
==== Front
Stem Cell Res Ther
Stem Cell Res Ther
Stem Cell Research & Therapy
1757-6512
BioMed Central London

38956621
3809
10.1186/s13287-024-03809-x
Research
Mesenteric lymph nodes: a critical site for the up-regulatory effect of hUC-MSCs on Treg cells by producing TGF-β1 in colitis treatment
Zhang Qixiang 1
Zeng Zhu 1
Wei Ning 12
Su Yueyan 2
Wang Jing 2
Ni Qi 1
Wang Yukai 1
Yang Jingwen 1
Liu Xiaoyan 1
Xu Huanke 1
Wang Guangji guangjiwang@hotmail.com

13
Shan Yunlong immunometabolism@163.com

14
Zhou Fang zf1113@163.com

13
1 grid.254147.1 0000 0000 9776 7793 Key Laboratory of Drug Metabolism and Pharmacokinetics, Haihe Laboratory of Cell Ecosystem, State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing, China
2 Jiangsu Renocell Biotech Co., Ltd, Nanjing, China
3 Present Address: No. 639 Longmian Avenue, Nanjing, Jiangsu China
4 Present Address: Tongjiaxiang #24, Nanjing, Jiangsu China
2 7 2024
2 7 2024
2024
15 19027 2 2024
23 6 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
Background

Mesenchymal stem cells (MSCs) demonstrate a wide range of therapeutic capabilities in the treatment of inflammatory bowel disease (IBD). The intraperitoneal injection of MSCs has exhibited superior therapeutic efficacy on IBD than intravenous injection. Nevertheless, the precise in vivo distribution of MSCs and their biological consequences following intraperitoneal injection remain inadequately understood. Additional studies are required to explore the correlation between MSCs distribution and their biological effects.

Methods

First, the distribution of human umbilical cord MSCs (hUC-MSCs) and the numbers of Treg and Th17 cells in mesenteric lymph nodes (MLNs) were analyzed after intraperitoneal injection of hUC-MSCs. Subsequently, the investigation focused on the levels of transforming growth factor beta1 (TGF-β1), a key cytokine to the biology of both Treg and Th17 cells, in tissues of mice with colitis, particularly in MLNs. The study also delved into the impact of hUC-MSCs therapy on Treg cell counts in MLNs, as well as the consequence of TGFB1 knockdown hUC-MSCs on the differentiation of Treg cells and the treatment of IBD.

Results

The therapeutic effectiveness of intraperitoneally administered hUC-MSCs in the treatment of colitis was found to be significant, which was closely related to their quick migration to MLNs and secretion of TGF-β1. The abundance of hUC-MSCs in MLNs of colitis mice is much higher than that in other organs even the inflamed sites of colon. Intraperitoneal injection of hUC-MSCs led to a significant increase in the number of Treg cells and a decrease in Th17 cells especially in MLNs. Furthermore, the concentration of TGF-β1, the key cytokine for Treg differentiation, were also found to be significantly elevated in MLNs after hUC-MSCs treatment. Knockdown of TGFB1 in hUC-MSCs resulted in a noticeable reduction of Treg cells in MLNs and the eventually failure of hUC-MSCs therapy in colitis.

Conclusions

MLNs may be a critical site for the regulatory effect of hUC-MSCs on Treg/Th17 cells and the therapeutic effect on colitis. TGF-β1 derived from hUC-MSCs promotes local Treg differentiation in MLNs. This study will provide new ideas for the development of MSC-based therapeutic strategies in IBD patients.

Supplementary Information

The online version contains supplementary material available at 10.1186/s13287-024-03809-x.

Keywords

Mesenchymal stem cells
Experimental colitis
Intraperitoneal injection
Mesenteric lymph nodes
TGF-β1
Treg cells
http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 82073928 82104184 Wang Guangji Shan Yunlong Leading technology foundation research project of Jiangsu provinceBK20232035 BK20192005 Wang Guangji Zhou Fang Haihe Laboratory of Cell Ecosystem Innovation Fund22HHXBSS00005 Wang Guangji Nanjing Scientific and Technological Special Project for Life and Health202110006 Wang Guangji the Project of State Key Laboratory of Natural Medicines, China Pharmaceutical UniversitySKLNMZZ202302 Zhou Fang http://dx.doi.org/10.13039/501100012226 Fundamental Research Funds for the Central Universities 2632023TD03 Shan Yunlong issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Inflammatory bowel disease (IBD), mainly including ulcerative colitis (UC) and Crohn’s disease (CD), has emerged as a global disease with no available cure [1, 2], which is characterized by recurrent chronic inflammation of the gastrointestinal tract [3, 4]. In the past decade, an expansive armamentarium of biologic and small-molecule therapies has become available for the induction and maintenance of remission in IBD [5]. Despite these advancements, approximately 30% of patients do not respond to biologicals and of those who do initially respond, 50% experience a relapse within one year. Additionally, the majority of medications used to treat IBD are immunosuppressive, which can result in a heightened susceptibility to infections and cancer [6]. Given the variability in individual responses to these drugs, a more diverse array of therapeutic approaches is necessary.

Mesenchymal stem cells (MSCs) have emerged as a valuable therapeutic approach in tissue repair and immunomodulation, offering numerous advantages. MSCs possess the capability to be attracted to areas of tissue damage or inflammation and modulate the immune microenvironment at the site of injury. The safety and efficacy of MSC-based therapy have been demonstrated in IBD patients, including those who are unresponsive to traditional clinical or biological treatments or are considered medically refractory [7–9]. Nevertheless, the intravenous injection of MSCs has been shown to result in inefficient homing to inflamed colon tissues, thereby limiting the optimal utilization of MSC therapy [10]. Although systemic infusion of MSCs remains a prevalent method for treating IBD [11], recent studies have demonstrated that intraperitoneal injections of MSCs exhibit greater efficacy in addressing colitis [10]. Nevertheless, the specific mechanisms underlying this phenomenon remain poorly understood. Further research is necessary to elucidate the relationship between the precise in vivo distribution of MSCs and their resulting biological effects following intraperitoneal injection.

An imbalance in the ratio of Treg to Th17 cells in the gut is a common characteristic typical of colitis. Therefore, upregulating Treg cells in the gut to restore balance between Treg and Th17 cells has been identified as a viable strategy for managing colitis [12–15]. It has been reported that MSCs induce Treg cell differentiation, which in turn limits the inflammatory response [16, 17]. Meanwhile, various investigations have indicated that human mesenchymal stem cells (hMSCs) possess the ability to release anti-inflammatory agents and have been shown to be dependent on local microenvironmental [18, 19]. TGF-β1 is of particular interest because it regulates T-cell-mediated tolerance and immunity through both Treg and Th17 cells in a context-dependent manner [20, 21]. Whether MSCs treatment could rebalance Treg/Th17 cells in colitis mice by inducing Treg cell differentiation need further investigation.

An important prerequisite for hMSCs to immune regulate by producing anti-inflammatory agents is migration to diseased tissues [22]. However, most studies have found MSCs administered systemically are predominantly distributed in the lungs, liver, and spleen after systemic infusion, with minimal distribution in the colon. In contrast, intraperitoneally injected MSCs could migrate into the inflamed colon and effectively reduced the amount of collagen deposition, the rate of epithelial cell apoptosis and the local production of pro-inflammatory cytokines [23, 24]. Here, we aim to explore the precise in vivo distribution of MSCs and their biological consequences focusing on the balance of Treg/Th17 cells especially in mesenteric lymph nodes (MLNs).

Materials and methods

Animal study

Male C57BL/6 mice (6–8 weeks) and male BALB/c mice (6–8 weeks) and were both purchased from the Beijing Vital River Laboratory Animal Technology Co (Beijing, China). All animals were maintained under the specific-pathogen free (SPF) condition with a constant temperature (23 ± 1.5˚C) and humidity (70 ± 20%) on a 12-hour light/dark cycle. All animal experiments were performed in compliance with Guidance for Care and Use of Laboratory Animals and approved by the Ethics Committee of the Experimental Animal Center at China Pharmaceutical University (SYXK2021-0011) and ARRIVE (Animal Research: Reporting of In Vivo Experiments) 2.0 guidelines. The animals were humanely euthanized using carbon dioxide inhalation according to institutional guidelines.

hUC-MSCs preparation

The hUC-MSCs were manufactured by Jiangsu Renocell Biotech Co., Ltd. (Nanjing, China). The hUC-MSC product were identified by the minimal criteria suggested by International Society for Cellular Therapy (ISCT): (1) plastic adherent under tissue culture flask; (2) > 95% of the cell population expressed CD105, CD73, and CD90, and these cells were lack expression (< 2% positive) of CD45, CD34, CD11b, CD19, and HLA-DR as measured by flow cytometry (BD, FACS Calibur, USA); (3) differentiation potential into osteoblasts, adipocytes, and chondroblasts under standard in vitro differentiating conditions. The cell product has been certified by the National Institutes for Food and Drug Control of China.

Induction of colitis by DSS

Colitis in male C57BL/6 mice was induced by providing drinking autoclaved water containing 3% (w/v) Dextran sulfate (DSS) (36000-50,000 kDa; MP Biomedicals, USA), ad libitum for 7 days, followed by regular drinking water [25].

Treatment of colitis mice

At day 3 of DSS induction, mice were treated with hUC-MSCs (2 × 106 cells/mice, 200 µL in volume). To prevent confounding bias, the placement of each mouse cage was randomized after cell transplantation. Then DSS induction was continued until day 7. At the therapeutic endpoint of hUC-MSCs, animals from each group were euthanized, colon lengths and spleen weights were measured, and samples were taken for macroscopic analysis.

To compare the efficacy of hUC-MSCs administered intravenously and intraperitoneally on DSS-induced colitis mice, 32 mice were divided into four groups (n = 8): control mice, DSS-induced colitis mice, DSS-induced colitis mice with intravenous injection of hUC-MSCs (i.v.) and DSS-induced colitis mice with intraperitoneal injection of hUC-MSCs (i.p.). To further investigate the effect of intraperitoneal administration of hUC-MSCs on intestinal inflammatory injury, 15 mice were divided into three groups (n = 5): control mice, DSS-induced colitis mice, and DSS-induced colitis mice with intraperitoneal injection of hUC-MSCs. To study the effect of hUC-MSCs with TGFB1 Knockdown (hUC-MSCsTGFB1 KD) on DSS-induced colitis, 20 mice were divided into four groups (n = 5): control mice, DSS-induced colitis mice, DSS-induced colitis mice intraperitoneal injection of hUC-MSCsNC (Negative Control) and DSS-induced colitis mice intraperitoneal injection of hUC-MSCsTGFB1 KD. To prevent confounding bias, the placement of each mouse cage was randomized.

Distribution of hUC-MSCs

At day 7 of DSS induction, mice were randomized and injected intraperitoneally with hUC-MSCs (2 × 106 cells/mice, 200 µL in volume). 30 mice were divided into two groups: control mice injected with hUC-MSCs and DSS-induced colitis mice injected with hUC-MSCs. Three time points in each group for sample collection after receiving hUC-MSCs injection were: 1 day, 3 days, and 7 days (n = 5 per group at every time point). At the indicated time points, animals were euthanized, and then different organs were collected for detecting the hUC-MSCs numbers. To prevent confounding bias, the placement of each mouse cage was randomized.

Method for detecting hUC-MSCs in mouse tissues

We have established a sensitive, specific, and reliable qRT-PCR (Quantitative real time polymerase chain reaction) method based on the Alu gene [26–28]. The primers were designed targeting the human-specific unique sequence of Alu, the primer set for human-specific Alu repeat was as follows: forward, 5’- CACTACGCCCGGCTAATTT-3’; reverse, 5’-GCCTGTAATCCCAGCACTTT-3’. Total genomic DNA (gDNA) from mouse tissue was extracted with the FastPure Cell/Tissue DNA Isolation Mini Kit (Vazyme, Nanjing, China) based on the manufacturer’s protocol. The concentration and purity of total gDNA were detected by the Colibri Spectrophotometer (Berger, Germany). Then, the qRT-PCR assay of gDNA was performed with SYBR Green Mix (Bio-Rad, California, USA).

The standard curve of cycle threshold values (Ct) versus cell number (logarithmic form) was obtained through qRT-PCR amplification. Each test tissue was assayed alongside its respective standard curve. The concentration of hUC-MSCs in the tissue was determined by substituting the Ct value of the cDNA into the corresponding tissue’s standard curve. The precision and accuracy of this method have been verified for preclinical evaluation (Data not shown).

Imaging of RFP-hUC-MSCs in mice vivo

DSS-induced colitis mice were injected intraperitoneally with RFP-hUC-MSCs (2 × 106 cells/mice, 200 µL in volume). At the 1 day after injected with RFP-hUC-MSCs, animals of each group were euthanized and selected organs were collected. Organs were washed by PBS buffer (Phosphate Buffered Saline), and fluorescence intensities were measured by an IVIS with filter set as follows: Excitation/Emission 594/647 nm. Two different experimental groups were established: control mice injected with RFP-hUC-MSCs and DSS-induced colitis mice injected with RFP-hUC-MSCs. Each group comprised three mice, a total of six mice used during the experiment.

Enzyme-linked immunosorbent assay (ELISA)

Fresh tissue homogenization and serum from mice were collected and stored at -80 °C until cytokine determination. Cytokine in tissue homogenization and serum were determined by ELISA Kits according to the manufacturer’s instructions. TGF-β1 ELISA Kits were purchased from Elabscience Biotechnology Co., Ltd (Wuhan, China). TNF-α, IL-1β, IFN-γ and IL-6 ELISA Kits were purchased from CUSABIO Co., Ltd (Wuhan, China).

For the determination of TGF-β1 concentration in tissues, 60 mice were divided into four groups: control mice, control mice injected with hUC-MSCs, DSS-induced colitis mice and DSS-induced colitis mice injected with hUC-MSCs. A total of three time points of each group for sample collection after receiving hUC-MSCs injection: 1 day, 3 days and 7 days (n = 5 per group at every time point). To prevent confounding bias, the placement of each mouse cage was randomized.

Flow cytometry assay of cells in mouse tissues

For single cell suspensions of the MLNs and spleen, organs were chopped and ground through a 70 μm nylon mesh and washed with an isotonic PBS buffer. After lysis of erythrocytes with erythrocyte lysate (Beyotime), the cells were washed several times with PBS buffer and resuspended in FACS containing 2% FBS.

First, before antibody incubation, unspecific staining was blocked with anti-mouse CD16/32 antibody (Biolegend, USA). And labelled with PBS 1:1000 dilution of dead-acting dye (Biolegend, Cat# 423,101) at 4 °C for 15 min. Second, stained with CD45-APC/fire 750 (Biolegend, Cat# 103,154), CD4 -FITC (Biolegend, Cat# 100,406) and CD25-PE (Biolegend, Cat# 113,704) in a dark room at 4 °C for 30 min. Third, punched and fixed with Transcription Factor Buffer Set (BD Pharmingen) at 4 °C for 20 min. Fourth, stained with RORγ-PE-610 (Thermo, Cat# 61-6981-82), and FOXP3-AF647 (Biolegend, Cat# 126,407) in a dark room at 4 °C for 30 min. Finally, suspension in FACS with 2% FBS. The stained cells were examined on a CytoFLEX S multicolor flow cytometer and analyzed with FlowJo software (BD Biosciences).

For flow cytometry detection of T cells in MLNs and spleen of mice. To examine the effect of hUC-MSCs treatment on T cells in MLNs and spleen, 20 mice were divided into four groups (n = 5): control mice, control mice injected with hUC-MSCs, DSS-induced colitis mice and DSS-induced colitis mice injected with hUC-MSCs. To examine the role of TGFB1 knockdown on hUC-MSCs treatment in regulating T cells in MLNs, another 20 mice were divided into four groups (n = 5): control mice, DSS-induced colitis mice, DSS-induced colitis mice injected with hUC-MSCsNC and DSS-induced colitis mice injected with hUC-MSCsTGFB1 KD. To prevent confounding bias, the placement of each mouse cage was randomized.

Flow cytometry assay of cells cultured in vitro

For PBMC and mouse Th0 cells, which co-cultured with hUC-MSCs, the cell suspension was collected, respectively. Then, the supernatant was aspirated after centrifugation at 500 g for 5 min. Labelled with PBS 1:1000 dilution of dead-acting dye (Biolegend, Cat# 423,101) at 4 °C for 15 min. Subsequently, the dye was washed away with PBS and the supernatant was discarded after centrifugation at 500 g for 5 min.

For PBMC sample, stained samples with CD4-APC/fire 750 (Biolegend, Cat# 300,514), CD25-FITC (Biolegend, Cat# 53-0259-41), CD127-PE (Biolegend, Cat# 351,304) in a dark room at 4 °C for 30 min. Then, the antibody was washed away with PBS and the supernatant was discarded after centrifugation at 500 g for 5 min. Finally, suspension in FACS with 2% FBS.

For mouse Th0 cells, stained samples with CD4 -FITC (Biolegend, Cat# 100,406) and CD25-PE (Biolegend, Cat# 113,704) in a dark room at 4 °C for 30 min. Second, punched and fixed with Transcription Factor Buffer Set (BD Pharmingen) at 4 °C for 20 min. Third, stained with FOXP3-Cy5 (Thermo, Cat# 15-5773-80) in a dark room at 4 °C for 30 min. Fourth, the antibody was washed away with PBS and the supernatant was discarded after centrifugation at 500 g for 5 min. Finally, suspension in FACS with 2% FBS.

The stained cells were examined on a CytoFLEX S multicolor flow cytometer and analyzed with FlowJo software (BD Biosciences).

Cell infection

hUC-MSCs were infected in vitro with Lentivirus for stable expression of RFP fluorescent protein (RFP-hUC-MSCs). Lentivirus were synthesized by Jiman Biotechnology (Shanghai, China). Infection according to the manufacturer’s protocol. Infection efficiency was examined by inverted fluorescence microscopy.

TGFB1 small interfering RNA (siRNA) were synthesized by Jiman Biotechnology (Shanghai, China). The oligodeoxynucleotide sequences used in this study are presented in Table 1. Lipofectamine RNAiMAX infection reagent (Invitrogen, California, USA) was used for infection according to the manufacturer’s protocol. Infection efficiency was measured by qRT-PCR analysis.

Table 1 The oligodeoxynucleotide sequences of siRNA

Gene Name	Forward Sequence (5’-3’)	Reverse Sequence (5’-3’)	
TGFB1_Homo	AGCGACTCGCCAGAGTGGTTA	GCAGTGTGTTATCCCTGCTGTCA	
NC_Homo	UUCUCCGAACGUGUCACGUTT	ACGUGACACGUUCGGAGAATT	

Lentivirus of TGFB1 were added to complete medium and gently mixed (MOI = 15), then Polybrene was added to a final concentration of 8 µg/mL and gently mixed. Each of the above components was added in sequence. After 48 h of incubation at 37 °C, the lentivirus-containing medium was aspirated and replaced with fresh medium, and the cells were collected for subsequent in vivo experiments after 24–36 h of further incubation. Scarlet-Puro Lentivirus and Puromycin were synthesized by Jiman Biotechnology (Shanghai, China). Infection according to the manufacturer’s protocol. Infection efficiency was measured by qRT-PCR.

Statistical analysis

To test for statistical significance, the Student’s t-test was used to compare two different groups. Comparisons between more than two groups were analyzed using two-way analysis of variance (ANOVA) with Dunnett’s test, or one-way ANOVA with Tukey’s test. Data are described by mean ± SEM, unless otherwise specified. P < 0.05 was considered statistically significant.

Results

Intraperitoneal treatment with hUC-MSCs alleviates colitis in mice

Firs, the therapeutic effect of hUC-MSC intraperitoneal administration was compared to that of intravenous administration of hUC-MSCs in mice with DSS-induced colitis. As shown in Fig S1, intraperitoneal treatment with hUC-MSCs resulted in a significant amelioration in body weight (Fig. S1A), disease activity index (DAI) (Fig. S1B), spleen index (Fig. S1C), colon length and colon weight (Fig. S1, D-F) in colitis-afflicted mice, whereas intravenous administration did not yield improvement, as evidenced by the persistence of symptoms and phenotypes similar to those observed in the DSS group (Fig. S1, A-F). Therefore, intraperitoneal administration of hUC-MSCs was adopted in the following research. In addition to the notable improvements in body weight (Fig. 1A), disease activity index (DAI) (Fig. 1B), splenic index (Fig. 1C) and colon length (Fig. 1F), intraperitoneal administration of hUC-MSCs effectively mitigated the inflammatory injury to the intestinal barrier, as evidenced by reduced MPO activity (Fig. 1D) and decreased serum FD-4 permeability across the intestinal wall (Fig. 1E). Pathologically, intraperitoneal injection of hUC-MSCs was observed to ameliorate the morphology and architecture of the intestinal wall in DSS-induced mice (Fig. 1G). Furthermore, in colitis mice treated with hUC-MSCs, there was a notable decrease in serum levels of IFN-γ, IL-1β, TNF-α and IL-6 (Fig. 1, H-K), as well as reduced the mRNA expression levels of Ifng, Il1b, Tnfa and Il6 in the colons (Fig. S1, G-J). These findings demonstrate that intraperitoneal injection of hUC-MSCs effectively alleviated colitis.

Fig. 1 Intraperitoneal treatment with hUC-MSCs alleviated DSS-induced colitis in mice. (A) Weight loss was measured every day and expressed as the percentage change from day 0. (B) Disease activity index (DAI) score was monitored every day. (C) Spleen index of each group of mice on day 7 following the hUC-MSCs treatment. (D) The MPO activities in the colon of each group were determined on day 7 following the hUC-MSCs treatment. (E) Concentration of FD-4 in blood that penetrated through the intestinal epithelial barrier of each group were determined on day 7 following the hUC-MSCs treatment. (F) Macroscopic appearance (left) and length (right) of colon. (G) Colon histological sections stained with hematoxylin and eosin (H&E) of each group on day 7 following hUC-MSCs treatment. Scale bar: 300 μm. (H-K) The concentrations of IFN-γ (H), and IL-1β (I), TNF-α (J), IL-6 (K) in the serum of healthy control and DSS-induced colitis mice on day 7 following hUC-MSCs treatment were determined, respectively. Data are represented as the means ± SEM (n = 5). *P < 0.05, **P < 0.005, ***P < 0.001

The extensive distribution of hUC-MSCs in MLNs of colitis mice

An desensitize prerequisite for therapeutic effect of MSCs is their migration to the inflamed tissues or secondary lymphoid organs. To investigate this phenomenon, the biodistribution analysis of hUC-MSCs following intraperitoneal injection in DSS-induced colitis (Fig. 2A) and TNBS-induced colitis (Fig. S2A) mice was conducted, respectively. A significantly higher presence of hUC-MSCs was observed in the colon and MLNs of colitis mice compared to the healthy controls one day post-injection. And the concentration of hUC-MSCs in MLNs of colitis mice was much higher than that in colon and other tissues (Fig. 2B and S2B). The quantity of hUC-MSCs distributed within the MLNs and colons of both control mice and DSS-induced colitis mice peaked on day 1 and decreased over time. By day 3 post-intraperitoneal injection of hUC-MSCs, the quantity of hUC-MSCs in the MLNs of mice with DSS-induced colitis was significantly higher than that in control mice. At day 7, the distribution quantity had decreased to near the lower limit of detection (Fig. 2, C and D). Additionally, at 3 and 7 days post-injection of hUC-MSCs, the distribution of hUC-MSCs in various abdominal tissues of mice, including the stomach, spleen, liver, lung, and kidney, was found to be below the limit of detection. The findings suggest that hUC-MSCs exhibit rapid migration to the MLNs and the injury sites of colon within 1 day, followed by a significant elimination.

Fig. 2 The extensive distribution of hUC-MSCs in MLNs of colitis mice. (A) Schematic timeline of DSS-induced colitis mice and intraperitoneal administration of hUC-MSCs. (B) hUC-MSCs numbers in the MLNs, colons, liver, lung, kidney and spleen of DSS-induced colitis and control mice at 1 day after hUC-MSCs intraperitoneal injection (n = 5). (C and D) hUC-MSCs numbers in the MLNs (C) and colons (D) of DSS-induced colitis and control mice at 1, 3 and 7 days after hUC-MSCs intraperitoneal injection (n = 5). (E and F) Fluorescence intensity of MLNs (E) and colons (F) at 1 day after intraperitoneal administration of RFP-hUC-MSCs (the hUC-MSCs expressing RFP fluorescent protein) is determined by IVIS Imaging System (n = 3). Data are represented as the means ± SEM. **P < 0.005, ***P < 0.001

Visualization of RFP-hUC-MSCs (hUC-MSCs expressing RFP fluorescent protein) using IVIS demonstrated a notably higher fluorescence intensity in the colon and MLNs of DSS-induced colitis mice compared to the control mice (Fig. 2, E and F). There was no statistically significant variance observed in the fluorescence intensity levels within the kidneys, lungs, livers, and spleens between the two experimental groups (Fig. S2C). In order to further elucidate the specifics of the distribution pattern of hUC-MSCs following intraperitoneal injection in the colon, lymphatic vessels (LYVE1+) and epithelial cells (EPCAM+) were fluorescently labeled in the slices of colon tissues. The presence of hUC-MSCs in the colons of mice with colitis exceeded that in control mice, with a predominant localization within the crypt region and a notable accumulation within the lymphatic vessels (Fig. S2D). The above results indicate that hUC-MSCs not only homed to the colon but also distributed abundantly to MLNs.

hUC-MSCs modulate Treg/Th17 cell equilibrium in MLNs through promoting local Treg differentiation

Colitis is characterized by dysregulation of Treg cells and Th17 cells in MLNs. To investigate the effect of hUC-MSCs treatment on Treg cells and Th17 cells in colitis MLNs, the frequency of Treg (CD25+ FOXP3+/CD4+) cells and Th17 (RORγt+/CD4+) cells in MLNs and spleen were evaluated at 3 days after intraperitoneal injection of hUC-MSCs. Compared to colitis model mice, hUC-MSCs treatment exhibited significantly higher levels of Treg cells in the MLNs and spleen (Fig. 3, A and B), while Th17 cells were notably reduced (Fig. 3, C and D). And the proportion of Treg cells in MLNs was much higher than that in spleen, indicating MLNs are critical sites for the up-regulatory effect of hUC-MSCs on Treg cells. To further investigate the potential mechanism by which hUC-MSCs may contribute to the increase in Treg cells in MLNs, we conducted co-culture experiments involving mouse spleen Th0 (naïve CD4+ T) cells and human PBMC with hUC-MSCs in Transwell, respectively. It was observed that co-culture with hUC-MSCs significantly promoted the differentiation of mouse spleen Th0 cells into Treg cells (Fig. 3E), as well as increased the proportion of Treg cells in human PBMC (Fig. 3F). The above results suggest that hUC-MSCs have the ability to modulate the Treg/Th17 cell balance in the MLNs of mice with colitis through the induction of Treg cell differentiation from naïve CD4+ T cells.

Fig. 3 hUC-MSCs modulate Treg/Th17 cell equilibrium in MLNs and induce T cell differentiation into Treg cells. (A and B) Frequencies of Treg (CD25+ FOXP3+/CD4+) cells in MLNs (A) and spleen (B) of DSS-induced colitis and control mice at 3 days after hUC-MSCs intraperitoneal administration were detected by flow cytometry (n = 5). (C and D) Frequencies of Th17 (RORγT+/CD4+ T) cells in MLNs (C) and spleen (D) of DSS-induced colitis and control mice at 3 days after hUC-MSCs intraperitoneal administration were detected by flow cytometry (n = 5). (E) Frequencies of Treg cells of Th0 cells that co-culture with hUC-MSCs (n = 3). (F) Frequencies of Treg cells of PBMC that co-culture with hUC-MSCs (n = 4). Data are represented as the means ± SEM. **P < 0.005, ***P < 0.001

hUC-MSCs upregulate the levels of TGF-β1 in MLNs of colitis mice

It is known that cytokines are important for determining the fate of CD4+ T cells. For example, TGF-β1 and IL-2 are essential for Treg cell differentiation [29]. To further explore the impact of hUC-MSCs distribution in the MLNs on the local levels of TGF-β1. We first stimulated hUC-MSCs with MLNs homogenates from healthy control and DSS-induced colitis mice, respectively (Fig. 4A). The MLNs homogenates from colitis mice significantly enhanced the production of TGF-β1 by hUC-MSCs (Fig. 4, B and C). Furthermore, the mRNA level of TGFB1 was up-regulated much higher than that of TGFB2 and TGFB3 in hUC-MSCs stimulated by MLNs homogenates from colitis mice (Fig. S4, A and B). Then, we examined the levels of TGF-β1 in MLNs, colon and spleen of healthy control and DSS-induced colitis mice at 1 day, 3 days and 7 days after intraperitoneal injection of hUC-MSCs (Fig. 4D). At 1 day and 3 days after intraperitoneal injection of hUC-MSCs, the levels of TGF-β1 levels in the MLNs (Fig. 4E), colon (Fig. 4F) and spleen (Fig. 4G) of colitis mice with hUC-MSCs treatment were all significantly increased compared to those in colitis mice. Moreover, the levels of TGF-β1 in MLNs were much higher than those in colon, spleen and lung at 1 day after intraperitoneal injection of hUC-MSCs (Fig. 4H). At 7 days after intraperitoneal injection of hUC-MSCs, TGF-β1 levels in serum of colitis mice with hUC-MSCs injection were significantly higher than in control mice and colitis model mice (Fig. S4C). There was no significant difference in the levels of TGF-β1 levels in kidneys (Fig. S4D) and lungs (Fig. S4E) between the control and colitis groups. Further analysis revealed that TGF-β1 concentration in MLNs was positively correlated with the numbers of hUC-MSCs distribution (Fig. 4I), suggesting hUC-MSCs may produce abundant TGF-β1 after they migrated into MLNs.

Fig. 4 hUC-MSCs upregulate TGF-β1 levels in MLNs and colons. (A) Schematic representation of hUC-MSCs stimulated by MLNs homogenate from control mice or DSS-induced colitis mice for 24 h. (B and C) The TGFB1 mRNA level (B) and the quantification of TGF-β1 secretion (C) from hUC-MSCs stimulated by MLNs homogenate from control mice or DSS-induced colitis (n = 5). (D) Schematic timeline of DSS-induced colitis mice and sample collection. (E–G) The concentrations of TGF-β1 in the MLNs (E), colon (F) and spleen (G) of DSS-induced colitis and control mice were quantified on days 1, 3, and 7 following either the intraperitoneal administration of hUC-MSCs or no treatment (n = 5). (H) The concentrations of TGF-β1 in different organs of DSS-induced colitis mice were quantified on day 1 following the intraperitoneal administration of hUC-MSCs (n = 5). (I) Correlation between TGF-β1 concentration and the numbers of hUC-MSCs distributed in MLNs, colons, spleen, kidney, lung of DSS-induced colitis mice were analyzed on day 1 following the intraperitoneal administration of hUC-MSCs. Data are represented as the means ± SEM. *P < 0.05, **P < 0.005, ***P < 0.001

TGFB1 knockdown decreases the regulatory effect of hUC-MSCs on Treg cells in MLNs of colitis mice

Subsequently, hUC-MSCNC (Negative Control) or hUC-MSCTGFB1 KD (hUC-MSCs with TGFB1 knockdown) were co-cultured with Th0 cells, resulting in a significant decrease in the differentiation of Th0 cells to Treg cells when co-cultured with hUC-MSCTGFB1 KD compared to hUC-MSCNC (Fig. 5A). Additionally, co-culturing hUC-MSCNC or hUC-MSCTGFB1 KD with human PBMCs showed a significantly lower proportion of Treg cells in PBMC co-cultured with hUC-MSCTGFB1 KD compared to hUC-MSCNC (Fig. 5B). To further investigate whether the increase in Treg percentage in MLNs of colitis mice was accomplished by TGF-β1 secretion of hUC-MSCs, the effect of hUC-MSCTGFB1 KD treatment on Treg cells in MLNs of DSS-induced colitis mice were studied (Fig. 5, C and D). One day post-treatment with hUC-MSCNC, there was a significant increase in the concentration of TGF-β1 in the MLNs of colitis mice. Conversely, treatment with hUC-MSCTGFB1 KD did not result in an enhanced concentration of TGF-β1 in the MLNs (Fig. 5E). This lack of TGF-β1 enhancement in the MLNs following hUC-MSCTGFB1 KD treatment was associated with a failure to increase the percentage of Treg cells in the MLNs of colitis mice. In contrast, the hUC-MSCNC group showed an increase in Treg cell numbers in the MLNs at day 3 after MSC treatment, indicating a potential role of hUC-MSC-derived TGF-β1 in T cell differentiation in MLNs (Fig. 5F). Meanwhile, there was no significant difference in the percentage of Treg cells in the spleens of colitis mice between the hUC-MSCNC and hUC-MSCTGFB1 KD groups (Fig. S5A).

Fig. 5 TGFB1 knockdown decreases the regulatory effect of hUC-MSCs on Treg cells in MLNs of colitis mice. (A) Frequencies of Treg cells of Th0 cells that co-culture with hUC-MSCNC or hUC-MSCTGFB1 KD (n = 3). (B) Frequencies of Treg cells in human PBMCs that co-culture with hUC-MSCNC or hUC-MSCTGFB1 KD (n = 4). (C) The TGFB1 mRNA expression in hUC-MSCNC and hUC-MSCTGFB1 KD were detected by qRT-PCR (n = 6). (D) Schematic timeline of DSS-induced colitis and intraperitoneal administration of hUC-MSCs (NC or TGFB1 KD) in mice. (E) The concentrations of TGF-β1 in the MLNs of control mice, colitis mice and MSC-treated colitis mice at day 1 (n = 5). (F) Frequencies of Treg (CD25+ FOXP3+/CD4+) cells in MLNs from control mice, colitis mice and MSC-treated colitis mice at day 3 (n = 5). Data are represented as the means ± SEM. *P < 0.05, **P < 0.005, ***P < 0.001

TGFB1 knockdown reduces the therapeutic effects of hUC-MSCs on colitis

In comparison to treatment with hUC-MSCNC, treatment with hUC-MSCTGFB1 KD did not yield the improvements in body weight (Fig. 6A), DAI (Fig. 6B), splenic index (Fig. 6C) and colon MPO levels (Fig. 6D) in colitis mice. Additionally, the colon length of colitis mice treated with hUC-MSCNC exceeded that of both model colitis mice and colitis mice treated with hUC-MSCTGFB1 KD (Fig. 6E). These findings suggest that the therapeutic efficacy of hUC-MSCs in colitis mice is diminished by the knockdown of TGFB1.

Fig. 6 TGFB1 knockdown reduces the therapeutic efficacy of hUC-MSCs on colitis. (A) Weight loss was measured every day and expressed as the percentage change from day 0 (n = 5). (B) Disease activity index (DAI) score was monitored every day (n = 5). (C) Spleen index of control mice, colitis mice and MSC-treated colitis mice at day 7 (n = 5). (D) The MPO activities in the colon of each group were determined using an MPO activity assay (n = 5). (E) Macroscopic appearance (left) and the length (right) of the colon (n = 5). Data are represented as the means ± SEM. **P < 0.005, ***P < 0.001

Discussion

There are numerous reports on the biological properties of stem cells and their therapeutic effects on colitis [30, 31]. Systemically administered MSCs are still a widely used treatment for colitis [32], but numerous studies have reported that intravenous delivery of MSCs yields unsatisfactory results [33, 34]. For example, in a phase I–II clinical study that enrolled 13 patients with severe CD, only one patient achieved clinical remission [35]. In contrast, intraperitoneally injected MSCs have better therapeutic effects of colitis [10].

Abundant studies have shown that hMSCs have the property of homing to inflammation sites [36, 37], and the key prerequisite for MSCs to have a therapeutic effect is to reach the site of inflammation. It has been reported that intravenous hMSCs cannot distribute to the colon, which may be an important factor limiting the clinical efficacy of MSCs [23]. However systemically administered hMSCs were observed to migrate towards the inflamed colon, in another study with colitis mice [24, 38]. Discrepancies regarding homing experiments may result from different details in each protocol, including the number of cells, administered doses, the site of isolation, and the properties of the media [39–41]. Interestingly, we found that hUC-MSCs injected intraperitoneally in mice with colitis were distributed not only in the colon, but also in the MLNs, and the concentration in the MLNs was even much higher than that in the colon (Fig. 2). Our findings may provide a new insight into the in vivo distribution of intraperitoneally injected hUC-MSCs in colitis mice, and the regulatory effect of MSCs on immune cells in MLNs may be closely related to their therapeutic efficacy in treating IBD.

Treg cells may negatively regulate the activation of each of the major Th cell subtypes as well as other immune and inflammatory cells via cell-cell contact and production of soluble factors [42]. An imbalance of Th17 and Treg cells caused by Treg cells damage has been shown to play a significant role in IBD. And the balances between Th17 and Treg cells have been a key prognostic indicator in IBD immunopathogenesis [43]. Numerous in vitro and in vivo studies have shown that MSCs increase Treg number and activity and have the ability to specifically protect or induce Treg cells [44, 45]. For example, it has been shown that co-culture of allogeneic MSCs with CD4+ T cells induces human FOXP3+ CD25high Treg cells [46]. This is consistent with our results that in vitro co-culture of MSCs significantly increased the number of Treg cells in mouse splenic Th0 cells or PBMCs. While it has been reported that MSCs treatment increases the number of Treg cells in MLNs, which in turn alleviates inflammatory pathological changes in the colitis phase and suppresses inflammatory cytokines secretion in the colon and serum [47, 48]. Our study demonstrated that the number of Treg cells significantly increased and the number of Th17 cells decreased in the MLNs of colitis mice after intraperitoneal injection of hUC-MSCs. This suggests that MLNs may be a critical site for the regulatory effect of hUC-MSCs on Treg cells and the subsequent efficacy on colitis.

Numerous studies have shown that TGF-β secreted by MSCs is involved in the immunomodulatory function of MSCs [49, 50]. TGF-β plays a key role in the generation and maintenance of Treg cells [51, 52], especially under inflammatory conditions. And it promotes the expression of Foxp3, thereby inducing the production of Treg cells [21]. Our study found that TGF-β1 concentration in MLNs was elevated and significantly higher than that in other tissues after hUC-MSCs intraperitoneal injection treatment. An imperative prerequisite for MSCs to regulate Treg cells by secreting TGF-β1 is to reach the site of inflammation. In the above study we have found the presence of mesenteric lymph node distribution of intraperitoneally injected hUC-MSCs, and by further study we have found a significant positive correlation between the concentration of TGF-β1 in MLNs and the number of hUC-MSCs. And TGFB1 knockdown significantly impaired the ability of hUC-MSCs to induce Treg cells and treat colitis.

In conclusion, a close correlation was observed between the MLNs distribution properties of hUC-MSCs in MLNs and the therapeutic effect on colitis in mice, mediated by the induction of Treg cells through TGF-β1 produced by hUC-MSCs (See Fig. 7). MLNs may be a critical site for the regulatory effect of hUC-MSCs on Treg cells and the therapeutic effect on colitis.

Fig. 7 In colitis mice, hUC-MSCs migrate into MLNs quickly after intraperitoneal administration and subsequently upregulate Treg cells by secreting TGF-β1. hUC-MSCs after intraperitoneal administration not only homed to the colon but also distributed to the MLNs in significant quantities. This migration was accompanied by a notable increase in TGF-β1 concentration within the MLNs. Consequently, the upregulation of Treg cells in MLNs of colitis mice occurred as result of TGF-β1-mediated differentiation of T cells into Treg cells by hUC-MSCs, leading to a favorable therapeutic outcome for colitis

Electronic supplementary material

Below is the link to the electronic supplementary material.

Supplementary Material 1

Acknowledgements

Not applicable.

Author contributions

Q.Z. designed and performed experiments, analyzed and interpreted data, and wrote the manuscript. Z.Z. and N.W. performed experiments and analyzed data. Y.S. and J.W. commented on the study and interpreted the data. Q.N., Y.W., J.Y., X.L., and H.X. provided the assistance on the animal operation. F.Z., G.W. and Y.S. designed and supervised the study and critically revised the manuscript. All authors reviewed and approved the final manuscript.

Funding

This work was supported by grants from the National Nature Science Foundation of China (No.82073928, 82104184), the Leading technology foundation research project of Jiangsu province (BK20232035, BK20192005), Haihe Laboratory of Cell Ecosystem Innovation Fund (22HHXBSS00005), Nanjing Scientific and Technological Special Project for Life and Health (No. 202110006), the Project of State Key Laboratory of Natural Medicines, China Pharmaceutical University (No. SKLNMZZ202302), Fundamental Research Funds for the Central Universities (No. 2632023TD03).

Data availability

The authors confirm that all data underlying the findings are fully available.

Declarations

Ethics approval and consent to participate

All animal procedures were approved by the Committee on the Ethics of Animal Experiments of the China Pharmaceutical University. Project title: In vivo Distribution and Therapeutic Efficacy of hUC-MSCs in Mice with DSS-Induced Colitis. Approved number: SYXK2021-0011. Approved Date: 10th September 2021.

Consent for publication

This manuscript is approved by all authors for publication. I would like to declare on behalf of my co-authors that the work described was original research that has not been published previously, and not under consideration for publication elsewhere, in whole or in part. The materials in this manuscript are not reproduced from other articles. All the authors listed have approved the manuscript that is enclosed.

Competing interests

The authors declare that they have no competing interests.

Abbreviations

hUC-MSCs Human umbilical cord-derived mesenchymal stem cells

MSCs Mesenchymal stem cells

Treg cell T regulatory cell

Th17 cell T helper 17 cell

PBMC Peripheral blood mononuclear cell

RFP-hUC-MSCs RFP fluorescently labelled hUC-MSCs

IBD Inflammatory bowel disease

UC Ulcerative colitis

CD Crohn’s disease

GI Gastrointestinal

GMSCs Gingiva derived MSCs

PDLSCs Periodontal ligament stem cells

MLNs Mesenteric lymph nodes

TNBS Trinitrobenzenesufonic Acid

DSS Dextran sulfate

H&E Hematoxylin and Eosin

DAI Disease Activity Index

MPO Myeloperoxidase

FD-4 Fluorescein isothiocyanate dextran-4

qRT-PCR Quantitative real time polymerase chain reaction

siRNA Small interfering RNA

Elisa Enzyme-linked immunosorbent assay

IVIS In vivo imaging system

PBS Phosphate Buffered Saline

DMEM/F-12 Dulbecco’s Modified Eagle Medium/Nutrient Mixture F-12

TGF-β1 Transforming growth factor-β1

TNF-α Tumor necrosis factor-α

IL-1β Interleukin-1β

IL-6 Interleukin-6

IFN-γ Interferon-γ

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Qixiang Zhang, Zhu Zeng and Ning Wei contributed equally to this work.

Change history

9/4/2024

A Correction to this paper has been published: 10.1186/s13287-024-03867-1
==== Refs
References

1. Burisch J East-West gradient in the incidence of inflammatory bowel disease in Europe: the ECCO-EpiCom inception cohort Gut 2014 63 588 97 10.1136/gutjnl-2013-304636 23604131
Burisch J, et al. East-West gradient in the incidence of inflammatory bowel disease in Europe: the ECCO-EpiCom inception cohort. Gut. 2014;63:588–97. 10.1136/gutjnl-2013-304636.23604131 10.1136/gutjnl-2013-304636
2. Cai Z Wang S Li J Treatment of inflammatory bowel disease: a Comprehensive Review Front Med (Lausanne) 2021 8 765474 10.3389/fmed.2021.765474 34988090
Cai Z, Wang S, Li J. Treatment of inflammatory bowel disease: a Comprehensive Review. Front Med (Lausanne). 2021;8:765474. 10.3389/fmed.2021.765474.34988090 10.3389/fmed.2021.765474
3. Hodson R. Inflammatory bowel disease. Nature. 2016;540. 10.1038/540S97a.
4. Mahadevan U Silverberg MS Inflammatory bowel Disease-Gastroenterology Diamond Jubilee Review Gastroenterology 2018 154 1555 8 10.1053/j.gastro.2017.12.025 29550591
Mahadevan U, Silverberg MS. Inflammatory bowel disease-gastroenterology diamond jubilee review. Gastroenterology. 2018;154:1555–8. 10.1053/j.gastro.2017.12.025.29550591 10.1053/j.gastro.2017.12.025
5. Villablanca EJ Selin K Hedin CRH Mechanisms of mucosal healing: treating inflammatory bowel disease without immunosuppression? Nat Rev Gastroenterol Hepatol 2022 19 493 507 10.1038/s41575-022-00604-y 35440774
Villablanca EJ, Selin K, Hedin CRH. Mechanisms of mucosal healing: treating inflammatory bowel disease without immunosuppression? Nat Rev Gastroenterol Hepatol. 2022;19:493–507. 10.1038/s41575-022-00604-y.35440774 10.1038/s41575-022-00604-y
6. Wetwittayakhlang P, Tselekouni P, Al-Jabri R, Bessissow T, Lakatos PL. The optimal management of inflammatory Bowel Disease in patients with Cancer. J Clin Med. 2023;12. 10.3390/jcm12062432.
7. Adak S Mukherjee S Sen D Mesenchymal stem cell as a potential therapeutic for inflammatory bowel disease- myth or reality? Curr Stem Cell Res Ther 2017 12 644 57 10.2174/1574888X12666170914113633 28914206
Adak S, Mukherjee S, Sen D. Mesenchymal stem cell as a potential therapeutic for inflammatory bowel disease- myth or reality? Curr Stem Cell Res Ther. 2017;12:644–57. 10.2174/1574888X12666170914113633.28914206 10.2174/1574888X12666170914113633
8. Dave M Mesenchymal stem cell therapy for inflammatory bowel disease: a systematic review and Meta-analysis Inflamm Bowel Dis 2015 21 2696 707 10.1097/MIB.0000000000000543 26230863
Dave M, et al. Mesenchymal stem cell therapy for inflammatory bowel disease: a systematic review and meta-analysis. Inflamm Bowel Dis. 2015;21:2696–707. 10.1097/MIB.0000000000000543.26230863 10.1097/MIB.0000000000000543
9. Forbes GM A phase 2 study of allogeneic mesenchymal stromal cells for luminal Crohn’s disease refractory to biologic therapy Clin Gastroenterol Hepatol 2014 12 64 71 10.1016/j.cgh.2013.06.021 23872668
Forbes GM, et al. A phase 2 study of allogeneic mesenchymal stromal cells for luminal Crohn’s disease refractory to biologic therapy. Clin Gastroenterol Hepatol. 2014;12:64–71. 10.1016/j.cgh.2013.06.021.23872668 10.1016/j.cgh.2013.06.021
10. Wang M Intraperitoneal injection (IP), intravenous injection (IV) or anal injection (AI)? Best way for mesenchymal stem cells transplantation for colitis Sci Rep 2016 6 30696 10.1038/srep30696 27488951
Wang M, et al. Intraperitoneal injection (IP), intravenous injection (IV) or anal injection (AI)? Best way for mesenchymal stem cells transplantation for colitis. Sci Rep. 2016;6:30696. 10.1038/srep30696.27488951 10.1038/srep30696
11. Ciccocioppo R et al. Perspectives of the international society for cell & gene therapy gastrointestinal scientific committee on the intravenous use of mesenchymal stromal cells in inflammatory bowel disease (PeMeGi). Cytotherapy. 2019;21:824–839. 10.1016/j.jcyt.2019.05.003.
12. Cheng C Qing-Chang-Hua-Shi granule ameliorates DSS-induced colitis by activating NLRP6 signaling and regulating Th17/Treg balance Phytomedicine 2022 107 154452 10.1016/j.phymed.2022.154452 36150347
Cheng C, et al. Qing-Chang-Hua-Shi granule ameliorates DSS-induced colitis by activating NLRP6 signaling and regulating Th17/Treg balance. Phytomedicine. 2022;107:154452. 10.1016/j.phymed.2022.154452.36150347 10.1016/j.phymed.2022.154452
13. Liu X Salidroside alleviates ulcerative colitis via inhibiting macrophage pyroptosis and repairing the dysbacteriosis-associated Th17/Treg imbalance Phytother Res 2023 37 367 82 10.1002/ptr.7636 36331009
Liu X, et al. Salidroside alleviates ulcerative colitis via inhibiting macrophage pyroptosis and repairing the dysbacteriosis-associated Th17/Treg imbalance. Phytother Res. 2023;37:367–82. 10.1002/ptr.7636.36331009 10.1002/ptr.7636
14. Wen S Stigmasterol restores the balance of Treg/Th17 cells by activating the Butyrate-PPARgamma Axis in Colitis Front Immunol 2021 12 741934 10.3389/fimmu.2021.741934 34691046
Wen S, et al. Stigmasterol restores the balance of Treg/Th17 cells by activating the Butyrate-PPARgamma axis in colitis. Front Immunol. 2021;12:741934. 10.3389/fimmu.2021.741934.34691046 10.3389/fimmu.2021.741934
15. Zhao Y Gegen Qinlian decoction relieved DSS-induced ulcerative colitis in mice by modulating Th17/Treg cell homeostasis via suppressing IL-6/JAK2/STAT3 signaling Phytomedicine 2021 84 153519 10.1016/j.phymed.2021.153519 33640781
Zhao Y, et al. Gegen Qinlian decoction relieved DSS-induced ulcerative colitis in mice by modulating Th17/Treg cell homeostasis via suppressing IL-6/JAK2/STAT3 signaling. Phytomedicine. 2021;84:153519. 10.1016/j.phymed.2021.153519.33640781 10.1016/j.phymed.2021.153519
16. Court AC Mitochondrial transfer from MSCs to T cells induces Treg differentiation and restricts inflammatory response EMBO Rep 2020 21 e48052 10.15252/embr.201948052 31984629
Court AC, et al. Mitochondrial transfer from MSCs to T cells induces Treg differentiation and restricts inflammatory response. EMBO Rep. 2020;21:e48052. 10.15252/embr.201948052.31984629 10.15252/embr.201948052
17. Luz-Crawford P Mesenchymal stem cells generate a CD4 + CD25 + Foxp3 + regulatory T cell population during the differentiation process of Th1 and Th17 cells Stem Cell Res Ther 2013 4 65 10.1186/scrt216 23734780
Luz-Crawford P, et al. Mesenchymal stem cells generate a CD4 + CD25 + Foxp3 + regulatory T cell population during the differentiation process of Th1 and Th17 cells. Stem Cell Res Ther. 2013;4:65. 10.1186/scrt216.23734780 10.1186/scrt216
18. Song WJ Canine adipose tissue-derived mesenchymal stem cells pre-treated with TNF-alpha enhance immunomodulatory effects in inflammatory bowel disease in mice Res Vet Sci 2019 125 176 84 10.1016/j.rvsc.2019.06.012 31247473
Song WJ, et al. Canine adipose tissue-derived mesenchymal stem cells pre-treated with TNF-alpha enhance immunomodulatory effects in inflammatory bowel disease in mice. Res Vet Sci. 2019;125:176–84. 10.1016/j.rvsc.2019.06.012.31247473 10.1016/j.rvsc.2019.06.012
19. Yang H Human induced pluripotent stem cell-derived mesenchymal stem cells promote healing via TNF-alpha-stimulated gene-6 in inflammatory bowel disease models Cell Death Dis 2019 10 718 10.1038/s41419-019-1957-7 31558705
Yang H, et al. Human induced pluripotent stem cell-derived mesenchymal stem cells promote healing via TNF-alpha-stimulated gene-6 in inflammatory bowel disease models. Cell Death Dis. 2019;10:718. 10.1038/s41419-019-1957-7.31558705 10.1038/s41419-019-1957-7
20. Chen W TGF-beta regulation of T cells Annu Rev Immunol 2023 41 483 512 10.1146/annurev-immunol-101921-045939 36750317
Chen W. TGF-beta regulation of T cells. Annu Rev Immunol. 2023;41:483–512. 10.1146/annurev-immunol-101921-045939.36750317 10.1146/annurev-immunol-101921-045939
21. Wang J Zhao X Wan YY Intricacies of TGF-beta signaling in Treg and Th17 cell biology Cell Mol Immunol 2023 20 1002 22 10.1038/s41423-023-01036-7 37217798
Wang J, Zhao X, Wan YY. Intricacies of TGF-beta signaling in Treg and Th17 cell biology. Cell Mol Immunol. 2023;20:1002–22. 10.1038/s41423-023-01036-7.37217798 10.1038/s41423-023-01036-7
22. Ye T Liu X Zhong X Yan R Shi P Nongenetic surface engineering of mesenchymal stromal cells with polyvalent antibodies to enhance targeting efficiency Nat Commun 2023 14 5806 10.1038/s41467-023-41609-8 37726299
Ye T, Liu X, Zhong X, Yan R, Shi P. Nongenetic surface engineering of mesenchymal stromal cells with polyvalent antibodies to enhance targeting efficiency. Nat Commun. 2023;14:5806. 10.1038/s41467-023-41609-8.37726299 10.1038/s41467-023-41609-8
23. Castelo-Branco MT Intraperitoneal but not intravenous cryopreserved mesenchymal stromal cells home to the inflamed colon and ameliorate experimental colitis PLoS ONE 2012 7 e33360 10.1371/journal.pone.0033360 22432015
Castelo-Branco MT, et al. Intraperitoneal but not intravenous cryopreserved mesenchymal stromal cells home to the inflamed colon and ameliorate experimental colitis. PLoS ONE. 2012;7:e33360. 10.1371/journal.pone.0033360.22432015 10.1371/journal.pone.0033360
24. Xu J Embryonic stem cell-derived mesenchymal stem cells promote colon epithelial integrity and regeneration by elevating circulating IGF-1 in colitis mice Theranostics 2020 10 12204 22 10.7150/thno.47683 33204338
Xu J, et al. Embryonic stem cell-derived mesenchymal stem cells promote colon epithelial integrity and regeneration by elevating circulating IGF-1 in colitis mice. Theranostics. 2020;10:12204–22. 10.7150/thno.47683.33204338 10.7150/thno.47683
25. Alawi K Keeble J The paradoxical role of the transient receptor potential vanilloid 1 receptor in inflammation Pharmacol Ther 2010 125 181 95 10.1016/j.pharmthera.2009.10.005 19896501
Alawi K, Keeble J. The paradoxical role of the transient receptor potential vanilloid 1 receptor in inflammation. Pharmacol Ther. 2010;125:181–95. 10.1016/j.pharmthera.2009.10.005.19896501 10.1016/j.pharmthera.2009.10.005
26. Han L Define mesenchymal stem cell from its fate: Biodisposition of Human mesenchymal stem cells in normal and Concanavalin A-Induced Liver Injury mice J Pharmacol Exp Ther 2021 379 125 33 10.1124/jpet.121.000607 34373354
Han L, et al. Define mesenchymal stem cell from its fate: Biodisposition of Human mesenchymal stem cells in normal and concanavalin A-induced liver injury mice. J Pharmacol Exp Ther. 2021;379:125–33. 10.1124/jpet.121.000607.34373354 10.1124/jpet.121.000607
27. Lee RH Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6 Cell Stem Cell 2009 5 54 63 10.1016/j.stem.2009.05.003 19570514
Lee RH, et al. Intravenous hMSCs improve myocardial infarction in mice because cells embolized in lung are activated to secrete the anti-inflammatory protein TSG-6. Cell Stem Cell. 2009;5:54–63. 10.1016/j.stem.2009.05.003.19570514 10.1016/j.stem.2009.05.003
28. Salvadori M Dissecting the Pharmacodynamics and Pharmacokinetics of MSCs to Overcome limitations in their clinical translation Mol Ther Methods Clin Dev 2019 14 1 15 10.1016/j.omtm.2019.05.004 31236426
Salvadori M, et al. Dissecting the Pharmacodynamics and Pharmacokinetics of MSCs to Overcome limitations in their clinical translation. Mol Ther Methods Clin Dev. 2019;14:1–15. 10.1016/j.omtm.2019.05.004.31236426 10.1016/j.omtm.2019.05.004
29. Lee GR. The balance of Th17 versus Treg cells in autoimmunity. Int J Mol Sci. 2018;19. 10.3390/ijms19030730.
30. Hu J Safety and therapeutic effect of mesenchymal stem cell infusion on moderate to severe ulcerative colitis Exp Ther Med 2016 12 2983 9 10.3892/etm.2016.3724 27882104
Hu J, et al. Safety and therapeutic effect of mesenchymal stem cell infusion on moderate to severe ulcerative colitis. Exp Ther Med. 2016;12:2983–9. 10.3892/etm.2016.3724.27882104 10.3892/etm.2016.3724
31. Liu A Human umbilical cord mesenchymal stem cells ameliorate colon inflammation via modulation of gut microbiota-SCFAs-immune axis Stem Cell Res Ther 2023 14 271 10.1186/s13287-023-03471-9 37749611
Liu A, et al. Human umbilical cord mesenchymal stem cells ameliorate colon inflammation via modulation of gut microbiota-SCFAs-immune axis. Stem Cell Res Ther. 2023;14:271. 10.1186/s13287-023-03471-9.37749611 10.1186/s13287-023-03471-9
32. Kean TJ, Lin P, Caplan AI, Dennis JE, MSCs. Delivery routes and engraftment, cell-targeting strategies, and immune modulation. Stem Cells Int. 2013:732742. 10.1155/2013/732742.
33. Jung JW Familial occurrence of pulmonary embolism after intravenous, adipose tissue-derived stem cell therapy Yonsei Med J 2013 54 1293 6 10.3349/ymj.2013.54.5.1293 23918585
Jung JW, et al. Familial occurrence of pulmonary embolism after intravenous, adipose tissue-derived stem cell therapy. Yonsei Med J. 2013;54:1293–6. 10.3349/ymj.2013.54.5.1293.23918585 10.3349/ymj.2013.54.5.1293
34. Moll G Are therapeutic human mesenchymal stromal cells compatible with human blood? Stem Cells 2012 30 1565 74 10.1002/stem.1111 22522999
Moll G, et al. Are therapeutic human mesenchymal stromal cells compatible with human blood? Stem Cells. 2012;30:1565–74. 10.1002/stem.1111.22522999 10.1002/stem.1111
35. Gregoire C Allogeneic mesenchymal stromal cells for refractory luminal Crohn’s disease: a phase I-II study Dig Liver Dis 2018 50 1251 5 10.1016/j.dld.2018.08.015 30195816
Gregoire C, et al. Allogeneic mesenchymal stromal cells for refractory luminal Crohn’s disease: a phase I-II study. Dig Liver Dis. 2018;50:1251–5. 10.1016/j.dld.2018.08.015.30195816 10.1016/j.dld.2018.08.015
36. Algeri M Mesenchymal stromal cells and chronic inflammatory bowel disease Immunol Lett 2015 168 191 200 10.1016/j.imlet.2015.06.018 26170204
Algeri M, et al. Mesenchymal stromal cells and chronic inflammatory bowel disease. Immunol Lett. 2015;168:191–200. 10.1016/j.imlet.2015.06.018.26170204 10.1016/j.imlet.2015.06.018
37. Song JY Umbilical cord-derived mesenchymal stem cell extracts reduce colitis in mice by re-polarizing intestinal macrophages Sci Rep 2017 7 9412 10.1038/s41598-017-09827-5 28842625
Song JY, et al. Umbilical cord-derived mesenchymal stem cell extracts reduce colitis in mice by re-polarizing intestinal macrophages. Sci Rep. 2017;7:9412. 10.1038/s41598-017-09827-5.28842625 10.1038/s41598-017-09827-5
38. Liang L Human umbilical cord mesenchymal stem cells ameliorate mice trinitrobenzene sulfonic acid (TNBS)-induced colitis Cell Transpl 2011 20 1395 408 10.3727/096368910X557245
Liang L, et al. Human umbilical cord mesenchymal stem cells ameliorate mice trinitrobenzene sulfonic acid (TNBS)-induced colitis. Cell Transpl. 2011;20:1395–408. 10.3727/096368910X557245.10.3727/096368910X557245
39. Malinowski M Effect of lumican on the migration of human mesenchymal stem cells and endothelial progenitor cells: involvement of matrix metalloproteinase-14 PLoS ONE 2012 7 e50709 10.1371/journal.pone.0050709 23236386
Malinowski M, et al. Effect of lumican on the migration of human mesenchymal stem cells and endothelial progenitor cells: involvement of matrix metalloproteinase-14. PLoS ONE. 2012;7:e50709. 10.1371/journal.pone.0050709.23236386 10.1371/journal.pone.0050709
40. Ruster B Mesenchymal stem cells display coordinated rolling and adhesion behavior on endothelial cells Blood 2006 108 3938 44 10.1182/blood-2006-05-025098 16896152
Ruster B, et al. Mesenchymal stem cells display coordinated rolling and adhesion behavior on endothelial cells. Blood. 2006;108:3938–44. 10.1182/blood-2006-05-025098.16896152 10.1182/blood-2006-05-025098
41. Wynn RF A small proportion of mesenchymal stem cells strongly expresses functionally active CXCR4 receptor capable of promoting migration to bone marrow Blood 2004 104 2643 5 10.1182/blood-2004-02-0526 15251986
Wynn RF, et al. A small proportion of mesenchymal stem cells strongly expresses functionally active CXCR4 receptor capable of promoting migration to bone marrow. Blood. 2004;104:2643–5. 10.1182/blood-2004-02-0526.15251986 10.1182/blood-2004-02-0526
42. Zhu X, Zhu J. CD4 T Helper Cell subsets and Related Human Immunological disorders. Int J Mol Sci. 2020;21. 10.3390/ijms21218011.
43. Saadh MJ Therapeutic potential of mesenchymal stem/stromal cells (MSCs)-based cell therapy for inflammatory bowel diseases (IBD) therapy Eur J Med Res 2023 28 47 10.1186/s40001-023-01008-7 36707899
Saadh MJ, et al. Therapeutic potential of mesenchymal stem/stromal cells (MSCs)-based cell therapy for inflammatory bowel diseases (IBD) therapy. Eur J Med Res. 2023;28:47. 10.1186/s40001-023-01008-7.36707899 10.1186/s40001-023-01008-7
44. English K French A Wood KJ Mesenchymal stromal cells: facilitators of successful transplantation? Cell Stem Cell 2010 7 431 42 10.1016/j.stem.2010.09.009 20887949
English K, French A, Wood KJ. Mesenchymal stromal cells: facilitators of successful transplantation? Cell Stem Cell. 2010;7:431–42. 10.1016/j.stem.2010.09.009.20887949 10.1016/j.stem.2010.09.009
45. Griffin MD Ritter T Mahon BP Immunological aspects of allogeneic mesenchymal stem cell therapies Hum Gene Ther 2010 21 1641 55 10.1089/hum.2010.156 20718666
Griffin MD, Ritter T, Mahon BP. Immunological aspects of allogeneic mesenchymal stem cell therapies. Hum Gene Ther. 2010;21:1641–55. 10.1089/hum.2010.156.20718666 10.1089/hum.2010.156
46. English K Cell contact, prostaglandin E(2) and transforming growth factor beta 1 play non-redundant roles in human mesenchymal stem cell induction of CD4 + CD25(high) forkhead box P3 + regulatory T cells Clin Exp Immunol 2009 156 149 60 10.1111/j.1365-2249.2009.03874.x 19210524
English K, et al. Cell contact, prostaglandin E(2) and transforming growth factor beta 1 play non-redundant roles in human mesenchymal stem cell induction of CD4 + CD25(high) forkhead box P3 + regulatory T cells. Clin Exp Immunol. 2009;156:149–60. 10.1111/j.1365-2249.2009.03874.x.19210524 10.1111/j.1365-2249.2009.03874.x
47. Li L Human umbilical cord-derived mesenchymal stem cells downregulate inflammatory responses by shifting the Treg/Th17 profile in experimental colitis Pharmacology 2013 92 257 64 10.1159/000354883 24280970
Li L, et al. Human umbilical cord-derived mesenchymal stem cells downregulate inflammatory responses by shifting the Treg/Th17 profile in experimental colitis. Pharmacology. 2013;92:257–64. 10.1159/000354883.24280970 10.1159/000354883
48. Tang RJ Mesenchymal stem cells-regulated Treg cells suppress colitis-associated colorectal cancer Stem Cell Res Ther 2015 6 71 10.1186/s13287-015-0055-8 25889203
Tang RJ, et al. Mesenchymal stem cells-regulated Treg cells suppress colitis-associated colorectal cancer. Stem Cell Res Ther. 2015;6:71. 10.1186/s13287-015-0055-8.25889203 10.1186/s13287-015-0055-8
49. de Farias A Carrillo-Galvez V Martin AB Anderson P TGF-beta and mesenchymal stromal cells in regenerative medicine, autoimmunity and cancer Cytokine Growth Factor Rev 2018 43 25 37 10.1016/j.cytogfr.2018.06.002 29954665
de Farias A, Carrillo-Galvez V, Martin AB, F., Anderson P. TGF-beta and mesenchymal stromal cells in regenerative medicine, autoimmunity and cancer. Cytokine Growth Factor Rev. 2018;43:25–37. 10.1016/j.cytogfr.2018.06.002.29954665 10.1016/j.cytogfr.2018.06.002
50. Liu F MSC-secreted TGF-beta regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway Stem Cell Res Ther 2019 10 345 10.1186/s13287-019-1447-y 31771622
Liu F, et al. MSC-secreted TGF-beta regulates lipopolysaccharide-stimulated macrophage M2-like polarization via the Akt/FoxO1 pathway. Stem Cell Res Ther. 2019;10:345. 10.1186/s13287-019-1447-y.31771622 10.1186/s13287-019-1447-y
51. Cheung TS Galleu A von Bonin M Bornhauser M Dazzi F Apoptotic mesenchymal stromal cells induce prostaglandin E2 in monocytes: implications for the monitoring of mesenchymal stromal cell activity Haematologica 2019 104 e438 41 10.3324/haematol.2018.214767 30846505
Cheung TS, Galleu A, von Bonin M, Bornhauser M, Dazzi F. Apoptotic mesenchymal stromal cells induce prostaglandin E2 in monocytes: implications for the monitoring of mesenchymal stromal cell activity. Haematologica. 2019;104:e438–41. 10.3324/haematol.2018.214767.30846505 10.3324/haematol.2018.214767
52. Gao F et al. Mesenchymal stem cells and immunomodulation: current status and future prospects. Cell Death Dis. 2016;7:e2062. 10.1038/cddis.2015.327.
