
==== Front
PLoS One
PLoS One
plos
PLOS ONE
1932-6203
Public Library of Science San Francisco, CA USA

10.1371/journal.pone.0308095
PONE-D-23-31553
Research Article
Biology and Life Sciences
Cell Biology
Cell Processes
Cell Death
Apoptosis
Biology and Life Sciences
Organisms
Bacteria
Actinobacteria
Mycobacterium Tuberculosis
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Blood Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Cell Biology
Cellular Types
Animal Cells
Immune Cells
White Blood Cells
Macrophages
Biology and Life Sciences
Immunology
Immune Cells
White Blood Cells
Macrophages
Medicine and Health Sciences
Immunology
Immune Cells
White Blood Cells
Macrophages
Biology and life sciences
Genetics
Gene expression
Gene regulation
Small interfering RNA
Biology and life sciences
Biochemistry
Nucleic acids
RNA
Non-coding RNA
Small interfering RNA
Biology and life sciences
Biochemistry
Nucleic acids
RNA
Non-coding RNA
Natural antisense transcripts
MicroRNAs
Biology and life sciences
Genetics
Gene expression
Gene regulation
MicroRNAs
Biology and Life Sciences
Molecular Biology
Molecular Biology Techniques
Transfection
Research and Analysis Methods
Molecular Biology Techniques
Transfection
Biology and Life Sciences
Molecular Biology
Molecular Biology Techniques
Molecular Biology Assays and Analysis Techniques
Gene Expression and Vector Techniques
Protein Expression
Research and Analysis Methods
Molecular Biology Techniques
Molecular Biology Assays and Analysis Techniques
Gene Expression and Vector Techniques
Protein Expression
Biology and Life Sciences
Genetics
Gene Expression
Mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and facilities mycobacterium survival
Mmu-let-7a-5p facilities mycobacteria survival
https://orcid.org/0000-0002-3189-8648
Zhan Xuehua Methodology Validation Writing – original draft 1
Yuan Wenqi Software Validation 1
Ma Rong Conceptualization 1
Zhou Yueyong Validation 2
Xu Guangxian Supervision 3
https://orcid.org/0000-0001-5167-4601
Ge Zhaohui Conceptualization Writing – review & editing 1 *
1 Department of Orthopedics, General Hospital of Ningxia Medical University, Yinchuan, Ningxia, China
2 Clinical Medicine School, Ningxia Medical University, Yinchuan, Ningxia, China
3 The First Dongguan Affiliated Hospital, Guangdong Provincial Key Laboratory of Medical Molecular Diagnostics, School of Medical Technology, Guangdong Medical University, Dongguan, China
Sessa Francesco Editor
University of Catania, ITALY
Competing Interests: The authors have declared that no competing interests exist.

* E-mail: myovid@126.com
3 9 2024
2024
19 9 e030809527 9 2023
17 7 2024
© 2024 Zhan et al
2024
Zhan et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

We have been trying to find a miRNA that can specifically regulate the function of mycobacterial host cells to achieve the purpose of eliminating Mycobacterium tuberculosis. The purpose of this study is to investigate the regulation of mmu-let-7a-5p on macrophages apoptosis and its effect on intracellular BCG clearance. After a series of in vitro experiments, we found that mmu-let-7a-5p could negatively regulate the apoptosis of macrophages by targeting Caspase-3. The extrinsic apoptosis signal axis TNFR1/FADD/Caspase-8/Caspase-3 was inhibited after BCG infection. Up-regulated the expression level of mmu-let-7a-5p increase the cell proliferation viability and inhibit apoptosis rate of macrophages, but down-regulated its level could apparently reduce the bacterial load of intracellular Mycobacteria and accelerate the clearance of residual Mycobacteria effectively. Mmu-let-7a-5p has great potential to be utilized as an optimal candidate exosomal loaded miRNA for anti-tuberculosis immunotherapy in our subsequent research.

School Level Project of Ningxia Medical University XT2023042 https://orcid.org/0000-0002-3189-8648
Zhan Xuehua http://dx.doi.org/10.13039/501100001809 National Natural Science Foundation of China 82360434 https://orcid.org/0000-0001-5167-4601
Ge Zhaohui Zhaohui This work was supported by the National Natural Science Foundation of China [82360434 to Zhaohui Ge] and the School Level Project of Ningxia Medical University [XT2023042 to Xuehua Zhan]. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Data AvailabilityAll relevant data are within the manuscript and its Supporting Information files.
Data Availability

All relevant data are within the manuscript and its Supporting Information files.
==== Body
pmc1. Introduction

The incidence of spinal tuberculosis accounts for 50% -75% of Bone and joint tuberculosis (BJTB) [1, 2]. Traditional anti-tuberculosis drug therapy combined with surgical intervention is commonly utilized for the treatment of spinal tuberculosis. Due to the structure and pharmacokinetic characteristics of first-line anti-tuberculosis drugs, conventional dosage forms are difficult to penetrate the bone marrow-blood barrier (MBB), which resulting in poor anti-tuberculosis efficacy [3, 4]. How to efficiently deliver anti-tuberculosis drugs to the core area of tuberculosis foci has always been a research difficulty in this field. Exosomes are a class of extracellular vesicles which could contain numerous items derived from parental cells and shuttle them to receipt cell [5]. Exosomes can not only be used as capable transport vehicles to deliver traditional drugs, but also the genetic drugs with immunomodulatory functions such as miRNAs and proteins [6–10].Currently, research based on exosomes or extracellular vesicle therapy mainly focused on immune regulation, nervous system diseases, tissue repair and regenerative medicine [11–14]. However, there is no related report on the treatment of spinal tuberculosis.

The clearance of Mycobacterium tuberculosis in lesions is the core process throughout the whole course. It has been shown that the apoptosis of macrophages is closely related to the prognosis and outcome of mycobacteria. Apoptosis of macrophages in the early stage of infection could inhibit the increase of intracellular bacterial load and facilitate the clearance of Mycobacteria [15–17]. In our previous study, we found that mmu-let-7a-5p and its targeted gene Caspase-3 were associated with the regulation of cell growth and death, especially in apoptosis. Therefore, we proposed the bold idea of constructing a novel exosomal drug delivery system loading with rifampin and mmu-let-7a-5p for anti-tuberculosis therapy. It is hoped that traditional anti-tuberculosis drugs can be delivered pass through various biological impediments to increase the drug concentration in spinal tuberculosis areas by the aid of the nano size and low immunogenicity of exosomes. At the same time, the loaded miRNA molecules could also play its anti-tuberculosis immune regulation to accelerate the clearance of mycobacteria by macrophages in order to achieve the multiple purposes of anti-tuberculosis infection. Whereupon, the function of macrophages apoptosis regulated by mmu-let-7a-5p is crucial for our subsequent research.

In the present study, we investigated the influence of mmu-let-7a-5p on macrophages apoptosis and further validated its effect on the clearance of intracellular mycobacteria load in vitro.

2. Methods

2.1 Cell & mycobacteria culture and infection assay

RAW264.7 cells and Mycobacterium bovis Bacillus Calmette-Guérin (BCG) St. Pasteur 1173P2 strain were cultured as we described in our previous study [18], and the infection assay was followed with Bettencourt’s description [19, 20].

2.2 Bioinformatics analysis

Metascape (https://metascape.org) and CyotoHubba in Cytoscape (v3.1.2) were selected to complete the visual analysis of the target genes related to cell growth and death. TargetScan (Mouse v8.0) and DIANA TOOLS were used to predict the seed sequence of mmu-let-7a-5p targeted binding with the 3′UTR of Caspase-3.

2.3 Synthesis of mimics/inhibitor and siRNA & construction of vector

The synthesis of mmu-let-7a-5p mimics, inhibitor and Caspase-3 siRNA and the construction of Caspase-3 expression plasmid were commissioned by Shanghai Gene-Optimal Biological Technology Co., Ltd. The transfection efficiency was determined by fluorescence detection of the transfected cells after construction.

2.4 Cell transfection

A total of 300 uL Opti-MEM I Reduced Serum Medium was transferred into 1.5 mL EP tube, 3ug plasmid or synthetic RNA was added or co-transfected into EP tube and mixed well. According to the instructions, a volume of 9uL Fu GENE ® HD Transfection Reagent was applied into EP tube continuously. The mixture was incubated at room temperature for 15 min and added into the wells subsequently. Fluorescence was observed after 24 hours.

2.5 Dual luciferase reporter gene assay

The 3’UTR- wild type (WT) / mutant type (MUT) sequence of Caspase-3 was constructed into the pmirGLO reporter vector. The mixture containing the reporter vector and mmu-let-7a-5p mimics or inhibitor was co-transfected into different groups. The dual luciferase Reporter Gene assay kit (Beyotime, Shanghai, China) was chosen for detection according to the instructions.

2.6 Cell Counting kit-8

Cells were grouped and transfected with mmu-let-7a-5p mimics / inhibitor and Caspase-3 siRNA / OE followed by BCG stimulation for 4 hours, then washed with PBS. Set infection starting point as 0h, Cell Counting Kit (Beyotime, Shanghai, China) was selected to detect the OD values of cells at different time points post infection.

2.7 Flow cytometry

Cell grouping and transfection process were the same as the CCK-8 experiment. Annexin V-FITC/PI (Solarbio, Beijing, China) was used to examine the apoptosis rate. Briefly, cell suspension was collected after digestion with trypsin without EDTA, centrifuged at 1000 rpm for 5 min, added with 1 mL pre-cooled PBS, centrifuged at 1000 rpm for 5 min, and cell precipitation was retained. After resuspending, the cell concentration was adjusted to 5 × 106 / mL. 100 μL cell suspension was transferred into 5 mL tube, 5 μL Annexin V / FITC was added to mix for 5 min. 5 μL PI solution and 400 μL PBS were added for flow cytometry immediately.

2.8 qRT-PCR

The RNAeasy™ Animal RNA Isolation Kit with Spin Column (Beyotime, Shanghai, China) was used to extract RNA, and the SanPrep Column microRNA Extraction Kit (Sangon Biotech, China) was used to extract miRNA accordance with the instructions. RNA reverse transcription, cDNA verification, preparation of Real time-PCR reaction system and the setting of reaction conditions were the same as previous [18]. GAPDH was a reference gene for qPCR detection of mRNA. The primers information of related genes is listed in Table 1.

10.1371/journal.pone.0308095.t001 Table 1 List of miRNAs and mRNAs primers information.

Primer name	Primer sequence	
mmu-let-7a-5p	RT: CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAACTATAC	
F: ACACTCCAGCTGGGTGAGGTAGTAGGTTGT	
mmu-U6	RT: CGAATTTGCGTGTCATCCTTG
F: CTCGCTTCGGCAGCACATATAC	
Reverse (universal)	TGGTGTCGTGGAGTCG	
Caspase-8	F: GCAGAAAGCGAAGCAGCCTA
R: AGGTTTGCTACCGATTCCGA	
FADD	F: GTTCCTTGGGGGAAGACACC
R: GGCCTCCAAGGATGTGAGAC	
TNFR1	F: AAGGCTGGAAAGCCCCTAAC
R: AGAACTAAAGCCTGGGGTGC	
GAPDH	F: AGGTTGTCTCCTGCGACTTCA
R: TGGTCCAGGGTTTCTTACTCC	
Caspase-3	F: CAGCCAACCTCAGAGAGACA	
R: ACAGGCCCATTTGTCCCATA	

2.9 Western blotting

Membrane and Cytosol Protein Extraction Kit (Beyotime, Shanghai, China) and Enhanced BCA Protein Assay Kit (Beyotime, Shanghai, China) were used to complete the extraction and concentration determination of total proteins. The PVDF membrane was activated by methanol before SDS-PAGE electrophoresis.

The filter paper, gel and PVDF membrane were prepared correctly and then 300 mA constant transfer was started. TNFR1 Rabbit Polyclonal Antibody(1:1000 dilution, AF8196, Beyotime, Shanghai, China); Caspase-3 antibody (Rabbit polyclonal antibody) (1:1000 dilution, AC030, Beyotime, Shanghai, China); Caspase-3 (activated) antibody (Rabbit mAb) (1:1000 dilution, AC033, Beyotime, Shanghai, China); and GAPDH Rabbit Monoclonal Antibody(1:1000 dilution, AF1186, Beyotime, Shanghai, China)were incubated at 4°C overnight. Membranes were incubated with HRP-labeled Goat Anti-Rabbit IgG (1:2000 dilution, Proteintech, USA) as secondary antibody after three times washing. Finally, chemiluminescence detection was completed after primary and secondary antibody incubation.

2.10 ELISA

The expression of TNF-α, IL-6, IL-1β and IL-10 in each group at 48 h after BCG infection were detected by different Enzyme-linked immunosorbent assay (ELISA) Kit (Jianglai Biotech, Shanghai, China). The sample preparation, washing and antibody incubation steps were followed strictly by the instructions. The OD value was detected and the real concentration of the sample was calculated.

2.11 Colony forming unit determination

The infection process was the same as previous[18, 20]. The DMEM containing antibiotics was replaced for further culture for 48 h. The lysis cells were serially diluted and coated with Mycobacterium Solid Culture Medium (Gene-Optimal, Shanghai, China). The cells were further cultured at 37°C for 2–3 weeks, and the number of colonies in the culture dish was counted.

2.12 Statistical analysis

All experiments were set at least three biological repetitions. The data were displayed as mean ± standard deviation. Graphpad Prism 9.0 (GraphPad Software Inc., CA, United States) was used for statistical analysis. Non-paired t test was adopted between the two groups and one-way analysis of variance (ANOVA) in the multiple groups to compare the differences. p < 0.05 was considered to be statistically significant.

3. Results

3.1 The visual analysis and Hub genes

The Metascape visual analysis results indicated that these genes were involved in multiple biological processes and pathways and correlated with the regulation of apoptosis (Fig 1A). Caspase-3, Bcl2l1, Casp8, Xiap, Akt1, Apaf1, Birc3, Bcl2l11, Mcl1 and Diablo were the Hub genes obtained by using CytoHubba for the target genes involved in apoptosis (Fig 1B).

10.1371/journal.pone.0308095.g001 Fig 1 The visual analysis and Hub genes.

(A) The visual enrichment of top 20 terms of target genes related to cell growth and death by Metascapse. (B) Hub genes participated in apoptosis filtered by Cytohubba in Cytoscape (v3.2). The darker the colour of the gene, the higher weight of the gene in the apoptosis process.

3.2 Mmu-let-7a-5p targets 3′UTR of Caspase-3

Bioinformatics analysis predicted that Caspase-3 might be the target gene of mmu-let-7a-5p and the seed sequence of mmu-let-7a-5p was completely complementary to the 152–159 base of the 3′UTR of Caspase-3 in TargetScan (v8.0) (Fig 2A).

10.1371/journal.pone.0308095.g002 Fig 2 The results of the dual luciferase gene reporter assay.

(A) Predicted consequential pairing of target region (top) and miRNA (bottom) in TargetScan(v8.0). (B) The relative luciferase activity normalized to Renilla luciferase activity was detected by the dual luciferase gene reporter assay. *** p < 0.001. n = 3 repeats.

3.3 Verification of mmu-let-7a-5p mimics / inhibitor & Caspase-3 siRNA / OE

After the synthesis of mmu-let-7a-5p mimics / inhibitor gene was completed, the transfection efficiency of Raw264.7 cells was detected to be over 80%. Raw264.7 cells were transfected with NC-mimics, let-7a-5p-mimics, NC-inhibitor and let-7a-5p-inhibitor, and then the expression level of mmu-let-7a-5p was detected by qRT-PCR. U6 was used as an internal reference. As shown in Fig 3A, that the expression level of intracellular mmu-let-7a-5p in Raw264.7 cells was significantly changed after transfection of mimics and inhibitor, respectively. Compared with the NC-inhibitor group, the expression level of let-7a-5p in let-7a-5p inhibitor group was significantly down-regulated, and the difference between groups was statistically significant (p < 0.05). The expression level of let-7a-5p in let-7a-5p mimics group was significantly up-regulated compared with the NC-mimics group. The difference between groups was statistically significant (p < 0.001). The consequences certificated that mmu-let-7a-5p mimics and inhibitor gene synthesis sequence was correct, cell group transfection was successful and reached the expected requirements of the experiment, which can be used for subsequent experiments. After the construction of Caspase-3 over-expression plasmid (Casp3-OE) and the synthesis of siRNA (Casp3-siRNA), the mRNA and protein levels of Caspase-3 were also detected after transfection (Fig 3B and 3C). The results showed that compared with the pcDNA3.1, the mRNA level of Caspase-3 in Casp3-OE group was significantly increased, and the difference between groups was statistically significant (p < 0.001). The protein band of Caspase-3 in Caspase-3 OE group was markedly thickened by WB at the same time, this indicated that the Casp3-siRNA-3 and Caspase-3 OE were successfully constructed and could be used for subsequent experiments (Fig 3D and 3E).

10.1371/journal.pone.0308095.g003 Fig 3 Validation of synthetic chemicals and construction vectors.

(A) qPCR verification of mmu-let-7a-5p mimics and inhibitor, (B) qPCR verification of three Caspase-3 siRNA, (C) qPCR verification of Caspase-3 Over expression plasmid (Casp-3 OE), (D) Western Blotting verification of three Caspase-3 siRNA, (E) Western Blotting verification of Casp-3 OE. * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3 repeats.

3.4 Dual luciferase reporter gene assay

The fluorescence intensity of let-7a-5p mimics + Caspase-3–3′UTR-WT was obviously weakened compared with that of NC mimics + Caspase-3–3′UTR- WT, and the difference between groups was statistically significant (p < 0.001). Compared with the NC mimics + Caspase-3–3′UTR-MUT, the fluorescence activity of let-7a-5p mimics + Caspase-3–3′UTR-MUT had no significant change (Fig 2B). The dual luciferase reporter gene activity assay confirmed mmu-let-7a-5p was targeted to the 3′UTR of Caspase-3, and Caspase-3 was one of the target genes of mmu-let-7a-5p.

3.5 BCG infection up-regulated the expression of mmu-let-7a-5p

qRT-PCR was performed to detect the expression levels of intracellular mmu-let-7a-5p and Caspase-3 at 24 h, 48 h and 72 h after BCG infection (Fig 4). Compared with the control group, the expression level of mmu-let-7a-5p in BCG group decreased slightly at 24 h time point, and the expression level of Caspase-3 was similar to that in the control group. There was no significant difference between the two groups. At 48 h after infection, compared with the control group, mmu-let-7a-5p was increased and Caspase-3 was decreased significantly in the BCG group, and the differences between groups were statistically significant (p < 0.05). At 72 h time point, the expression level of mmu-let-7a-5p and Caspase-3 had no significant differences between the two groups. It can be seen that BCG infection could up-regulate the expression of intracellular mmu-let-7a-5p, while the expression of Caspase-3 displayed the opposite trend.

10.1371/journal.pone.0308095.g004 Fig 4 The relative expression of mmu-let-7a-5p and Caspase-3 at different time points post BCG infection.

* p < 0.05. n = 3 repeats.

3.6 Mmu-let-7a-5p negatively regulates Caspase-3

Meanwhile, the regulations of mmu-let-7a-5p on Caspase-3 were further observed by qRT-PCR and WB. Compared with the NC-mimics group, the mRNA level of Caspase-3 in the mmu-let-7a-5p mimics group was significantly decreased (p < 0.01); Compared with the NC-inhibitor group, the mRNA expression of Caspase-3 in the mmu-let-7a-5p inhibitor group was significantly increased (p < 0.01). The differences between the two groups were statistically significant. WB findings displayed that the protein expression changes of Caspase-3 were consistent with the result of qRT-PCR.

Furthermore, Raw264.7 macrophages were co-transfected with Casp3—OE and NC-mimics or let-7a-5p mimics, respectively. Compared with the NC mimics + Casp3—OE group, Caspase-3 expression level in the mmu-let-7a-5p mimics + Casp3—OE group was down-regulated, and the difference was statistically significant (p < 0.001). When Raw264.7 macrophages were co-transfected with Casp3—siRNA and NC-inhibitor or mmu-let-7a-5p inhibitor, separately, there was no significant difference between the two groups. The results of WB displayed that compared with NC mimics + Caspase-3 OE group, the protein band of Caspase-3 in mmu-let-7a-5p mimics + Caspase-3 OE group was apparently thinner; compared with the NC-inhibitor + Caspase-3—siRNA group, the protein strip of Capsase-3 in the mmu-let-7a-5p inhibitor + Caspase-3—siRNA group was significantly thickened. All of the above findings were presented in Fig 5.

10.1371/journal.pone.0308095.g005 Fig 5 Mmu-let-7a-5p negatively regulates Caspase-3 expression.

(A) The mRNA expression levels of Caspase-3 by qRT-PCR. (B) The relative protein expression levels of Caspase-3 by Western Blotting. (C) The mRNA expression changes of Caspase-3 in Rescue assay. (D) The relative protein expression changes of Caspase-3 in Rescue assay. ** p < 0.01, *** p < 0.001. n = 3 repeats.

3.7 Mmu-let-7a-5p enhances Raw264.7 cell viability

The effects of mmu-let-7a-5p and Caspase-3 on the viability of Raw264.7 cells were further clarified through CCK-8 assay. As shown in Fig 6, compared with the NC mimics group, the OD values of cells in the mmu-let-7a-5p-mimics group were significantly increased at each time points post infection, suggesting that the vitality of cells were enhanced and the difference between the two groups was statistically significant (Fig 6). Compared with the NC inhibitor group, the cell activity in the mmu-let-7a-5p-inhibitor group were decreased at 24 h (p < 0.05), significantly decreased at 48 h (p < 0.01), and slightly decreased at 72 h after infection, but the difference had no statistical significance (Fig 6B). Compared with the NC siRNA group, the activity of cells in the Casp3—siRNA-3 group were significantly increased at each time points after infection (p < 0.01) (Fig 6C). Compared with the pcDNA3.1 group, the cell vitality of cells was decreased in Casp3—OE group both at 24 h and 48 h t after infection. The difference between the two groups was statistically significant (p < 0.05), there was no difference between the two groups that has no statistical significance at 72 h time point (Fig 6D).

10.1371/journal.pone.0308095.g006 Fig 6 Raw264.7 cell viability at different time points.

(A) NC mimics vs let-7a-5p mimics, (B) NC inhibitor vs let-7a-5p inhibitor, (C) NC siRNA vs Caspase-3 siRNA (Casp3-siRNA), (D) pcDNA3.1 vs Caspase-3 Over-expression plasmid (Casp-3-OE). * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3 repeats.

3.8 Mmu-let-7a-5p suppresses Raw264.7 cell apoptosis

In order to observe the effect on apoptosis regulated by mmu-let-7a-5p, Flow Cytometry was used to detect the apoptosis rate of Raw264.7 macrophages in different groups. As can be seen from the Fig 7A–7C, the average apoptosis rate of NC-mimics group was 29.60% ± 0.1922 and the mmu-let-7a-5p mimics group was 26.70% ± 0.367. Compared with NC-mimics group, the apoptosis rate in the mmu-let-7a-5p mimics group was significantly reduced and the difference between the two groups was statistically significant (p < 0.01). The average apoptosis rate of NC-inhibitor group was 28.24% ± 0.4683 and the mmu-let-7a-5p inhibitor group was 33.14% ± 0.5453. Compared with NC-inhibitor group, the apoptosis rate in the mmu-let-7a-5p inhibitor group was significantly increased (p < 0.01). In addition, the average apoptosis rate of the NC-siRNA group was 36.03% ± 0.2226 and the Casp3—siRNA-3 group was 30% ± 0.374. Compared with the NC-siRNA group, the apoptosis rate in the Casp3—siRNA-3 group was decreased and the difference between these two groups was statistically significant (p < 0.001). The average apoptosis rate in pcDNA3.1 group was 73.83% ± 0.289 and the Casp3—OE group was 86.16% ± 0.3518. Compared with the pcDNA3.1 group, the apoptosis rate in the Casp3—OE group was obviously increased and the difference was also statistically significant (p < 0.001).

10.1371/journal.pone.0308095.g007 Fig 7 Apoptosis rate of Raw264.7 cells in different groups at 48 hours after BCG infection.

(A) The results of Flow Cytometry, (B) Comparison of let-7a-5p mimics and inhibitor groups, (C) Comparison of Casp-3 siRNA and Casp-3 OE groups, (D) Comparison in multiple groups. ** p < 0.01, *** p < 0.001. n = 3 repeats.

At the same time, one-way ANOVA was adopted to compare the apoptosis rates in the different groups. It was found in Fig 7D that compared with the Casp3—siRNA-3 group, the apoptosis rate in the mmu-let-7a-5p mimics group was decreased (p < 0.01), while significantly increased in the mmu-let-7a-5p inhibitor group (p < 0.01). Compared with the Casp3—siRNA-3 group, the apoptosis rate in the Casp3—OE group was significantly increased (p < 0.001). It can be seen that up-regulating the expression of mmu-let-7a-5p in Raw264.7 cells or silencing the expression of Caspase-3 could apparently suppress the apoptosis rate of macrophages, but down-regulating the expression of endogenous mmu-let-7a-5p or over-expressing the expression of intracellular Caspase-3 could increase the apoptosis rate of Raw264.7 by contrast.

3.9 BCG restrains TNFR1/FADD/Caspase-8/Caspse-3 signal axis

qRT-PCR was performed to detect the core genes in the extrinsic apoptotic signaling pathway mediated by TNFR1 (Fig 8A–8D). The consequences manifested that compared with the control group, the expression level of TNFR1, FADD and Caspase-3 were decreased in the experiment groups, and the differences were statistically significant (p < 0.05). The expression level of Caspase-8 also showed a downward trend in the experiment group, but a slight rise in the let-7a-5p mimics + BCG group, however, there was no significant difference between the two groups compared with the control group. The comparative analysis of differences among multiple groups demonstrated that there were no significant differences in the expression of TNFR1 and FADD in let-7a-5p mimics + BCG and let-7a-5p inhibitor + BCG groups. The expression level of Caspase-8 in let-7a-5p inhibitor + BCG group was lower than that in let-7a-5p mimics + BCG group, and the difference was statistically significant (p < 0.05). The expression differences of Caspase-3 in different experiment groups were also statistically significant (p < 0.001). Moreover, the protein expression changes of TNFR1, Caspase-3 Pro and Caspase-3 cleaved were detected by Western Blotting (Fig 8E). The results displayed that all of the three protein expressions were increased in the let-7a-5p mimics / inhibitor + BCG group but decreased in the BCG group compared with the control group, and the differences between the two groups were statistically significant. It can be seen that compared with the BCG group, the expression changes of the above three proteins in let-7a-5p mimics + BCG group were similar with the let-7a-5p inhibitor + BCG group, and the differences between those groups were statistically significant (Fig 8F–8H). Furthermore, it was found that the protein expression change of TNFR1 in the BCG group was opposite to the previous mRNA results, while the expression changes of Caspase-3 Pro and Caspase-3 cleaved in the BCG group were basically consistent with the mRNA results.

10.1371/journal.pone.0308095.g008 Fig 8 The detection of core genes in TNFR1-mediated extrinsic apoptosis pathway.

(A-D) The mRNA expression levels of TNFR1, FADD, Caspase-8 and Caspase-3 by qRT-PCR, (E) The protein expression changes of TNFR1, Caspase-3 Pro and Caspase-3 cleaved by Western Blotting, (F-H) Quantitative analysis of TNFR1, Caspase-3 Pro and Caspase-3 cleaved protein expression in Western Blotting. * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3 repeats.

3.10 Caspase-3 siRNA inhibits TNF-α and IL-6 secretion

The expression levels of inflammatory cytokines at 48 hours after BCG infection were examined by ELISA. The results were presented in Fig 9. Compared with the control group, the secretion levels of TNF-α and IL-6 were significantly increased in the experimental groups except the Caspase-3 siRNA + BCG group, and the differences between the two groups were statistically significant (p < 0.001). The secretion of TNF-α and IL-6 was obviously decreased in the Caspase-3 siRNA + BCG group, and the difference between the two groups was also statistically significant. The expression of IL-1β and IFN-γ were not detected in each group. It indicated that Caspase-3 siRNA could inhibit the secretion of TNF-α and IL-6.

10.1371/journal.pone.0308095.g009 Fig 9 The expression levels of inflammatory cytokines at 48 hours after BCG infection by ELISA.

(A) The expression changes of TNF-α in different groups, (B) The expression changes of IL-6 in different groups. * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3 repeats.

3.11 Mmu-let-7a-5p facilities BCG survival in Raw264.7 macrophage

The colony forming unit determination consequences displayed that compared with the control group treated with BCG stimulation alone, the CFU counts were significantly increased in the mmu-let-7a-5p mimics group and Caspase-3 siRNA group (p < 0.01) and decreased in the mmu-let-7a-5p inhibitor group and Caspase-3 OE group (p < 0.05), the differences were statistically significant (Fig 10).

10.1371/journal.pone.0308095.g010 Fig 10 The results of mycobacteria colony forming unit (CFU) determination.

(A) Mycobacteria colony forming unit counts in different groups after ×106 dilution. (B) The CFU counts quantitative analysis in multiple groups. * p < 0.05, ** p < 0.01, *** p < 0.001. n = 3 repeats.

4. Discussion

Studies have found that the fate of infected macrophages influenced the destiny of mycobacteria and the prognosis of tuberculosis infection to a certain degree. If macrophages underwent apoptosis, they could not only accelerate the progress in clearing intracellular mycobacteria at the early stage of infection, but also activate adaptive immune responses by antigen presentation to reduce bacterial load in the host [15–17, 21, 22]. Although a large number of studies have been reported on apoptosis pathways related to tuberculosis infection [23–26], the mechanism of how Mycobacterium tuberculosis regulates macrophages apoptosis remains unclear. The majority of previous studies explored the expression differences and functions of miRNA in macrophages post Mycobacterium tuberculosis infection from the cellular level, while we attempted to investigate from the exosome level in our previous study [18]. We found that BCG could change the profile of miRNA in exosomes derived from the infection group cell culture supernatants. The expression of mmu-let-7a-5p and other five miRNAs were up-regulated in the infection group. Bioinformatics analysis indicated that mmu-let-7a-5p and its target genes were involved in multiple biological processes and pathways and correlated with the regulation of apoptosis. Similar findings were reported, Aplipoor et al. [27] infected human monocyte-derived macrophages with BCG and identified a complex set of exosomal miRNAs. The enrichment analysis illustrated that they were primarily taken part in the regulation of host metabolic progression which participate in protective immunity of the host, and this effect ultimately leads to the persistence of intracellular bacteria. Mtb is a facultative intracellular parasite. Macrophages were the first barrier to defend the Mtb invasion, at the same time, they can be utilized as a potential tent by Mtb to induce latent infections [28–30]. There is evidence that bacteria could reverse the apoptosis process of macrophages by manipulating host miRNAs to achieve its immune escape and persistent survival [31, 32], but the specific mechanisms are still unclear. Macrophage apoptosis has been considered as an effective protecting mechanism for controlling tuberculosis infection and plays a key role in the clearance of intracellular Mycobacterium tuberculosis for a long time [26].

Let-7 is the second miRNA discovered after lin-4, which is extremely conserved in species including humans [33]. Since its discovery, let-7 has expanded greatly and paved the way for non-coding RNA (ncRNA) research. It has been found that let-7 family members are important regulatory factors that participate in the regulation of various human diseases [33–36]. Previous studies on let-7 family mainly focus on cancer and viral infection. Tsang et al. first reported in 2008 that let-7a can affect drug-induced apoptosis of A431 cells and HepG2 cells through Caspase-3; Fasihi-Ramandi et al. found in 2018 that let-7a-5p could block Caspase-3 to induce apoptosis of HL60 cells and inhibit the proliferation of AML [37]. However, there were few studies on let-7a-5p and Caspase-3 in tuberculosis infection.

The bioinformatics analysis and the validation of dual luciferase reporter gene assay confirmed that Caspase-3 was one of the target genes of mmu-let-7a-5p. We examined the intracellular miRNA expression changes at different time points after BCG infection. The results showed that compared with the control group, the expression level of intracellular mmu-let-7a-5p fluctuated with time after BCG infection, showing an overall upward trend. The expression of intracellular mmu-let-7a-5p increased significantly at 48 h after BCG infection, which was consistent with the results of high-throughput sequence. In the meantime, the expression of Caspase-3 showed the opposite trend with mmu-let-7a-5p, this indicated that BCG infection could up-regulate the expression of mmu-let-7a-5p in Raw264.7 cells. However, whether mmu-let-7a-5p could inhibit the apoptosis of macrophages by targeting Caspase-3, which was beneficial to the survival of mycobacteria in the cell and escape immune clearance needed to be further explored.

Apoptosis is a programmed cell death by activating Caspase to clear damaged or multiple cells [38, 39]. Cysteine Aspartate Acid Specific Proteases (Caspase) are a family of proteases closely related to the regulation of apoptosis [40, 41]. They are divided into Initiators (Caspase-2 / -8 / -9 / -10) and Effectors (Caspase-3 / -6 / -7) according to the presence or absence of specific N-terminal interaction domain proteins. Caspase-3 is a key effector protein kinase, which needs to be activated under the action of other family members. Once the enzyme is activated, irreversible programmed cell death will occur [42].

CCK-8 assay and flow cytometry were utilized to detect the proliferation ability, viability and apoptosis rate of Raw264.7 cells in different groups. Up- regulating the expression of mmu-let-7a-5p in cells or silencing Caspase-3 significantly enhanced the proliferation ability and viability and decreased the apoptosis rate of the cells, while down-regulating of mmu-let-7a-5p or over-expressing of Caspase-3 had the contrary consequence on the cell proliferation and cell viability even the apoptosis rate. In other words, mmu-let-7a-5p negatively regulates the apoptosis of Raw264.7 cells, whilst Caspase-3 positively regulates the apoptosis of Raw264.7 cells. Rescue experiment confirmed that mmu-let-7a-5p could attenuate the biological effects caused by Caspase-3 OE to a certain extent, which indicated that mmu-let-7a-5p could directly and negatively regulate Caspase-3 expression.

We detected the expression changes of inflammatory factors TNF-α, IL-6, IL-1β and IFN-γ in the supernatant of cells in each group at the time point of 48 h after BCG infection. Compared with the control group, the expressions of TNF-α and IL-6 were significantly increased in the experimental groups except the Caspase-3 siRNA group and the expression of IL-1β and IFN-γ could not be detected at the same time. Overexpression of mmu-let-7a-5p could significantly increase the secretion of TNF-α while inhibiting the expression of mmu-let -7a-5p could obviously increase the secretion of IL-6. The expression of Caspase-3 had a certain correlation with the secretion of TNF-α and IL-6. Silencing the expression of Caspase-3 was capable of inhibiting the production of TNF-α and IL-6, but it cannot completely rule out the influence of Off-Target effect caused by cell transfection reagent and other factors on the function of Raw264.7 cells.

As a key effector of apoptosis, the activation of Caspases mainly mediated extrinsic and intrinsic apoptosis [43, 44]. Mitochondrial outer membrane permeability (MOMP) changes and cytochrome C release are the central events of this pathway, followed by apoptotic protease activation factor (Apaf-1) combined with cytochrome C to form apoptotic bodies to further activate Caspase-9. The extrinsic pathway stimulates the TNF receptor subfamily members on the cell membrane surface, such as TNFRI, Fas or TRAILR by specific ligands such as TNF-α, FasL or TRAIL, and then initiates, which further mediates the recruitment and activation of Caspase-8 / -10 through DISC. DISC is a death-induced signaling complex composed of Fas-related death domain protein (FADD) and / or TNFR-related death domain protein (TRADD) [45]. No matter which apoptotic pathway Caspases are activated, they will eventually mediate the apoptotic effect executor Caspase-3 activation to initiate apoptosis. Perforin and granzyme B are important proteins released by cytotoxic lymphocytes such as CTL and NK [46, 47]. They also directly initiate and activate Caspase to induce apoptosis.

In the process of viral and bacterial infections infection, extrinsic apoptosis initiated by the binding of TNFR-specific ligand TNF-α to cell surface TNFR1 is a way for host cells to clear mycobacterial pathogens [48–51]. We detected the expression changes of key genes of TNFR1/FADD/Caspase-8/Caspase-3 signaling axis in this apoptosis pathway by qRT-PCR. Compared with the control group, the expression of TNFR1, FADD, Caspase-8 and Caspase-3 were significantly down-regulated in the BCG groups, indicating that the TNFR1/FADD/Caspase-8/Caspase-3 signaling axis of extrinsic apoptosis mediated by TNFR1 was inhibited, which also explained to some extent that BCG infection could inhibit the apoptosis of macrophages to avoid being cleared by macrophages and be beneficial to their persistence in the host cells. In addition, the changes of mmu-let-7a-5p expression level in Raw264.7 macrophages had no significant effect on the expression of TNFR1 and FADD, and the expression of Caspase-8 in let-7a-5p inhibitor group was lower than that in let-7a-5p mimics group, while Caspase-3 was significantly correlated with the expression changes of intracellular let-7a-5p. These results also certificated that mmu-let-7a-5p could directly and negatively regulate the key executive molecule Caspase- 3 expressions during the apoptosis.

Generally, Caspase-3 has two forms in vivo, one is an inactive zymogen, the full-length Caspase-3 (Caspase-3 Pro), and the other is an active activated Caspase-3 (Caspase-3 cleaved) [40, 42]. The Caspase-3 originally has two restriction sites, and the activation of the full-length Caspase-3 requires cleavage at these two restriction sites to generate the biologically active activated Caspase-3 fragment (17 kDa) and inactive fragments. To our knowledge, the detection of the activated Caspase-3 fragment at the protein level should be an accurate indicator for proving the occurrence of apoptosis. Therefore, we detected the protein expression changes of Caspase-3 clevaed, Caspase-3 Pro and TNFR1 by Western Blot. Compared with the control group, all of the three proteins were obviously increased in the BCG + let-7a-5p mimic / inhibitor groups. Combined with the qRT-PCR results, we found that the protein expression of TNFR1 were different from the mRNA results. We could not completely explain the real reason behind this phenomenon, however, it is certain that the protein expression of Caspase-3 Pro and Caspase-3 cleaved in the BCG group was decreased compared with the control group, and the decrease of Caspase-3 cleaved was more significant. This was basically consistent with the qPCR results of mRNA, which implied that BCG infection can inhibit the apoptosis of macrophages. It also provided a relatively strong theoretical basis for elucidating the mechanism of immune escape of Mycobacterium.

Finally, we estimated the intracellular bacterial load and clearance rate of mycobacteria by the determination of colony formation unit. The results showed that mmu-let-7a-5p positively regulated the intracellular bacterial load and facilitated its survival, while Caspase-3 negatively modulated the intracellular bacterial load and was beneficial to the clearance of mycobacteria in macrophages.

5. Conclusion

Mmu-let-7a-5p negatively regulates the apoptosis of Raw264.7 macrophages by targeting Caspase-3. Down-regulated the expression of mmu-let-7a-5p facilities the clearance of residual mycobacteria and attenuation the bacterial load of intracellular mycobacteria. Therefore, mmu-let-7a-5p has the potential to be a target for anti-tuberculosis immunotherapy. In our subsequent study, we will expect to develop a novel exosomal drug system for synergistic delivery of mmu-let-7a-5p and rifampicin for the treatment of bone and joint tuberculosis.

Supporting information

S1 Raw images The data including original uncropped and unadjusted blot/gel images of this manuscript.

(PDF)

Abbreviations

CFU Colony forming unit

EDTA Ethylenediaminetetraacetic acid

ELISA Enzyme-linked immunosorbent assay

FADD Fas associated via death domain

FITC Fluorescein isothiocyanate

IL-6 Interleukin 6

IL-1β Interleukin 1 beta

IL-10 Interleukin 10

OD Optical density

PBS Phosphate buffered saline

TB Tuberculosis

TBST Tris-Buffered saline tween-20

TEM Transmission electron microscopy

TNFR1 Tumor necrosis factor receptor superfamily member 1A

UC Ultracentrifugation

10.1371/journal.pone.0308095.r001
Decision Letter 0
Sessa Francesco Academic Editor
© 2024 Francesco Sessa
2024
Francesco Sessa
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
9 Jan 2024

PONE-D-23-31553mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and promote facilities mycobacteria survivalPLOS ONE

Dear Dr. Ge,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Feb 23 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Francesco Sessa, Ph.D., MS

Academic Editor

PLOS ONE

Journal requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. Note from Emily Chenette, Editor in Chief of PLOS ONE, and Iain Hrynaszkiewicz, Director of Open Research Solutions at PLOS: Did you know that depositing data in a repository is associated with up to a 25% citation advantage (https://doi.org/10.1371/journal.pone.0230416)? If you’ve not already done so, consider depositing your raw data in a repository to ensure your work is read, appreciated and cited by the largest possible audience. You’ll also earn an Accessible Data icon on your published paper if you deposit your data in any participating repository (https://plos.org/open-science/open-data/#accessible-data).

3. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match.

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

4. Please provide a complete Data Availability Statement in the submission form, ensuring you include all necessary access information or a reason for why you are unable to make your data freely accessible. If your research concerns only data provided within your submission, please write "All data are in the manuscript and/or supporting information files" as your Data Availability Statement.

5. PLOS requires an ORCID iD for the corresponding author in Editorial Manager on papers submitted after December 6th, 2016. Please ensure that you have an ORCID iD and that it is validated in Editorial Manager. To do this, go to ‘Update my Information’ (in the upper left-hand corner of the main menu), and click on the Fetch/Validate link next to the ORCID field. This will take you to the ORCID site and allow you to create a new iD or authenticate a pre-existing iD in Editorial Manager. Please see the following video for instructions on linking an ORCID iD to your Editorial Manager account: https://www.youtube.com/watch?v=_xcclfuvtxQ.

6. Please amend either the title on the online submission form (via Edit Submission) or the title in the manuscript so that they are identical.

7. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Additional Editor Comments:

This study aims to explore the impact of mmu-let-7a-5p on Raw264.7 mononuclear macrophage apoptosis and its influence on intracellular Bacillus Calmette-Guérin (BCG) load in vitro. While the study holds potential interest for readers, there are several significant changes required.

The abstract section needs enhancement, specifically in introducing the theme, outlining the aims, and summarizing methods and results. Additionally, the conclusion section should outline future research directions, as the current presentation is unclear.

The introduction section should also be improved with background information relating to the study's aims. Furthermore, the material and methods section would benefit from the inclusion of a schematic diagram illustrating the study's protocol and a justification for using GAPDH as a reference gene for qPCR detection of mRNA. Additionally, the authors should provide the original figures of the western blot as supplementary files for the results section and submit the main raw data as supplementary files.

In the discussion section, the authors should refrain from comparing the present study's data to their previous findings and expand the analysis to include international data. Moreover, it should be important to insert the section limitations.

Lastly, the conclusion section should suggest future research directions.

Minor points:

- English should be reviewed by a native speaker.

- Please, check the use of reference manager software (Error! Reference source not found..-> line 121).

- The short form should be introduced by the extension form the first time; subsequently, it should be used through the text. Please, check all abbreviations.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: No

Reviewer #2: Partly

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: I Don't Know

Reviewer #2: N/A

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: No

Reviewer #2: Yes

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: I am sorry that I have little understanding of the content of this article and cannot make scientific and correct judgments about it. Please find another reviewer. I'm sorry that I clicked on 'accept review' earlier (before seeing the manuscript) because it caused me to review the manuscript without being familiar with it, which is unfair to the author.

Reviewer #2: This study found that mmu-let-7a-5p regulates the mycobacterial load in macrophages through apoptosis, which is of certain value and innovation, because in addition, reports about it focus on tumors and cardiovascular diseases, and few reports are related to infectious diseases. But there are some issues in the article that need to be revised

1. The figure legends were not clear, and there was no explanation of the production method or number of replicates for each group of samples.

2. There are A-H graphs in Figure 8, but only A-B is explained and does not match

3. There are some columnar statistical charts, although the p-value is less than 0.05, the actual difference is not significant, which usually means that there may be some deviation between the statistical significance and the actual biological significance. As shown in Figure 8F, Figure 7B, etc

4. Figure 8G and Figure 8H, qRT PCR to detect mRNA of Caspase-3 Pro and Caspase-3 cleared. In fact, qRT PCR cannot distinguish between Caspase-3 Pro and Caspase-3 cleared. You need to explain.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

Attachment Submitted filename: review comment1.docx

10.1371/journal.pone.0308095.r002
Author response to Decision Letter 0
Submission Version1
19 Mar 2024

Dear Editors and Reviewers:

Thank you for your letter and for the reviewer’s comments concerning our manuscript entitled “mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and promote facilities mycobacteria survival” [manuscript number: PONE-D-23-31553].

First of all, please let me express my respect and sincere thanks for your conscientious work attitude. Those comments are all valuable and very helpful for revising and improving our manuscript, as well as the important guiding significance to our researchers.

Review comments

This study found that mmu-let-7a-5p regulates the mycobacterial load in macrophages through apoptosis, which is of certain value and innovation, because in addition, reports about it focus on tumors and cardiovascular diseases, and few reports are related to infectious diseases. But there are some issues in the article that need to be revised

1. The figure legends were not clear, and there was no explanation of the production method or number of replicates for each group of samples.

2. There are A-H graphs in Figure 8, but only A-B is explained and does not match

3. There are some columnar statistical charts, although the p-value is less than 0.05, the actual difference is not significant, which usually means that there may be some deviation between the statistical significance and the actual biological significance. As shown in Figure 8F, Figure 7B, etc

4. Figure 8G and Figure 8H, qRT PCR to detect mRNA of Caspase-3 Pro and Caspase-3 cleared. In fact, qRT PCR cannot distinguish between Caspase-3 Pro and Caspase-3 cleared. You need to explain.

Reply

We have studied comments carefully and have made correction which we hope meet with approval. Revised portion are marked in red in the paper. The main corrections in the paper and the responds to the reviewer’s comments are as flowing:

1. The figure legends were not clear, and there was no explanation of the production method or number of replicates for each group of samples.

Thank you for your comments. We have revised our figure legends and annotated description of replicates for each group of samples.

2. There are A-H graphs in Figure 8, but only A-B is explained and does not match

We are very sorry for our negligence of these mistakes in the manuscript writing and we have carefully revised these mistakes.

3. There are some columnar statistical charts, although the p-value is less than 0.05, the actual difference is not significant, which usually means that there may be some deviation between the statistical significance and the actual biological significance. As shown in Figure 8F, Figure 7B, etc.

We are extremely grateful to Reviewer for pointing out this problem. We have double checked the raw data and re-calculated the statistics by using Graphpad Prism 9.0. There are indeed significant differences in the results of statistical charts in our manuscripts.

4. Figure 8G and Figure 8H, qRT PCR to detect mRNA of Caspase-3 Pro and Caspase-3 cleared. In fact, qRT PCR cannot distinguish between Caspase-3 Pro and Caspase-3 cleared. You need to explain.

Due to our negligence, we did not explain exactly about the figure legends, especially Figure 8. In fact, Figure 8.F-H were the quantitative analysis of TNFR1, Caspase-3 Pro and Caspase-3 cleaved protein expression in Western Blotting, they were not the expression level of mRNA.

Additional Editor Comments

This study aims to explore the impact of mmu-let-7a-5p on Raw264.7 mononuclear macrophage apoptosis and its influence on intracellular Bacillus Calmette-Guérin (BCG) load in vitro. While the study holds potential interest for readers, there are several significant changes required.

1. The abstract section needs enhancement, specifically in introducing the theme, outlining the aims, and summarizing methods and results. Additionally, the conclusion section should outline future research directions, as the current presentation is unclear.

2. The introduction section should also be improved with background information relating to the study's aims. Furthermore, the material and methods section would benefit from the inclusion of a schematic diagram illustrating the study's protocol and a justification for using GAPDH as a reference gene for qPCR detection of mRNA. Additionally, the authors should provide the original figures of the western blot as supplementary files for the results section and submit the main raw data as supplementary files.

3. In the discussion section, the authors should refrain from comparing the present study's data to their previous findings and expand the analysis to include international data. Moreover, it should be important to insert the section limitations.

4. Lastly, the conclusion section should suggest future research directions.

Reply

1. The abstract section needs enhancement, specifically in introducing the theme, outlining the aims, and summarizing methods and results. Additionally, the conclusion section should outline future research directions, as the current presentation is unclear.

Thank you for your comments. Considering the Editor’s suggestion, we have re-written the abstract section part.

Abstract: We have been trying to find a miRNA that can specifically regulate the function of mycobacterial host cells to achieve the purpose of eliminating Mycobacterium tuberculosis. The purpose of this study is to investigate the regulation of mmu-let-7a-5p on macrophages apoptosis and its effect on intracellular BCG clearance. After a series of in vitro experiments, we found that mmu-let-7a-5p could negatively regulate the apoptosis of macrophages. by targeting Caspase-3. The extrinsic apoptosis signal axis TNFR1/FADD/Caspase-8/Caspase-3 was inhibited after BCG infection. Up-regulated the expression level of mmu-let-7a-5p increase the cell proliferation viability and inhibit apoptosis rate of macrophages, but down-regulated its level could apparently reduce the bacterial load of intracellular Mycobacteria and accelerate the clearance of residual Mycobacteria effectively. Mmu-let-7a-5p has great potential to be utilized as an optimal candidate exosomal loaded miRNA for anti-tuberculosis immunotherapy in our subsequent research.

2. The introduction section should also be improved with background information relating to the study's aims. Furthermore, the material and methods section would benefit from the inclusion of a schematic diagram illustrating the study's protocol and a justification for using GAPDH as a reference gene for qPCR detection of mRNA. Additionally, the authors should provide the original figures of the western blot as supplementary files for the results section and submit the main raw data as supplementary files.

Thank you for your comments and we have updated the background information of the introduction section. Furthermore, a schematic diagram was supplied to the material and methods.

Glyceraldehyde-3-phosphate Dehydrogenase (GAPDH) is widely present in many organisms and is abundant in cells, accounting for 10% -20% of the total protein. The gene has a highly conserved sequence, which is highly expressed in almost all tissues. The protein expression in the same cell or tissue is generally constant, and it is not affected by the induction substances such as partial recognition check point and phorbol lipid. It has been commonly used as a reference gene in RT-qPCR assays for gene and protein expression analysis. Due to this, we chose GAPDH as a reference gene for qPCR detection of mRNA.

Additionally, we have re-submitted the original figures of the western blot as supplementary files for the results section and submit the main raw data as supplementary files.

3. In the discussion section, the authors should refrain from comparing the present study's data to their previous findings and expand the analysis to include international data. Moreover, it should be important to insert the section limitations.

Thank you for your comments. We have modified the discussion section according to your comments.

4. The conclusion section should suggest future research directions.

Thank you for your comments. Based on our primary research, we will expect to construct a new multiple drug delivery system with exosomes for tuberculosis treatment in the future, which loaded miRNA and traditional anti-tuberculosis drug rifampin. This was mentioned in the conculsion.

Conclusion: Mmu-let-7a-5p negatively regulates the apoptosis of Raw264.7 macrophages by targeting Caspase-3. Down-regulated the expression of mmu-let-7a-5p facilities the clearance of residual mycobacteria and attenuation the bacterial load of intracellular mycobacteria. Therefore, mmu-let-7a-5p has the great potential to be utilized as a candidate miRNA for the construction of novel exosomal drug delivery system loading with rifampin for anti-tuberculosis therapy in our subsequent research.

Minor points:

- English should be reviewed by a native speaker.

- Please, check the use of reference manager software (Error! Reference source not found..-> line 121).

- The short form should be introduced by the extension form the first time; subsequently, it should be used through the text. Please, check all abbreviations.

Reply

1. English should be reviewed by a native speaker.

Thank you for your advice. We not only invited an English-speaking friend from the United States to help polish our manuscript. Our manuscripts are also edited by one or more highly qualified native English editors of AJE for appropriate English language, grammar, punctuation, spelling and overall style.

2. Please, check the use of reference manager software (Error! Reference source not found.-> line 121).

Thank you for your comments. We are very sorry for our negligence of the mistake in line 121 of the manuscript and we have revised the mistake.

3. The short form should be introduced by the extension form the first time; subsequently, it should be used through the text. Please, check all abbreviations.

According to the Reviewer’s suggestion, we have double checked all the abbreviations in our manuscript.

We tried our best to improve the quality of our manuscript and made some changes to the manuscript. These changes will not influence the content and framework of the paper. And we not only listed the changes in the email but also marked in red in the revised manuscript. We appreciate Editors / Reviewers’ warm work earnestly, and hope that the correction will meet with approval.

Attachment Submitted filename: Response to Reviewers&#39.docx

10.1371/journal.pone.0308095.r003
Decision Letter 1
Sessa Francesco Academic Editor
© 2024 Francesco Sessa
2024
Francesco Sessa
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
22 May 2024

PONE-D-23-31553R1Mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and facilities mycobacterium survivalPLOS ONE

Dear Dr. Ge,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Jul 06 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Francesco Sessa, Ph.D., MS

Academic Editor

PLOS ONE

Journal Requirements:

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Additional Editor Comments:

The reviewer suggested minor revision and I agree with his comments.

[Note: HTML markup is below. Please do not edit.]

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. If the authors have adequately addressed your comments raised in a previous round of review and you feel that this manuscript is now acceptable for publication, you may indicate that here to bypass the “Comments to the Author” section, enter your conflict of interest statement in the “Confidential to Editor” section, and submit your "Accept" recommendation.

Reviewer #3: (No Response)

**********

2. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #3: Yes

**********

3. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #3: Yes

**********

4. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #3: Yes

**********

5. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #3: Yes

**********

6. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #3: The re-submitted manuscript entitled “Mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and facilities mycobacterium survival” by Zhan et al have made considerable modifications, however, there are still some minor concerns that need further addressed before accept.

1. Line 253 “3.7 Mmu-let-7a-5p enhances Raw264.7 cell proliferation and viability”, according to Fig 6 and its-related contents, the current subtitle of 3.7 needs to rethink and refine, especially only CCK-8 results whether could support the cell proliferation as authors claim?

2. Figure 7, if possible, suggests the authors add a group that is just Raw264.7 cells without anything as a negative control. The current apoptotic data from Nc-mimics and NC-siRNA almost reached 30%, whether the Nc-mimics and NC-siRNA could promote apoptosis? To exclude the possibility of higher apoptotic rates such as Nc-mimics and NC-siRNA groups, the cell picture from each should provide additional support.

3. In Fig 10, it’s better to add the dilution index on the top of panel A.

4. Considering the large amounts of data and results of this study, a graphic abstract is helpful if it is provided.

**********

7. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #3: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10.1371/journal.pone.0308095.r004
Author response to Decision Letter 1
Submission Version2
15 Jul 2024

Response to Reviewers

Dear Editors and Reviewers,

Thank you for your response and for the reviewer’s comments concerning our manuscript entitled “Mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and promote facilities mycobacteria survival” [manuscript number: PONE-D-23-31553R1].

Please let me express my respect and sincere thanks for your conscientious work attitude. Those comments are all valuable and very helpful for revising and improving our manuscript, as well as the important guiding significance to our researchers.

Journal Requirements

Please review your reference list to ensure that it is complete and correct. If you have cited papers that have been retracted, please include the rationale for doing so in the manuscript text, or remove these references and replace them with relevant current references. Any changes to the reference list should be mentioned in the rebuttal letter that accompanies your revised manuscript. If you need to cite a retracted article, indicate the article’s retracted status in the References list and also include a citation and full reference for the retraction notice.

Reply

We have reviewed our references and double-checked the references list, no article was retracted.

Review comments

Reviewer #3: The re-submitted manuscript entitled “Mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and facilities mycobacterium survival” by Zhan et al. have made considerable modifications; however, there are still some minor concerns that need further addressed before accepted.

1. Line 253 “3.7 Mmu-let-7a-5p enhances Raw264.7 cell proliferation and viability”, according to Fig. 6 and its related contents, the current subtitle of 3.7 needs to rethink and refine, especially only CCK-8 results whether could support the cell proliferation as authors claim?

2. Figure 7, if possible, suggests the authors add a group that is just Raw264.7 cells without anything as a negative control. The current apoptotic data from Nc-mimics and NC-siRNA almost reached 30%, whether the Nc-mimics and NC-siRNA could promote apoptosis? To exclude the possibility of higher apoptotic rates such as Nc-mimics and NC-siRNA groups, the cell picture from each should provide additional support.

3. In Fig. 10, it is better to add the dilution index on the top of panel A.

4. Considering the large amounts of data and results of this study, a graphic abstract is helpful if it is provided.

Reply

We have studied comments carefully and have made corrections which we hope meet with approval. Revised portions are marked in red in the paper. The main corrections in the paper and the responses to the reviewer’s comments are as follows:

1. Line 253 “3.7 Mmu-let-7a-5p enhances Raw264.7 cell proliferation and viability”, according to Fig. 6 and its related contents, the current subtitle of 3.7 needs to rethink and refine, especially only CCK-8 results whether could support the cell proliferation as authors claim?

Thank you for your comments and we are extremely grateful to the Reviewer for pointing out this problem. Considering the reviewer’s comment, we have revised our subtitle of 3.7 and figure legends of Fig. 6. The CCK-8 results are appropriate to demonstrate the cell viability.

2. Figure 7, if possible, suggests the authors add a group that is just Raw264.7 cells without anything as a negative control. The current apoptotic data from Nc-mimics and NC-siRNA almost reached 30%, whether the Nc-mimics and NC-siRNA could promote apoptosis? To exclude the possibility of higher apoptotic rates such as Nc-mimics and NC-siRNA groups, the cell picture from each should provide additional support.

First of all, we thank you for your rigorous and realistic academic style. In our data, there is a blank cell group which is Raw264.7 cells without anything as a negative control as you referred to above. Because the processing of apoptosis data needs to be compared with blank cells, the histogram shown later is actually the value compared with blank cells. Although the apoptosis rate of the Nc-mimics group and the NC-siRNA group was nearly 30%, they were significantly different from the statistical analysis results between the let-7a-5p mimics group and the Casp-3 siRNA group.

3. In Fig. 10, it is better to add the dilution index on the top of panel A.

Thank you for your comments. Considering the reviewer’s suggestion, we have added the dilution index on the top of panel A.

4. Considering the large amounts of data and results of this study, a graphic abstract is helpful if it is provided.

Thank you so much for your affirmation and suggestions for our work. In fact, we have already prepared a graphic abstract before our first submission. We will upload the graphic abstract together this time. Please review and make clear whether it is suitable for publication.

Finally, we sincerely thank the reviewers for their valuable comments and suggestions. We try our best to revise the manuscript and improve the quality of our manuscripts by making some modifications. These changes will not affect the content and framework of the paper. We sincerely thank the editors / reviewers for their enthusiastic work and hope that the review work will be recognized.

Yours sincerely

Zhaohui Ge

Attachment Submitted filename: Response to Reviewers.docx

10.1371/journal.pone.0308095.r005
Decision Letter 2
Sessa Francesco Academic Editor
© 2024 Francesco Sessa
2024
Francesco Sessa
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version2
17 Jul 2024

Mmu-let-7a-5p inhibits macrophage apoptosis by targeting CASP3 to increase bacterial load and facilities mycobacterium survival

PONE-D-23-31553R2

Dear Dr. Ge,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Francesco Sessa, Ph.D., MS

Academic Editor

PLOS ONE

Additional Editor Comments (optional):

Following the reviewers' comments, the authors have improved their manuscript. I endorse its publication.

Reviewers' comments:

10.1371/journal.pone.0308095.r006
Acceptance letter
Sessa Francesco Academic Editor
© 2024 Francesco Sessa
2024
Francesco Sessa
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
24 Jul 2024

PONE-D-23-31553R2

PLOS ONE

Dear Dr. Ge,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Lecturer Francesco Sessa

Academic Editor

PLOS ONE
==== Refs
References

1 Rupp M , Walter N , Baertl S , Lang S , Lowenberg DW , Alt V . Terminology of bone and joint infection. Bone Joint Res. 2021;10 (11 ):742–3. Epub 2021/11/18. doi: 10.1302/2046-3758.1011.BJR-2021-0371 .34786949
2 Pigrau-Serrallach C , Rodriguez-Pardo D . Bone and joint tuberculosis. European spine journal: official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society. 2013;22 Suppl 4 :556–66. Epub 2012/06/20. doi: 10.1007/s00586-012-2331-y .22711012
3 Ge Z , Wang Z , Wei M . Measurement of the concentration of three antituberculosis drugs in the focus of spinal tuberculosis. European spine journal: official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society. 2008;17 (11 ):1482–7. Epub 2008/09/17. doi: 10.1007/s00586-008-0778-7 .18795341
4 Ge Z , Ma R , Xu G , Chen Z , Zhang D , Wang Q , et al . Development and In Vitro Release of Isoniazid and Rifampicin-Loaded Bovine Serum Albumin Nanoparticles. Med Sci Monit. 2018;24 :473–8. Epub 2018/01/25. doi: 10.12659/msm.905581 .29364864
5 Kalluri R , LeBleu VS . The biology, function, and biomedical applications of exosomes. Science. 2020;367 (6478 ). Epub 2020/02/08. doi: 10.1126/science.aau6977 .32029601
6 Sharma A , Johnson A . Exosome DNA: Critical regulator of tumor immunity and a diagnostic biomarker. Journal of cellular physiology. 2020;235 (3 ):1921–32. doi: 10.1002/jcp.29153 .31512231
7 Wu CX , Liu ZF . Proteomic Profiling of Sweat Exosome Suggests its Involvement in Skin Immunity. The Journal of investigative dermatology. 2018;138 (1 ):89–97. doi: 10.1016/j.jid.2017.05.040 .28899687
8 Salvi V , Gianello V , Busatto S , Bergese P , Andreoli L , D’Oro U , et al . Exosome-delivered microRNAs promote IFN-alpha secretion by human plasmacytoid DCs via TLR7. JCI insight. 2018;3 (10 ). doi: 10.1172/jci.insight.98204 .29769437
9 Peng H , Ji W , Zhao R , Yang J , Lu Z , Li Y , et al . Exosome: a significant nano-scale drug delivery carrier. J Mater Chem B. 2020;8 (34 ):7591–608. Epub 2020/07/23. doi: 10.1039/d0tb01499k .32697267
10 Tang TT , Wang B , Lv LL , Liu BC . Extracellular vesicle-based Nanotherapeutics: Emerging frontiers in anti-inflammatory therapy. Theranostics. 2020;10 (18 ):8111–29. Epub 2020/07/30. doi: 10.7150/thno.47865 .32724461
11 Lee ST , Im W , Ban JJ , Lee M , Jung KH , Lee SK , et al . Exosome-Based Delivery of miR-124 in a Huntington’s Disease Model. J Mov Disord. 2017;10 (1 ):45–52. Epub 2017/01/27. doi: 10.14802/jmd.16054 .28122430
12 Haney MJ , Klyachko NL , Zhao Y , Gupta R , Plotnikova EG , He Z , et al . Exosomes as drug delivery vehicles for Parkinson’s disease therapy. J Control Release. 2015;207 :18–30. Epub 2015/04/04. doi: 10.1016/j.jconrel.2015.03.033 .25836593
13 Izco M , Blesa J , Schleef M , Schmeer M , Porcari R , Al-Shawi R , et al . Systemic Exosomal Delivery of shRNA Minicircles Prevents Parkinsonian Pathology. Mol Ther. 2019;27 (12 ):2111–22. Epub 2019/09/11. doi: 10.1016/j.ymthe.2019.08.010 .31501034
14 Kalani A , Chaturvedi P , Kamat PK , Maldonado C , Bauer P , Joshua IG , et al . Curcumin-loaded embryonic stem cell exosomes restored neurovascular unit following ischemia-reperfusion injury. Int J Biochem Cell Biol. 2016;79 :360–9. Epub 2016/09/07. doi: 10.1016/j.biocel.2016.09.002 .27594413
15 Stutz MD , Allison CC , Ojaimi S , Preston SP , Doerflinger M , Arandjelovic P , et al . Macrophage and neutrophil death programs differentially confer resistance to tuberculosis. Immunity. 2021;54 (8 ):1758–71 e7. Epub 2021/07/14. doi: 10.1016/j.immuni.2021.06.009 .34256013
16 Song Y , Dong Y , Liao Y , Liang Z , Yao J , Zhou X . Apoptotic caspases suppress Mycobacterium bovis-induced IFN-beta production in murine macrophage. The Journal of infection. 2021;83 (1 ):61–8. Epub 2021/04/24. doi: 10.1016/j.jinf.2021.04.014 .33892015
17 Behar SM , Martin CJ , Booty MG , Nishimura T , Zhao X , Gan HX , et al . Apoptosis is an innate defense function of macrophages against Mycobacterium tuberculosis. Mucosal Immunol. 2011;4 (3 ):279–87. Epub 2011/02/11. doi: 10.1038/mi.2011.3 .21307848
18 Zhan X , Yuan W , Zhou Y , Ma R , Ge Z . Small RNA sequencing and bioinformatics analysis of RAW264.7-derived exosomes after Mycobacterium Bovis Bacillus Calmette-Guerin infection. BMC Genomics. 2022;23 (1 ):355. Epub 2022/05/08. doi: 10.1186/s12864-022-08590-w .35525953
19 Singh PP , Li L , Schorey JS . Exosomal RNA from Mycobacterium tuberculosis-Infected Cells Is Functional in Recipient Macrophages. Traffic. 2015;16 (6 ):555–71. Epub 2015/03/11. doi: 10.1111/tra.12278 .25753779
20 Bettencourt P , Carmo N , Pires D , Timóteo P , Anes E . Mycobacterial infection of macrophages: the effect of the multiplicity of infection. 2017. p. 651–64.
21 Winau F , Weber S , Sad S , de Diego J , Hoops SL , Breiden B , et al . Apoptotic vesicles crossprime CD8 T cells and protect against tuberculosis. Immunity. 2006;24 (1 ):105–17. Epub 2006/01/18. doi: 10.1016/j.immuni.2005.12.001 .16413927
22 Liu M , Li W , Xiang X , Xie J . Mycobacterium tuberculosis effectors interfering host apoptosis signaling. Apoptosis. 2015;20 (7 ):883–91. Epub 2015/04/05. doi: 10.1007/s10495-015-1115-3 .25840680
23 Behar SM , Briken V . Apoptosis inhibition by intracellular bacteria and its consequence on host immunity. Curr Opin Immunol. 2019;60 :103–10. Epub 2019/06/23. doi: 10.1016/j.coi.2019.05.007 .31228759
24 Zhang D , Yi Z , Fu Y . Downregulation of miR-20b-5p facilitates Mycobacterium tuberculosis survival in RAW 264.7 macrophages via attenuating the cell apoptosis by Mcl-1 upregulation. J Cell Biochem. 2019;120 (4 ):5889–96. Epub 2018/11/01. doi: 10.1002/jcb.27874 .30378171
25 Zhou YL , Zhang L , Zhou Z , Liu W , Lu Y , He S , et al . Antibody Modified Nanoparticle-Mediated Delivery of miR-124 Regulates Apoptosis via Repression the Stat3 Signal in Mycobacterial-Infected Microglia. J Biomed Nanotechnol. 2018;14 (12 ):2185–97. Epub 2018/10/12. doi: 10.1166/jbn.2018.2650 .30305225
26 Arnett E , Schlesinger LS . Live and let die: TB control by enhancing apoptosis. Immunity. 2021;54 (8 ):1625–7. Epub 2021/08/12. doi: 10.1016/j.immuni.2021.07.010 .34380059
27 Alipoor SD , Mortaz E , Tabarsi P , Farnia P , Mirsaeidi M , Garssen J , et al . Bovis Bacillus Calmette-Guerin (BCG) infection induces exosomal miRNA release by human macrophages. J Transl Med. 2017;15 (1 ):105. Epub 2017/05/14. doi: 10.1186/s12967-017-1205-9 .28499455
28 McClean CM , Tobin DM . Macrophage form, function, and phenotype in mycobacterial infection: lessons from tuberculosis and other diseases. Pathog Dis. 2016;74 (7 ). Epub 2016/07/13. doi: 10.1093/femspd/ftw068 .27402783
29 Sampath P , Periyasamy KM , Ranganathan UD , Bethunaickan R . Monocyte and Macrophage miRNA: Potent Biomarker and Target for Host-Directed Therapy for Tuberculosis. Frontiers in immunology. 2021;12 :667206. Epub 2021/07/13. doi: 10.3389/fimmu.2021.667206 .34248945
30 Abdalla AE , Ejaz H , Mahjoob MO , Alameen AAM , Abosalif KOA , Elamir MYM , et al . Intelligent Mechanisms of Macrophage Apoptosis Subversion by Mycobacterium. Pathogens. 2020;9 (3 ). Epub 2020/03/20. doi: 10.3390/pathogens9030218 .32188164
31 Singh PK , Singh AV , Chauhan DS . Current understanding on micro RNAs and its regulation in response to Mycobacterial infections. Journal of biomedical science. 2013;20 :14. Epub 2013/03/02. doi: 10.1186/1423-0127-20-14 .23448104
32 Alipoor SD , Adcock IM , Tabarsi P , Folkerts G , Mortaz E . MiRNAs in tuberculosis: Their decisive role in the fate of TB. Eur J Pharmacol. 2020;886 :173529. Epub 2020/09/14. doi: 10.1016/j.ejphar.2020.173529 .32919937
33 Jiang S. Recent findings regarding let-7 in immunity. Cancer Lett. 2018;434 :130–1. Epub 2018/07/28. doi: 10.1016/j.canlet.2018.07.027 .30053607
34 Letafati A , Najafi S , Mottahedi M , Karimzadeh M , Shahini A , Garousi S , et al . MicroRNA let-7 and viral infections: focus on mechanisms of action. Cell Mol Biol Lett. 2022;27 (1 ):14. Epub 2022/02/16. doi: 10.1186/s11658-022-00317-9 .35164678
35 Zhang WT , Zhang GX , Gao SS . The Potential Diagnostic Accuracy of Let-7 Family for Cancer: A Meta-Analysis. Technol Cancer Res Treat. 2021;20 :15330338211033061. Epub 2021/07/15. doi: 10.1177/15330338211033061 .34259101
36 Gilles ME , Slack FJ . Let-7 microRNA as a potential therapeutic target with implications for immunotherapy. Expert Opin Ther Targets. 2018;22 (11 ):929–39. Epub 2018/10/18. doi: 10.1080/14728222.2018.1535594 .30328720
37 Fasihi-Ramandi M , Moridnia A , Najafi A , Sharifi M . Inducing Apoptosis and Decreasing Cell Proliferation in Human Acute Promyelocytic Leukemia Through Regulation Expression of CASP3 by Let-7a-5p Blockage. Indian J Hematol Blood Transfus. 2018;34 (1 ):70–7. Epub 2018/02/06. doi: 10.1007/s12288-017-0809-9 .29398802
38 Peeters SH , de Jonge MI . For the greater good: Programmed cell death in bacterial communities. Microbiol Res. 2018;207 :161–9. Epub 2018/02/21. doi: 10.1016/j.micres.2017.11.016 .29458850
39 Kolb JP , Oguin TH 3rd , Oberst A , Martinez J . Programmed Cell Death and Inflammation: Winter Is Coming. Trends Immunol. 2017;38 (10 ):705–18. Epub 2017/07/25. doi: 10.1016/j.it.2017.06.009 .28734635
40 Julien O , Wells JA . Caspases and their substrates. Cell Death Differ. 2017;24 (8 ):1380–9. Epub 2017/05/13. doi: 10.1038/cdd.2017.44 .28498362
41 Galluzzi L , Lopez-Soto A , Kumar S , Kroemer G . Caspases Connect Cell-Death Signaling to Organismal Homeostasis. Immunity. 2016;44 (2 ):221–31. Epub 2016/02/18. doi: 10.1016/j.immuni.2016.01.020 .26885855
42 Asadi M , Taghizadeh S , Kaviani E , Vakili O , Taheri-Anganeh M , Tahamtan M , et al . Caspase-3: Structure, function, and biotechnological aspects. Biotechnol Appl Biochem. 2021. Epub 2021/08/04. doi: 10.1002/bab.2233 .34342377
43 Lossi L. The concept of intrinsic versus extrinsic apoptosis. Biochem J. 2022;479 (3 ):357–84. Epub 2022/02/12. doi: 10.1042/BCJ20210854 .35147165
44 Chen KW , Demarco B , Heilig R , Shkarina K , Boettcher A , Farady CJ , et al . Extrinsic and intrinsic apoptosis activate pannexin-1 to drive NLRP3 inflammasome assembly. EMBO J. 2019;38 (10 ). Epub 2019/03/25. doi: 10.15252/embj.2019101638 .30902848
45 MacFarlane M , Williams AC . Apoptosis and disease: a life or death decision. EMBO Rep. 2004;5 (7 ):674–8. Epub 2004/06/26. doi: 10.1038/sj.embor.7400191 .15218528
46 Konno R , Igarashi T , Okamoto S , Sato S , Moriya T , Sasano H , et al . Apoptosis of human endometrium mediated by perforin and granzyme B of NK cells and cytotoxic T lymphocytes. Tohoku J Exp Med. 1999;187 (2 ):149–55. Epub 1999/05/06. doi: 10.1620/tjem.187.149 .10228986
47 Zhang G , Zheng G , Jiang F , Wu T , Wu L . Granzyme B and perforin produced by SEC2 mutant-activated human CD4(+) T cells and CD8(+) T cells induce apoptosis of K562 leukemic cells by the mitochondrial apoptotic pathway. Int J Biol Macromol. 2021;190 :284–90. Epub 2021/09/08. doi: 10.1016/j.ijbiomac.2021.08.225 .34492245
48 Gough P , Myles IA . Tumor Necrosis Factor Receptors: Pleiotropic Signaling Complexes and Their Differential Effects. Frontiers in immunology. 2020;11 :585880. Epub 2020/12/17. doi: 10.3389/fimmu.2020.585880 .33324405
49 Vucic D , Dixit VM , Wertz IE . Ubiquitylation in apoptosis: a post-translational modification at the edge of life and death. Nat Rev Mol Cell Biol. 2011;12 (7 ):439–52. Epub 2011/06/24. doi: 10.1038/nrm3143 .21697901
50 Chiewchengchol D , Wright HL , Thomas HB , Lam CW , Roberts KJ , Hirankarn N , et al . Differential changes in gene expression in human neutrophils following TNF-alpha stimulation: Up-regulation of anti-apoptotic proteins and down-regulation of proteins involved in death receptor signaling. Immun Inflamm Dis. 2016;4 (1 ):35–44. Epub 2016/04/05. doi: 10.1002/iid3.90 .27042300
51 Lee J , Repasy T , Papavinasasundaram K , Sassetti C , Kornfeld H . Mycobacterium tuberculosis induces an atypical cell death mode to escape from infected macrophages. PloS one. 2011;6 (3 ):e18367. Epub 2011/04/13. doi: 10.1371/journal.pone.0018367 .21483832
