outcome J. Natl. Cancer Inst. 2018 10.1093/jnci/djx160 28922791
Salem, A. et al. Targeting Hypoxia to Improve Non-Small Cell Lung Cancer Outcome. J. Natl. Cancer Inst.10.1093/jnci/djx160 (2018).28922791 10.1093/jnci/djx160
24. Siegel RL Miller KD Wagle NS Jemal A Cancer statistics, 2023 CA Cancer J Clin 2023 73 17 48 10.3322/caac.21763 36633525
Siegel, R. L., Miller, K. D., Wagle, N. S. & Jemal, A. Cancer statistics, 2023. CA Cancer J Clin 73, 17–48. 10.3322/caac.21763 (2023).36633525 10.3322/caac.21763
25. Giatromanolaki A Relation of hypoxia inducible factor 1 alpha and 2 alpha in operable non-small cell lung cancer to angiogenic/molecular profile of tumours and survival Br. J. Cancer 2001 85 881 890 10.1054/bjoc.2001.2018 11556841
Giatromanolaki, A. et al. Relation of hypoxia inducible factor 1 alpha and 2 alpha in operable non-small cell lung cancer to angiogenic/molecular profile of tumours and survival. Br. J. Cancer 85, 881–890. 10.1054/bjoc.2001.2018 (2001).11556841 10.1054/bjoc.2001.2018
26. Wu XH Qian C Yuan K Correlations of hypoxia-inducible factor-1alpha/hypoxia-inducible factor-2alpha expression with angiogenesis factors expression and prognosis in non-small cell lung cancer Chin. Med. J. (England) 2011 124 11 18 21362301
Wu, X. H., Qian, C. & Yuan, K. Correlations of hypoxia-inducible factor-1alpha/hypoxia-inducible factor-2alpha expression with angiogenesis factors expression and prognosis in non-small cell lung cancer. Chin. Med. J. (England) 124, 11–18 (2011).21362301
27. Keith B Johnson RS Simon MC HIF1alpha and HIF2alpha: Sibling rivalry in hypoxic tumour growth and progression Nat. Rev. Cancer 2011 12 9 22 10.1038/nrc3183 22169972
Keith, B., Johnson, R. S. & Simon, M. C. HIF1alpha and HIF2alpha: Sibling rivalry in hypoxic tumour growth and progression. Nat. Rev. Cancer 12, 9–22. 10.1038/nrc3183 (2011).22169972 10.1038/nrc3183
28. Semenza GL Hypoxia, clonal selection, and the role of HIF-1 in tumor progression Crit. Rev. Biochem. Mol. Biol. 2000 35 71 103 10.1080/10409230091169186 10821478
Semenza, G. L. Hypoxia, clonal selection, and the role of HIF-1 in tumor progression. Crit. Rev. Biochem. Mol. Biol. 35, 71–103. 10.1080/10409230091169186 (2000).10821478 10.1080/10409230091169186
29. Nisar H Hypoxia changes energy metabolism and growth rate in non-small cell lung cancer cells Cancers (Basel) 2023 10.3390/cancers15092472 37173939
Nisar, H. et al. Hypoxia changes energy metabolism and growth rate in non-small cell lung cancer cells. Cancers (Basel)10.3390/cancers15092472 (2023).37173939 10.3390/cancers15092472
30. Wang X Schneider A HIF-2alpha-mediated activation of the epidermal growth factor receptor potentiates head and neck cancer cell migration in response to hypoxia Carcinogenesis 2010 31 1202 1210 10.1093/carcin/bgq078 20395290
Wang, X. & Schneider, A. HIF-2alpha-mediated activation of the epidermal growth factor receptor potentiates head and neck cancer cell migration in response to hypoxia. Carcinogenesis 31, 1202–1210. 10.1093/carcin/bgq078 (2010).20395290 10.1093/carcin/bgq078
31. Shi R Liao C Zhang Q Hypoxia-driven effects in cancer: Characterization, mechanisms, and therapeutic implications Cells 2021 10.3390/cells10030678 35011587
Shi, R., Liao, C. & Zhang, Q. Hypoxia-driven effects in cancer: Characterization, mechanisms, and therapeutic implications. Cells10.3390/cells10030678 (2021).35011587 10.3390/cells10030678
32. Naveena HA Bhatia D Hypoxia modulates cellular endocytic pathways and organelles with enhanced cell migration and 3D cell invasion Chembiochem 2023 24 e202300506 10.1002/cbic.202300506 37677117
Naveena, H. A. & Bhatia, D. Hypoxia modulates cellular endocytic pathways and organelles with enhanced cell migration and 3D cell invasion. Chembiochem 24, e202300506. 10.1002/cbic.202300506 (2023).37677117 10.1002/cbic.202300506
33. Wang T Hypoxia increases the motility of lung adenocarcinoma cell line A549 via activation of the epidermal growth factor receptor pathway Cancer Sci. 2007 98 506 511 10.1111/j.1349-7006.2007.00428.x 17425591
Wang, T. et al. Hypoxia increases the motility of lung adenocarcinoma cell line A549 via activation of the epidermal growth factor receptor pathway. Cancer Sci. 98, 506–511. 10.1111/j.1349-7006.2007.00428.x (2007).17425591 10.1111/j.1349-7006.2007.00428.x
34. Lehmann S Hypoxia induces a HIF-1-dependent transition from collective-to-amoeboid dissemination in epithelial cancer cells Curr. Biol. 2017 27 392 400 10.1016/j.cub.2016.11.057 28089517
Lehmann, S. et al. Hypoxia induces a HIF-1-dependent transition from collective-to-amoeboid dissemination in epithelial cancer cells. Curr. Biol. 27, 392–400. 10.1016/j.cub.2016.11.057 (2017).28089517 10.1016/j.cub.2016.11.057
35. Kataoka Y Hypoxia-induced galectin-3 enhances RhoA function to activate the motility of tumor cells in non-small cell lung cancer Oncol. Rep. 2019 41 853 862 10.3892/or.2018.6915 30535445
Kataoka, Y. et al. Hypoxia-induced galectin-3 enhances RhoA function to activate the motility of tumor cells in non-small cell lung cancer. Oncol. Rep. 41, 853–862. 10.3892/or.2018.6915 (2019).30535445 10.3892/or.2018.6915
36. Liu KH Hypoxia stimulates the epithelial-to-mesenchymal transition in lung cancer cells through accumulation of nuclear beta-catenin Anticancer Res. 2018 38 6299 6308 10.21873/anticanres.12986 30396950
Liu, K. H. et al. Hypoxia stimulates the epithelial-to-mesenchymal transition in lung cancer cells through accumulation of nuclear beta-catenin. Anticancer Res. 38, 6299–6308. 10.21873/anticanres.12986 (2018).30396950 10.21873/anticanres.12986
37. Yan F Hypoxia promotes non-small cell lung cancer cell stemness, migration, and invasion via promoting glycolysis by lactylation of SOX9 Cancer Biol. Ther. 2024 25 2304161 10.1080/15384047.2024.2304161 38226837
Yan, F. et al. Hypoxia promotes non-small cell lung cancer cell stemness, migration, and invasion via promoting glycolysis by lactylation of SOX9. Cancer Biol. Ther. 25, 2304161. 10.1080/15384047.2024.2304161 (2024).38226837 10.1080/15384047.2024.2304161
38. Hui L Prognostic significance of twist and N-cadherin expression in NSCLC PLoS ONE 2013 8 e62171 10.1371/journal.pone.0062171 23626784
Hui, L. et al. Prognostic significance of twist and N-cadherin expression in NSCLC. PLoS ONE 8, e62171. 10.1371/journal.pone.0062171 (2013).23626784 10.1371/journal.pone.0062171
39. Li X Combs JD 3rd Salaita K Shu X Polarized focal adhesion kinase activity within a focal adhesion during cell migration Nat. Chem. Biol. 2023 19 1458 1468 10.1038/s41589-023-01353-y 37349581
Li, X., Combs, J. D. 3rd., Salaita, K. & Shu, X. Polarized focal adhesion kinase activity within a focal adhesion during cell migration. Nat. Chem. Biol. 19, 1458–1468. 10.1038/s41589-023-01353-y (2023).37349581 10.1038/s41589-023-01353-y
40. Shen C Genetic and functional studies implicate HIF1alpha as a 14q kidney cancer suppressor gene Cancer Discov. 2011 1 222 235 10.1158/2159-8290.CD-11-0098 22037472
Shen, C. et al. Genetic and functional studies implicate HIF1alpha as a 14q kidney cancer suppressor gene. Cancer Discov. 1, 222–235. 10.1158/2159-8290.CD-11-0098 (2011).22037472 10.1158/2159-8290.CD-11-0098
41. Velasco-Hernandez T Hyrenius-Wittsten A Rehn M Bryder D Cammenga J HIF-1alpha can act as a tumor suppressor gene in murine acute myeloid leukemia Blood 2014 124 3597 3607 10.1182/blood-2014-04-567065 25267197
Velasco-Hernandez, T., Hyrenius-Wittsten, A., Rehn, M., Bryder, D. & Cammenga, J. HIF-1alpha can act as a tumor suppressor gene in murine acute myeloid leukemia. Blood 124, 3597–3607. 10.1182/blood-2014-04-567065 (2014).25267197 10.1182/blood-2014-04-567065
42. Tiwari A Loss of HIF1A from pancreatic cancer cells increases expression of PPP1R1B and degradation of p53 to promote invasion and metastasis Gastroenterology 2020 159 1882–1897 e1885 10.1053/j.gastro.2020.07.046
Tiwari, A. et al. Loss of HIF1A from pancreatic cancer cells increases expression of PPP1R1B and degradation of p53 to promote invasion and metastasis. Gastroenterology 159(1882–1897), e1885. 10.1053/j.gastro.2020.07.046 (2020).10.1053/j.gastro.2020.07.046
43. Hegedus L HDAC inhibition induces PD-L1 expression in a novel anaplastic thyroid cancer cell line Pathol. Oncol. Res. 2020 26 2523 2535 10.1007/s12253-020-00834-y 32591993
Hegedus, L. et al. HDAC inhibition induces PD-L1 expression in a novel anaplastic thyroid cancer cell line. Pathol. Oncol. Res. 26, 2523–2535. 10.1007/s12253-020-00834-y (2020).32591993 10.1007/s12253-020-00834-y
44. Baranyi M Farnesyl-transferase inhibitors show synergistic anticancer effects in combination with novel KRAS-G12C inhibitors Br. J. Cancer 2024 10.1038/s41416-024-02586-x 38278976
Baranyi, M. et al. Farnesyl-transferase inhibitors show synergistic anticancer effects in combination with novel KRAS-G12C inhibitors. Br. J. Cancer10.1038/s41416-024-02586-x (2024).38278976 10.1038/s41416-024-02586-x
45. Suarez-Arnedo A An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays PLoS ONE 2020 15 e0232565 10.1371/journal.pone.0232565 32722676
Suarez-Arnedo, A. et al. An image J plugin for the high throughput image analysis of in vitro scratch wound healing assays. PLoS ONE 15, e0232565. 10.1371/journal.pone.0232565 (2020).32722676 10.1371/journal.pone.0232565
