
==== Front
PLoS One
PLoS One
plos
PLOS ONE
1932-6203
Public Library of Science San Francisco, CA USA

10.1371/journal.pone.0304939
PONE-D-24-20532
Research Article
Biology and life sciences
Genetics
DNA
Forms of DNA
Mitochondrial DNA
Biology and life sciences
Biochemistry
Nucleic acids
DNA
Forms of DNA
Mitochondrial DNA
Medicine and Health Sciences
Oncology
Cancers and Neoplasms
Biology and life sciences
Genetics
DNA
DNA damage
Biology and life sciences
Biochemistry
Nucleic acids
DNA
DNA damage
Medicine and Health Sciences
Oncology
Cancer Treatment
Biology and Life Sciences
Biochemistry
Oxidative Damage
Biology and life sciences
Genetics
DNA
DNA repair
Biology and life sciences
Biochemistry
Nucleic acids
DNA
DNA repair
Biology and Life Sciences
Cell Biology
Oxidative Stress
Research and Analysis Methods
Spectrum Analysis Techniques
Spectrophotometry
Cytophotometry
Flow Cytometry
Mitochondrial DNA is a sensitive surrogate and oxidative stress target in oral cancer cells
Mitochondrial DNA as an oxidative stress target in oral cancer cells
Tan Jingyu Writing – original draft 1
Dong Xinlin Data curation 1
https://orcid.org/0000-0003-4872-0886
Liu Haiwen Conceptualization Data curation Writing – review & editing 1 2 *
1 The First Affiliated Hospital of Jinzhou Medical University, Jinzhou, China
2 Liaoning Provincial Key Laboratory of Clinical Oncology Metabonomic, Jinzhou, China
Nigam Manisha Editor
School of Life Sciences, H.N.B. Garhwal University (A Central University), INDIA
Competing Interests: The authors have declared that no competing interests exist.

* E-mail: haiwen163@163.com
3 9 2024
2024
19 9 e030493921 5 2024
13 8 2024
© 2024 Tan et al
2024
Tan et al
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Cellular oxidative stress mediated by intrinsic and/or extrinsic reactive oxygen species (ROS) is associated with disease pathogenesis. Oxidative DNA damage can naturally be substituted by mitochondrial DNA (mtDNA), leading to base lesion/strand break formation, copy number changes, and mutations. In this study, we devised a single test for the sensitive quantification of acute mtDNA damage, repair, and copy number changes using supercoiling-sensitive quantitative PCR (ss-qPCR) and examined how oxidative stress-related mtDNA damage responses occur in oral cancer cells. We observed that exogenous hydrogen peroxide (H2O2) induced dynamic mtDNA damage responses, as reflected by early structural DNA damage, followed by DNA repair if damage did not exceed a particular threshold. However, high oxidative stress levels induced persistent mtDNA damage and caused a 5–30-fold depletion in mtDNA copy numbers over late responses. This dramatic depletion was associated with significant growth arrest and apoptosis, suggesting persistent functional consequences. Moreover, oral cancer cells responded differentially to oxidative injury when compared with normal cells, and different ROS species triggered different biological consequences under stress conditions. In conclusion, we developed a new method for the sensitive detection of mtDNA damage and copy number changes, with exogenous H2O2 inducing dynamic mtDNA damage responses associated with functional changes in stressed cancer cells. Finally, our method can help characterize oxidative DNA damage in cancer and other human diseases.

the Science Foundation of the Liaoning Provincial Department of Education LJKMZ20221224 Tan Jingyu http://dx.doi.org/10.13039/501100004767 University of Science and Technology Liaoning 2023JH/101700235 https://orcid.org/0000-0003-4872-0886
Liu Haiwen the funding of Scientific Research of The First Affiliated Hospital of Jinzhou Medical University FYQKR- 202203 Tan Jingyu The Science Foundation of the Liaoning Provincial Department of Education(LJKMZ20221224),the Science and Technology Program Project of the Liaoning Province(2023JH/101700235),the funding of Scientific Research of The First Affiliated Hospital of Jinzhou Medical University(FYQKR-202203). Data AvailabilityThe data generated in this study is included in the paper itself and uploaded as supplementary information.
Data Availability

The data generated in this study is included in the paper itself and uploaded as supplementary information.
==== Body
pmcIntroduction

Oral squamous cell carcinoma (OSCC) is a cancer with high morbidity and mortality [1]. In 2018, combined effects of lip, oral cavity, and oropharynx cancers resulted in an estimated 228,389 fatalities and 447,751 new cancer cases, or 2.4% of all cancer deaths worldwide [2]. Oral cancer is a serious public health issue, particularly for dentists. The disease is among the top ten cancers in terms of incidence, while survival rates have not greatly increased recently, despite advancements in treatment and research, posing a persistent challenge to biomedical science [3]. In around 90% of cases, alcohol and smoking are key risk factors for oral cancer, which is a preventable disease [4] and they exert synergic effects [5]. Intrinsic oxidative stress due to augmented cellular reactive oxygen species (ROS) production is increasingly intrinsic to many cancers [6]. ROS comprise a family of short-lived molecules, such as superoxide anion(O2.), hydrogen peroxide (H2O2) and hydroxyl radicals (OH),first described as free radicals in skeletal muscle [7]. They are extremely reactive molecules that contain oxygen and have the ability to damage DNA and affect damage responses [8].

In organisms, ROS is constantly generated during normal aerobic metabolism. Low ROS doses, particularly H2O2, are mitogenic and promote cell proliferation and induce mutagenesis, with high levels not only inhibiting cell proliferation, but also inducing elevated cytotoxicity in cells and causing apoptosis in several tumor types [9–12]. Of the different ROS types, H2O2 is a hallmark molecule generated by almost all oxidative stress sources, and is a vital oxygen metabolite that plays significant roles in diseases driven by oxidative stress, such as inflammation [13, 14].

Physical or chemical alterations to DNA can indicate DNA damage, which impacts the interpretation and transfer of genetic information. Numerous external and internal insults, such as chemicals, radiation, free radicals, and MicroRNAs(miRNAs), maladjusted in multifarious malignant tumor, can be considered as both carcinogens and tumor-inhibiting factor [15], can harm DNA, and each one does so in a different way.

The main ROS molecules formed by mitochondria are superoxides (O2-) and H2O2 [16].Cellular DNA and other macromolecules are directly oxidatively damaged by HO•, the most reactive kind of ROS [17]. Some features of cancer, including transcription factors and activated proto-oncogenes, genomic instability, resistance to treatment, invasion, and metastasis, may be partially explained by persistent oxidative stress [18]. The mitochondrial electron transport chain, is one source of cellular ROS, which is generated as by-products. Mitochondrial DNA (mtDNA), which is circular and multi-copy, is susceptible to oxidative DNA damage. Its distinct characteristics include a high copy number, susceptibility to damage, and dependence on repair processes [6, 19].

In this study, we developed a new method for the sensitive detection of mtDNA damage, copy number changes, and exogenous H2O2 production induced by dynamic mtDNA damage responses associated with functional changes in oral cancer cells. We may be able to evaluate oxidative DNA damage in cancer and other disorders using our sensitive mtDNA test.

Materials and methods

Reagents and cell culture

Normal human fibroblast (BJ) and human oral squamous carcinoma (SCC-25) cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). We bought the majority of the chemicals from Sigma-Aldrich in Oakville, Ontario, Canada. Whereas SCC-25s were maintained in DMEM/F12 along with 15 mM HEPES, 1.2 g/L sodium bicarbonate, 0.5 mM sodium pyruvate, and 400 ng/ml hydrocortisone, BJ cells were cultured in Dulbecco’s Modified Eagle’s Medium (DMEM) supplemented with 1.5 g/L sodium bicarbonate. Supplements of 10% fetal bovine serum, 100 μg/mL streptomycin, and 100 U/mL penicillin were added to both mediums. Cells were cultivated at 37°C in a humidified 5% CO2 environment.

Inducing oxidative DNA damage

SCC-25 and BJ cells (1×106 cells) were grown for 24 h. A 1 M H2O2 (working solution) was freshly prepared in phosphate buffered saline (PBS). For exposure studies, culture dishes containing cells were treated with different H2O2 concentrations in serum-free medium for 15 min and 60 min. For recovery studies, H2O2 was applied for 60 min and cells allowed recover for 48 h in fresh complete medium. Cells were washed once in PBS, collected by trypsin digestion, and genomic DNA extracted.

DNA preparation

Using QIAGEN Blood and Cell Culture DNA kits (Qiagen, Germany), total DNA from cell pellets was extracted in accordance with the manufacturer’s instructions with a few minor adjustments to preserve mtDNA [20]. DNA was quantified using a NanoDrop (Thermo Scientific, Amarican); 1 × Tris/EDTA (pH 8.0) was used to prepare a 1 ng/L template solution. Template solutions were divided equally into two parts: half the original template was used to quantify relaxed/damaged mtDNA, and the other half underwent heat treatment for six minutes at 95°C to measure the amount of whole mtDNA.

Real-time PCR with supercoiling sensitivity for quantifying mtDNA damage

The total mtDNA copy number and mtDNA damage level calculation method was previously reported [21, 22]. Primer sequences are shown (Table 1). The new two-step procedure for determining mtDNA damage is described: 38 cycles of a two-step reaction at 80.0°C for 6 s and 61.0°C for 30 s are followed by 95.0°C for 30 s, 61.0°C for 30 s, 95.0°C for 3 s, and 61.0°C for 30 s. Melt curve analysis was performed at amplification end. We used the ViiA7TM Real-Time PCR System with Power SYBR®Fast Green PCR Master Mix (ABI, American). The percentage of relaxed mtDNA fraction in samples compared to total copy numbers was used to calculate mtDNA structural damage, while relative mtDNA copy numbers were normalized to total copy numbers in controls.

10.1371/journal.pone.0304939.t001 Table 1 Primer sequences for long PCR and real time PCR amplifications.

Primers	Forward 5’-3’	Reverse5’-3’	
CO2(3285bp)	CCTAGGGTTTATCGTGTGAG	CTAGTTAATTGGAAGTTAACGG　	
Calicin(2658bp)	ATTCCAGAAGCCTTTAACTAG	ACAAATGAGACACAAACTACCG	
CO2(real-timePCR)	CCCCACATTAGGCTTAAAAACAGAT	TATACCCCCGGTCGTGTAGCGGT	
Calicin(real-timePCR)	CTGGTCGCTACATCTACATCTC	CAGGTCAGGCAACTTGGTC	

3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays

These tests were based on the process by which mitochondrial reductase changes the water-soluble yellow dye MTT into the insoluble purple formazan [23]. Different functional endpoints were examined when varying H2O2 concentrations were employed for one, twenty-four, and forty-eight hours. The long-term MTT impact suggests cell viability and/or growth inhibition, whereas the 56short-term MTT effect is dictated by mitochondrial respiration and cellular redox status effects.6x103 cells (150 uL/well) were cultured in 96-well plates for a full night at 37°C with 5% CO2 until the cells adhered. The next day, growth media was created with various H2O2 concentrations (during 24 and 48 hours of incubation). A negative control was established using untreated material. Following a 24-hour incubation period, wells were treated with 5 mg/mL MTT (Sigma, UK) for 4 hours at 37°C in 5% CO2, and then formazan was solubilized with the addition of dimethyl sulfoxide. Using an ELx808TM Absorbance Microplate Reader (BioTek, USA), plates were analyzed at 550 nm.

Quantifying γ-H2AX in DNA double-strand breaks (DSBs) by flow cytometry

Assessing the amounts of γ-H2AX offers a dependable and sensitive way to measure responses to DNA damage in many cell types [24, 25]. In short, the cells were in blocking buffer (5.0% rabbit serum (Labtech) + 0.1% Triton TM X-100 (Sigma-Aldrich, Dorset, UK) in PBS) and gently shaken for one hour at room temperature. Blocking buffer was removed, and cells were then gently stirred at 4°C for 24 hours before being treated with a primary antibody (anti-phosphohistone γ-H2AX (serine 139) mouse monoclonal IgG1 antibody; clone JBW301 (Millipore, Waterford, Ireland) was diluted 1/10000 in blocking buffer). The main antibody was eliminated after two PBS washes with 0.1% Triton TM X-100. To prepare cells for flow cytometry, they were resuspended in PBS. Information on 5000–10000 cells was gathered.

Alkaline gel electrophoresis to detect H2O2-induced DSB and single-strand breaks (SSBs)

Alkaline gel electrophoresis is performed under alkaline conditions to promote DNA denaturation to better detect SSBs [26, 27]. Approximately 3–5 μL DNA was added to 3.2 μL of a 500 mM NaOH stock solution. The final NaOH concentration was adjusted to 100 mM (50 mM HEPES buffer). Then, 2 μL loading buffer was added and incubated with DNA at 37°C for 20 min. After loading samples onto the gel, buffer was circulated around the system. For sixteen hours, electrophoresis was run at 30 V. The next day, the gel was placed into neutralizing solution for 20 min at room temperature, then rinsed twice in deionized water, and placed into a container with enough 10000 × Gel stain for 40 min at room temperature. The waste agarose gel was disposed of in the designated rubbish bin and disposed of centrally.

Data analysis

Statistical analyses were performed in GraphPad Prism version 5 (GraphPad, San Diego, CA, USA). One-way analysis of variance with Dunnet’s multiple comparison tests were used for statistical analyses involving > two groups. Otherwise, Student’s t-tests were used to analyze specific samples/groupings.

Results

Ss-qPCR sensitivity and stability in detecting mtDNA base damage

Using ss-qPCR, we developed a sensitive quantification method for acute mtDNA damage, repair and copy number changes in a single test. The two-phase protocol allows for the sensitive identification of basal mtDNA damage levels resulting from DNA strand breaks and the estimation of mtDNA content while also greatly reducing experimental artifacts [28]. From the literature, damaged mtDNA levels in cancer cells can be as high as 30% or over and over 40% in Fast and Regular protocols [28]. Our detection results showed that in controls (no treatment), mtDNA base damage at different time points was stable, while our method identified basal mtDNA damage levels of approximately 30% of total mtDNA content in untreated SCC-25 and BJ cells (Fig 1), which was a significant reduction. Studies were repeated three times or more.

10.1371/journal.pone.0304939.g001 Fig 1 Two-phase, supercoiling-sensitive qPCR for improved mtDNA damage detection.

Damaged mtDNA percentages in SCC-25 oral cancer and BJ cell lines (A–D). Data were calculated using Image-Pro 5.0 software (Media Cybernetics).

H2O2 induces prevalent mtDNA damage in oral cancer and normal cells

Using our approach, mtDNA damage was assessed to investigate if oxidative DNA damage linked with differential cell toxicity between oral cancer and normal cells caused by exogenous H2O2. When SCC-25 cells were treated with 120–960 μM H2O2,mtDNA damage increased during exposure durations of 15 and 60 minutes in a dose-dependent manner (Fig 2A). When SCC-25 cells, previously treated with 480 μM H2O2 and allowed recover in complete medium, mtDNA damage maintained over time and displayed modest healing at 24 h, as shown by reduced damage molecule ratios(Fig 2B). In 60 minutes, 120–240 μM H2O2 altered more than 70% of the mtDNA molecules in the cells into damaged versions, while the amount of mtDNA did not change much throughout exposure(Fig 2C and 2D). During the course of the 2-to 24-hour healing period, a 20-fold decrease in the total amount of mtDNA was also seen, indicating that the highly damaged mtDNA molecules were actively undergoing destruction (Fig 2E). We observed significant quantities of floating cells in 24 h recovery dishes. We were also surprised to observe sensitive mtDNA damage responses in BJ cells when treated with several H2O2 doses, e.g., at 240 μM H2O2, considerable mtDNA damage was seen, and for one hour, a dose-dependent increase was brought on by 240–960 μM H2O2 (Fig 2F). Moreover, 480 μM H2O2 induced > 60% early structural damage in BJ cells (Fig 2G). BJ cells treated with 960 μM H2O2 showed much more extensive mtDNA copy number loss (Fig 2H). Therefore, mtDNA damage and destruction caused by H2O2 was common in both normal and oral cancer cells, but it was not associated with distinct cell cytotoxicity.

10.1371/journal.pone.0304939.g002 Fig 2 Hydrogen peroxide (H2O2) induces prevalent mtDNA damage in oral cancer and normal cells.

H2O2-induced mtDNA damage, repair, and copy number depletion were analyzed using ss-qPCR. SCC-25 cells were treated for 15 and 60 min with 120–980 μM H2O2 to assess dose-responses during mtDNA damage (A). To measure repair activity, cells were treated for 60 min with 480 μM H2O2 and then allowed recover for 2 h and 24 h (B). SCC-25 cells were treated for 60 min with 120–480 μM H2O2 and then allowed recover for 2 h and 72 h to measure copy number changes (C, D, E). BJ cells were treated for 15 and 60 min with 120–980 μM H2O2 to assess dose-responses during mtDNA damage (F). BJ cells were treated for 60 min with 480 μM H2O2 and then allowed recover for 2–72 h to assess copy number changes (G). BJ cells were treated for 60 min with 960 μM H2O2 and then allowed recover for 2–72 h to measure copy number changes (H).

Oral cancer and normal cells exhibit selective cytotoxicity from exogenous H2O2

We used MTT assays to assess oral cancer’s cellular oxidative damage vs. normal BJ cells. Comprehensive H2O2-induced dose- and time-dependent profile responses were generated in cells in preliminary analyses. At one hour, both cell lines showed much higher vulnerability to early H2O2 toxicity(Fig 3A and 3B) and 24 hours later, growth inhibition (Fig 3C). In SCC-25 cells, at 24 hours, 287.2 μM of H2O2 was needed to achieve 50% growth inhibition (EC50), whereas in contrast, BJ cells demonstrated robust resilience against external oxidative damage, demonstrating an EC50 value of 578.4 μM H2O2(Fig 3D).

10.1371/journal.pone.0304939.g003 Fig 3 Hydrogen peroxide (H2O2) induces differential cell toxicity in oral cancer and normal cells.

H2O2 induces early redox toxicity at 1 h; expressed as the percentage of treatment vs. control cells (A, B), and growth inhibition at 24 h; expressed as a function of log dose (C, D) in MTT assays in cell lines. SCC-25 cells were treated with final 0/120/240/480, and 960 μM H2O2 concentrations. BJ cells were exposed to 0/120/240/480 and 960 μM H2O2 concentrations at indicated times. 50% growth inhibition (EC50) is indicated by a solid line. Statistical significance is indicated by: p < 0.05 (*), p < 0.01 (**), and p < 0.001 (***). Data were calculated using Image-Pro 5.0 software (Media Cybernetics). RFI/cell mean values were obtained from at least two separate experiments.

H2O2 and etoposide (ETO)-induce DNA SSBs and DSBs in oral cancer cells

We used flow cytometry to investigate the effects of H2O2-induced DNA breaks in oral cancer cells; we used 480 μM H2O2 at 1 h/2 h/6 h, and 24 h and the γ-H2AX antibody to detect DNA fracture points of 4.14%, 3.23%, 3.66%, and 3.58%, respectively (Fig 4A–4D). The break point in the control group was 0.68%. Although experimental group data were statistically significantly different when compared with controls, a dose relationship was not observed at different stimulation times. We also used another chemical reagent ETO, which is a semisynthetic derivative of podophyllotoxin and is frequently used to treat solid tumors, lymphoma, and leukemia, among other cancers [29]. ETO is a potent DNA DSB inducer via topoisomerase II inhibition. The medication is utilized as an efficient chemotherapy [30].

10.1371/journal.pone.0304939.g004 Fig 4 Hydrogen peroxide (H2O2)- and etoposide (ETO)-induce DNA breaks in SCC-25 cells. 480 μM H2O2, 50 ng/L ETO two chemicals stimulated 1 h/2 h/6 h/24 h, respectively, using flow cell surgery for nuclear DNA fracture detection.

(A) Blank control group; (B–E) 480 μM H2O2 stimulation at 1 h /2 h /6 h /24 h, nuclear DNA fracture ratio; (F–I) 50 ng/L ETO stimulation 1 h/ 2 h/ 6 h/24 h, nuclear DNA fracture ratio.

Gamma-H2AX is a key factor during damaged DNA repair processes; it is recruited to damage sites where it recruits other DNA repair machinery [31, 32]. Phosphorylated γ-H2AX status at Ser139 (H2AX) was examined after cells were treated with 50 μg/mL ETO for 1 h/2 h /6 h, and 24 h. We identified 16%/22.1%/35.1%, and 65.5% breaks, respectively. Gamma-H2AX production is a sensitive and fast cellular response to double-strand breaks (DSBs) that may reveal information about higher order chromatin structures; utilizing the ss-qPCR method, exogenous H2O2 causes widespread and sensitive mtDNA damage responses in both normal and oral cancer cell lines.

H2O2-induces DNA SSBs in oral cancer cells

Agarose gel electrophoresis is used for DNA damage analyses [33]. Nuclear DNA damage was determined using γ-H2AX antibodies combined with flow cytometry and alkaline gel electrophoresis. SSBs were observed in SCC-25 cells when continuously exposed to 120/240/480 μM H2O2 for 1 h/2 h/24 h. SSBs were visualized in cells using OTX-coupled AGE analysis. Images were obtained using Gei stain and a Kodak Image Station 440CF system. When cells were stimulated for 1 h at 120/240/480 μM concentrations, the degree of nuclear DNA damage increased with increased concentrations (Fig 5, lines B, E, H). At 2 h stimulation, the degree of nuclear DNA damage was dose-dependent (Fig 5, lines C, F, I), but differences were not significantly different to the 1 h stimulation. At 24 h stimulation, the degree of nuclear DNA damage increased over time, but some damage was recovered (Fig 5, Lines D, G, J).And the comparison of the intensity of DNA fluorescence, showed that the damage trend of nuclear DNA was the same as mt DNA(Fig 6)

10.1371/journal.pone.0304939.g005 Fig 5 Single Stranded Break (SSB) detection in SCC-25 cells continuously exposed to 120/240/480 μM hydrogen peroxide (H2O2) for 1 h/2 h/24 h.

LaneA—control; Lane B—120 μM H2O2 exposure for 1 h; Lane C—120 μM H2O2 exposure for 2 h; Lane D—120 μM H2O2 exposure for 24 h; Lane E—240 μM H2O2 exposure for 1 h; Lane F- 240 μM H2O2 exposure for 2 h; Lane G—240 μM H2O2 exposure for 24 h; Lane H—480 μM H2O2 exposure for 1 h; Lane I—480 μM H2O2 exposure for 2 h; and Lane J—480 μM H2O2 exposure for 24 h.

10.1371/journal.pone.0304939.g006 Fig 6 SSB detection in SCC-25 cells exposed continuously to 120/240/480μM H2O2 for 1/2/24 h.

The picture shows the comparison of the intensity of DNA fluorescence.

Discussion

In this study, dynamic changes during mtDNA damage, repair, and copy number in oral squamous carcinoma cells were induced by exogenous oxidative stimulation. We showed that when low oxidative stimulation levels were applied to cells, mtDNA exhibited some damage responses in the short term, then the body’s repair mechanisms soon took effect and quickly returned mtDNA to normal levels, this process reflects the dynamic changes in mtDNA damage and repair in oral squamous cell carcinoma cells. MtDNA damage and repair in cells was dynamically altered, while copy numbers did not increase or decrease due to repair mechanisms. Copy numbers were also significantly reduced by approximately 20-fold when compared with controls. Under similar stimulation conditions, control cells showed changes in oxidative damage only at high concentrations, and decrease copy numbers at 2 h and 24 h, which quickly reverted to normal levels. Only at very high concentrations did copy numbers significantly decrease. Thus, oral squamous carcinoma cells were more sensitive to oxidative stimulation.

In the literature, it was suggested that changes in gene copy numbers are important factors affecting gene function, and that some tumors are not triggered by mutations but by increases/decreases in gene copy numbers. Vijay et al. [34] used in situ digoxigenin-labelled mtDNA probes to detect mtDNA in malignant and benign cells and identified significant increases in mtDNA copy numbers in malignant cells. Boultwood et al. [35] used in situ hybridization probes to detect mtDNA in peripheral blood or bone marrow cells from leukemia patients and normal subjects, and reported significantly increased mtDNA copy numbers in all acute leukemia and most chronic leukemia patients (8/9). Increased mtDNA copy numbers may be related to under- developed mtDNA repair mechanisms and inefficient repair, while mutations in mtDNA cause functional defects in mitochondria, the production of which requires excessive mtDNA replication to compensate for functional defects. It was also reported that differences in mtDNA copy numbers existed between gastric cancer and normal tissue, with significant decreases in copy numbers in gastric cancer cells [34]. This may be due to ROS damage to mtDNA or D-loop regions, thereby causing prolonged mtDNA replication cycles, reduced replication or increased mtDNA damage. Thus, genetic structure changes in tumor mtDNA, such as point mutations in non-coding regions or microsatellite instability, may affect regulatory sequences in non-coding regions, thereby altering mtDNA transcription and replication regulator or inducer infinity to D-loops and altering mtDNA copy numbers [35–38].

To assess nuclear DNA breaks in SCC-25 cells after H2O2 stimulation, flow cytometry, γ-H2AX, and alkaline gel electrophoresis assays were performed. We observed significant difference between H2O2-stimulated samples when compared with controls, but difference were not significant. However, different stimulation times showed certain dose-dependent relationships. When we used ETO, a chemical agent which induced DNA DSBs, DNA break points were not only significantly different to controls, but dose differences were identified depending on time differences. It was clear from both chemical stimuli (ETO and H2O2) that while both reagents caused severe DNA breaks, the γ-H2AX method was only sensitive to DSBs and could not detect SSBs, the H2O2 can cause DNA SSBs. The γ-H2AX assay is applicable to DSB detection, whereas our ss-qPCR assay was more sensitive and stable with respect to mtDNA oxidative damage.

Our alkaline gel electrophoresis studies, which detected a full range of DNA breaks, confirmed that oxidative stimulation conditions triggered nuclear DNA damage in a dose-dependent manner. Taken together, these results showed that the extent of nuclear DNA damage under exogenous oxidative stimulation followed the same trend as for mtDNA damage, with both indicating similar gene damage trends.

Several studies reported that when oral squamous carcinoma cells and normal skin fibroblasts are subjected to exogenous oxidative stimuli, they exhibit different degrees of damage, repair, and copy number dynamics with respect to oxidative damage. Such observations suggest that when cells are subjected to sustained oxidative stress, ROS production is increased and accumulates in tumor cells, which becomes relevant to tumorigenesis. By studying these mechanisms, researchers can prevent and treat oral squamous carcinoma. However, it remains unclear which cellular processes contribute to ROS propagation in cancer cells and how these alterations are linked to cellular oxidative damage.

Conclusions

Using ss-qPCR, in oral cancer cells, we found dynamic responses to mtDNA damage, including sensitive early mtDNA damage, repair, and copy number changes when exogenous H2O2 was present. Increased sensitivity in cancer cells to oxidative DNA damage was consistent with preferential cell toxicity and the simultaneous induction of nuclear DNA damage. Thus, oxidative stress increases the sensitivity of oral cancer cells., and dynamic oxidative stress responses may offer fresh perspectives for the early prevention and treatment of oral cancer.

Supporting information

S1 Fig This is the original data for all the data displayed in Fig 1.

The values behind the means, standard deviations and the values used to build graphs, the points extracted from images for analysis, all include in these figures.

(ZIP)

S2 Fig This is the original data for all the data displayed in Fig 2.

The values behind the means, standard deviations and the values used to build graphs, the points extracted from images for analysis, all include in these figures.

(ZIP)

S3 Fig This is the original data for all the data displayed in Fig 3.

The values behind the means, standard deviations and the values used to build graphs, the points extracted from images for analysis, all include in these figures.

(ZIP)

S4 Fig This is the original data for all the data displayed in Fig 4.

The values behind the means, standard deviations and the values used to build graphs, the points extracted from images for analysis, all include in these figures.

(ZIP)

S5 Fig This is the original data for all the data displayed in Fig 5.

The original gel electrophoresis images are included, along with the specific sample names and sizes represented by each band.

(ZIP)

S6 Fig This is the original data for all the data displayed in Fig 6.

The values behind the means, standard deviations and the values used to build graphs, the points extracted from images for analysis, all include in these figures.

(ZIP)

We thank the members of our division for their contribution to this study, Jingyu Tan and Xinlin Dong are responsible for writing article, Haiwen Liu for technical assistance.

Abbreviations

Abbreviation Full Name

H2O2 Hydrogen peroxide

ROS reactive oxygen species

ss-qPCR Supercoiling-sensitive PCR

DMEM Dulbecco’s Modified Eagle’s Medium

DMSO Dimethyl sulfoxide

ETO Etoposide

MTT 3-(45-dimethylthiazol-2-yl)-25-diphenyltetrazilium

FCM Flow cytometry

10.1371/journal.pone.0304939.r001
Decision Letter 0
Nigam Manisha Academic Editor
© 2024 Manisha Nigam
2024
Manisha Nigam
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version0
21 Jun 2024

PONE-D-24-20532Mitochondrial DNA is a sensitive surrogate and oxidative stress target in oral cancer cellsPLOS ONE

Dear Dr. Liu,

Thank you for submitting your manuscript to PLOS ONE. After careful consideration, we feel that it has merit but does not fully meet PLOS ONE’s publication criteria as it currently stands. Therefore, we invite you to submit a revised version of the manuscript that addresses the points raised during the review process.

Please submit your revised manuscript by Aug 05 2024 11:59PM. If you will need more time than this to complete your revisions, please reply to this message or contact the journal office at plosone@plos.org. When you're ready to submit your revision, log on to https://www.editorialmanager.com/pone/ and select the 'Submissions Needing Revision' folder to locate your manuscript file.

Please include the following items when submitting your revised manuscript:

A rebuttal letter that responds to each point raised by the academic editor and reviewer(s). You should upload this letter as a separate file labeled 'Response to Reviewers'.

A marked-up copy of your manuscript that highlights changes made to the original version. You should upload this as a separate file labeled 'Revised Manuscript with Track Changes'.

An unmarked version of your revised paper without tracked changes. You should upload this as a separate file labeled 'Manuscript'.

If you would like to make changes to your financial disclosure, please include your updated statement in your cover letter. Guidelines for resubmitting your figure files are available below the reviewer comments at the end of this letter.

If applicable, we recommend that you deposit your laboratory protocols in protocols.io to enhance the reproducibility of your results. Protocols.io assigns your protocol its own identifier (DOI) so that it can be cited independently in the future. For instructions see: https://journals.plos.org/plosone/s/submission-guidelines#loc-laboratory-protocols. Additionally, PLOS ONE offers an option for publishing peer-reviewed Lab Protocol articles, which describe protocols hosted on protocols.io. Read more information on sharing protocols at https://plos.org/protocols?utm_medium=editorial-email&utm_source=authorletters&utm_campaign=protocols.

We look forward to receiving your revised manuscript.

Kind regards,

Manisha Nigam

Academic Editor

PLOS ONE

Journal Requirements:

When submitting your revision, we need you to address these additional requirements.

1. Please ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming. The PLOS ONE style templates can be found at 

https://journals.plos.org/plosone/s/file?id=wjVg/PLOSOne_formatting_sample_main_body.pdf and 

https://journals.plos.org/plosone/s/file?id=ba62/PLOSOne_formatting_sample_title_authors_affiliations.pdf

2. We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. 

When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

3. Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript.

4. We note that your Data Availability Statement is currently as follows:

"All relevant data are within the manuscript and its Supporting Information files"

Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission. PLOS defines the minimal data set to consist of the data required to replicate all study findings reported in the article, as well as related metadata and methods (https://journals.plos.org/plosone/s/data-availability#loc-minimal-data-set-definition).

For example, authors should submit the following data:

- The values behind the means, standard deviations and other measures reported;

- The values used to build graphs;

- The points extracted from images for analysis.

Authors do not need to submit their entire data set if only a portion of the data was used in the reported study.

If your submission does not contain these data, please either upload them as Supporting Information files or deposit them to a stable, public repository and provide us with the relevant URLs, DOIs, or accession numbers. For a list of recommended repositories, please see https://journals.plos.org/plosone/s/recommended-repositories.

If there are ethical or legal restrictions on sharing a de-identified data set, please explain them in detail (e.g., data contain potentially sensitive information, data are owned by a third-party organization, etc.) and who has imposed them (e.g., an ethics committee). Please also provide contact information for a data access committee, ethics committee, or other institutional body to which data requests may be sent. If data are owned by a third party, please indicate how others may request data access.

5. PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files. This policy and the journal’s other requirements for blot/gel reporting and figure preparation are described in detail at https://journals.plos.org/plosone/s/figures#loc-blot-and-gel-reporting-requirements and https://journals.plos.org/plosone/s/figures#loc-preparing-figures-from-image-files. When you submit your revised manuscript, please ensure that your figures adhere fully to these guidelines and provide the original underlying images for all blot or gel data reported in your submission. See the following link for instructions on providing the original image data: https://journals.plos.org/plosone/s/figures#loc-original-images-for-blots-and-gels.   

In your cover letter, please note whether your blot/gel image data are in Supporting Information or posted at a public data repository, provide the repository URL if relevant, and provide specific details as to which raw blot/gel images, if any, are not available. Email us at plosone@plos.org if you have any questions.

Additional Editor Comments: 

Based on the opinion of the reviewers and their valuable comments this manuscript cannot be considered for the publication in its present form. It requires major revision on the following points.

Reviewer 1

The authors have presented a well conducted and rigorous research. However the authors should in more or better detail explain why they chose to use normal skin fibroblasts as their control rather than cells that are more similar to the normal oral squamous epithelium for better comparison.

Reviewer 2

The author of the manuscript titled "Mitochondrial DNA is a sensitive surrogate and oxidative stress target in oral cancer cells" claim that mitochondrial DNA of oral cancer cell is sensitive to oxidative stress than normal cells and analysed mtDNA damage, repair and copy number changes by a single method supercoiling-sensitive quantitative PCR (ss-qPCR). However, the experimental strategies presented, lack clarity. The author has tried to prove the potential of method by proving the vulnerability of mtDNA in oral cancer cells against oxidative stress. However, it would be preferable if the author could demonstrate the experimental results obtained from this method compared to other experimental approaches yielding comparable outcomes. The study is not novel.

Reviewers' comments:

Reviewer's Responses to Questions

Comments to the Author

1. Is the manuscript technically sound, and do the data support the conclusions?

The manuscript must describe a technically sound piece of scientific research with data that supports the conclusions. Experiments must have been conducted rigorously, with appropriate controls, replication, and sample sizes. The conclusions must be drawn appropriately based on the data presented.

Reviewer #1: Partly

Reviewer #2: No

**********

2. Has the statistical analysis been performed appropriately and rigorously?

Reviewer #1: Yes

Reviewer #2: Yes

**********

3. Have the authors made all data underlying the findings in their manuscript fully available?

The PLOS Data policy requires authors to make all data underlying the findings described in their manuscript fully available without restriction, with rare exception (please refer to the Data Availability Statement in the manuscript PDF file). The data should be provided as part of the manuscript or its supporting information, or deposited to a public repository. For example, in addition to summary statistics, the data points behind means, medians and variance measures should be available. If there are restrictions on publicly sharing data—e.g. participant privacy or use of data from a third party—those must be specified.

Reviewer #1: Yes

Reviewer #2: Yes

**********

4. Is the manuscript presented in an intelligible fashion and written in standard English?

PLOS ONE does not copyedit accepted manuscripts, so the language in submitted articles must be clear, correct, and unambiguous. Any typographical or grammatical errors should be corrected at revision, so please note any specific errors here.

Reviewer #1: Yes

Reviewer #2: No

**********

5. Review Comments to the Author

Please use the space provided to explain your answers to the questions above. You may also include additional comments for the author, including concerns about dual publication, research ethics, or publication ethics. (Please upload your review as an attachment if it exceeds 20,000 characters)

Reviewer #1: The authors have presented a well conducted and rigorous research. However the authors should in more or better detail explain why they chose to use normal skin fibroblasts as their control rather than cells that are more similar to the normal oral squamous epithelium for better comparison.

Reviewer #2: The author of the manuscript titled "Mitochondrial DNA is a sensitive surrogate and oxidative stress target in oral cancer cells" claim that mitochondrial DNA of oral cancer cell is sensitive to oxidative stress than normal cells and analysed mtDNA damage, repair and copy number changes by a single method supercoiling-sensitive quantitative PCR (ss-qPCR). However, the experimental strategies presented, lack clarity. The author has tried to prove the potential of method by proving the vulnerability of mtDNA in oral cancer cells against oxidative stress. However, it would be preferable if the author could demonstrate the experimental results obtained from this method compared to other experimental approaches yielding comparable outcomes. The study is not novel.

**********

6. PLOS authors have the option to publish the peer review history of their article (what does this mean?). If published, this will include your full peer review and any attached files.

If you choose “no”, your identity will remain anonymous but your review may still be made public.

Do you want your identity to be public for this peer review? For information about this choice, including consent withdrawal, please see our Privacy Policy.

Reviewer #1: No

Reviewer #2: No

**********

[NOTE: If reviewer comments were submitted as an attachment file, they will be attached to this email and accessible via the submission site. Please log into your account, locate the manuscript record, and check for the action link "View Attachments". If this link does not appear, there are no attachment files.]

While revising your submission, please upload your figure files to the Preflight Analysis and Conversion Engine (PACE) digital diagnostic tool, https://pacev2.apexcovantage.com/. PACE helps ensure that figures meet PLOS requirements. To use PACE, you must first register as a user. Registration is free. Then, login and navigate to the UPLOAD tab, where you will find detailed instructions on how to use the tool. If you encounter any issues or have any questions when using PACE, please email PLOS at figures@plos.org. Please note that Supporting Information files do not need this step.

10.1371/journal.pone.0304939.r002
Author response to Decision Letter 0
Submission Version1
1 Aug 2024

Dear Reviewer,

Thank you for your valuable feedback on our manuscript.We appreciate the time and effort you and the reviewers have dedicated to evaluating our work.We take your feedback seriously and are committed to addressing all points raised.We have carefully considered all your comments, and our replies are outlined as follows.

Journal Requirements:

1.Question: Ensure that your manuscript meets PLOS ONE's style requirements, including those for file naming.

Answer：The manuscript has been submitted in accordance with the required format.

2.Question：We note that the grant information you provided in the ‘Funding Information’ and ‘Financial Disclosure’ sections do not match. When you resubmit, please ensure that you provide the correct grant numbers for the awards you received for your study in the ‘Funding Information’ section.

Answer：I have revised and proofread the relevant project numbers and names in the 'Funding Information' section. However, I am unable to locate the 'Financial Disclosure' section and cannot make modifications there. I have also uploaded the project numbers as an attachment.

3.Question：Please note that funding information should not appear in the Acknowledgments section or other areas of your manuscript. We will only publish funding information present in the Funding Statement section of the online submission form. Please remove any funding-related text from the manuscript.

Answer:I have removed the acknowledgments section from the manuscript, and there are no references to funding or grants throughout the entire text.

4.Question:We note that your Data Availability Statement is currently as follows:"All relevant data are within the manuscript and its Supporting Information files"Please confirm at this time whether or not your submission contains all raw data required to replicate the results of your study. Authors must share the “minimal data set” for their submission.

Answer:The original data and statistical information corresponding to the images have been uploaded as Supporting Information files, with each folder corresponding to the respective image.

5.Question:PLOS ONE now requires that authors provide the original uncropped and unadjusted images underlying all blot or gel results reported in a submission’s figures or Supporting Information files.

Answer:The original data images of the gel have been uploaded under the filename "S1_raw_images."

Additional Editor Comments: 

Reviewer 1

The authors have presented a well conducted and rigorous research. However the authors should in more or better detail explain why they chose to use normal skin fibroblasts as their control rather than cells that are more similar to the normal oral squamous epithelium for better comparison.

Answer:First,regarding the choice of cells as controls. In the process of selecting cells for our study, we noted that there were no relevant normal squamous epithelial cell lines available on the ATCC website. Additionally, we found that the experimental designs in relevant literature predominantly utilized normal human dermal fibroblast cell line BJ as a control. For instance, studies such as those by Dominika Szlachcikowska et al. (Int. J. Mol. Sci. 2024, 25, 7329) and Bartosz Skóra et al. (Toxicology and Applied Pharmacology 443 (2022) 116009) have established the use of BJ cells in similar contexts. Therefore, we chose to use normal skin fibroblasts as our control in this study.We hope this clarifies our rationale for the selection of the control cell line.

Reviewer 2

The author of the manuscript titled "Mitochondrial DNA is a sensitive surrogate and oxidative stress target in oral cancer cells" claim that mitochondrial DNA of oral cancer cell is sensitive to oxidative stress than normal cells and analysed mtDNA damage, repair and copy number changes by a single method supercoiling-sensitive quantitative PCR (ss-qPCR). However, the experimental strategies presented, lack clarity. The author has tried to prove the potential of method by proving the vulnerability of mtDNA in oral cancer cells against oxidative stress. However, it would be preferable if the author could demonstrate the experimental results obtained from this method compared to other experimental approaches yielding comparable outcomes. The study is not novel.

Answer:Firstly, during our sensitivity assessment of the experimental methods, previous publications have confirmed that the two-step sensitive quantitative detection method (ss-qPCR) significantly reduces the background levels of mitochondrial DNA damage when compared to conventional PCR methods. This significant reduction in baseline levels is crucial for effectively detecting changes in mitochondrial DNA damage, as traditional methods cannot accurately quantify such damage in mitochondrial DNA.

Additionally, to demonstrate the sensitivity of our method, we conducted flow cytometry and gel electrophoresis experiments. The results confirmed that our ss-qPCR method allows for the detection of damage in both mitochondrial DNA and nuclear DNA. In contrast, flow cytometry and gel electrophoresis primarily assess damage to nuclear DNA and are not effective for detecting mitochondrial DNA damage.

We appreciate your understanding and hope this adequately addresses your concerns.

Thank you for your consideration.

Sincerely,

Haiwen Liu

Attachment Submitted filename: Response to Reviewers.docx

10.1371/journal.pone.0304939.r003
Decision Letter 1
Nigam Manisha Academic Editor
© 2024 Manisha Nigam
2024
Manisha Nigam
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Submission Version1
15 Aug 2024

Mitochondrial DNA is a sensitive surrogate and oxidative stress target in oral cancer cells

PONE-D-24-20532R1

Dear Dr. Liu,

We’re pleased to inform you that your manuscript has been judged scientifically suitable for publication and will be formally accepted for publication once it meets all outstanding technical requirements.

Within one week, you’ll receive an e-mail detailing the required amendments. When these have been addressed, you’ll receive a formal acceptance letter and your manuscript will be scheduled for publication.

An invoice will be generated when your article is formally accepted. Please note, if your institution has a publishing partnership with PLOS and your article meets the relevant criteria, all or part of your publication costs will be covered. Please make sure your user information is up-to-date by logging into Editorial Manager at Editorial Manager® and clicking the ‘Update My Information' link at the top of the page. If you have any questions relating to publication charges, please contact our Author Billing department directly at authorbilling@plos.org.

If your institution or institutions have a press office, please notify them about your upcoming paper to help maximize its impact. If they’ll be preparing press materials, please inform our press team as soon as possible -- no later than 48 hours after receiving the formal acceptance. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

Kind regards,

Manisha Nigam

Academic Editor

PLOS ONE

10.1371/journal.pone.0304939.r004
Acceptance letter
Nigam Manisha Academic Editor
© 2024 Manisha Nigam
2024
Manisha Nigam
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
21 Aug 2024

PONE-D-24-20532R1

PLOS ONE

Dear Dr. Liu,

I'm pleased to inform you that your manuscript has been deemed suitable for publication in PLOS ONE. Congratulations! Your manuscript is now being handed over to our production team.

At this stage, our production department will prepare your paper for publication. This includes ensuring the following:

* All references, tables, and figures are properly cited

* All relevant supporting information is included in the manuscript submission,

* There are no issues that prevent the paper from being properly typeset

If revisions are needed, the production department will contact you directly to resolve them. If no revisions are needed, you will receive an email when the publication date has been set. At this time, we do not offer pre-publication proofs to authors during production of the accepted work. Please keep in mind that we are working through a large volume of accepted articles, so please give us a few weeks to review your paper and let you know the next and final steps.

Lastly, if your institution or institutions have a press office, please let them know about your upcoming paper now to help maximize its impact. If they'll be preparing press materials, please inform our press team within the next 48 hours. Your manuscript will remain under strict press embargo until 2 pm Eastern Time on the date of publication. For more information, please contact onepress@plos.org.

If we can help with anything else, please email us at customercare@plos.org.

Thank you for submitting your work to PLOS ONE and supporting open access.

Kind regards,

PLOS ONE Editorial Office Staff

on behalf of

Dr. Manisha Nigam

Academic Editor

PLOS ONE
==== Refs
References

1 Xia Li , Hengjie Ren . Long noncoding RNA PVT1 promotes tumor cell proliferation, invasion, migration and inhibits apoptosis in oral squamous cell carcinoma by regulating miR-150-5p/GLUT-1.Oncol Rep. 2020 Oct;44 (4 ):1524–1538.32945498
2 https://gco.iarc.fr/today/data/factsheets/populations/682-saudi-arabia-factsheets.pdf 2020;2nd March.
3 Rivera César . Review Article Essentials of oral cancer. Int J Clin Exp Pathol 2015;8 (9 ):11884–11894.26617944
4 Waruna Lakmal Dissanayaka Gayani Pitiyage , Kumarasiri Pallegoda Vithanage Ranjith , et al .Clinical and histopathologic parameters in survival of oral squamous cell carcinoma. Oral Surg Oral Med Oral Pathol Oral Radiol 2012; 113 (4 ):518–25. doi: 10.1016/j.oooo.2011.11.001 22668430
5 Koontongkaew Sittichai . The tumor micro environment contribution to development, growth, invasion and metastasis of head and neck squamous cell carcinomas. J Cancer 2013; 4 (1 ):66–83. doi: 10.7150/jca.5112 23386906
6 Sam W Chan Phuong-Nam Nguyen , Chen Junjian Z , et al . Mitochondrial DNA damage is sensitive to exogenous H2O2 but independent of cellular ROS production in prostate cancer cells. Mutation Research 2011;716 (1–2 ):40–50.21843533
7 Commoner B. , Townsend J. , Pake G.E. Free radicals in biological materials. Nature 1954; 174 (4432 ):689–91. doi: 10.1038/174689a0 13213980
8 Srinivas US , Tan BWQ , Vellayappan BA , et al . ROS and the DNA damage response in cancer. Redox Biol. 2019 Jul;25 :101084. doi: 10.1016/j.redox.2018.101084 30612957
9 Dreher D , Junod AF . Role of oxygen free radicals in cancer development. Eur J Cancer. 1996 Jan;32A (1 ):30–8. doi: 10.1016/0959-8049(95)00531-5 8695238
10 Fang J , Nakamura H , Iyer AK . Tumor-targeted induction of oxystress for cancer therapy. J Drug Target. 2007 Aug-Sep;15 (7–8 ):475–86. doi: 10.1080/10611860701498286 17671894
11 Simizu S , Takada M , Umezawa K , et al . Requirement of caspase-3(-like) protease-mediated hydrogen peroxide production for apoptosis induced by various anticancer drugs. J Biol Chem. 1998 Oct 9;273 (41 ):26900–7. doi: 10.1074/jbc.273.41.26900 9756937
12 Martindale JL , Holbrook NJ . Cellular response to oxidative stress: signaling for suicide and survival. J Cell Physiol. 2002 Jul;192 (1 ):1–15. doi: 10.1002/jcp.10119 12115731
13 Matés JM , Sánchez-Jiménez F . Antioxidant enzymes and their implications in pathophysiologic processes. Front Biosci. 1999 Mar 15;4 :D339–45. doi: 10.2741/mates 10077544
14 Park SY , Kim YH , Kim EK , et al . Heme oxygenase-1 signals are involved in preferential inhibition of pro-inflammatory cytokine release by surfactin in cells activated with Porphyromonas gingivalis lipopolysaccharide. Chem Biol Interact. 2010 Dec 5;188 (3 ):437–45. doi: 10.1016/j.cbi.2010.09.007 20833156
15 Wu Chaoying , Tong Lingxia , Wu Chaoqun , et al . Two miRNA prognostic signatures of head and neck squamous cell carcinoma: A bioinformatic analysis based on the TCGA dataset. Cancer Med. 2020 Apr;9 (8 ):2631–2642. doi: 10.1002/cam4.2915 32064753
16 Mailloux RJ . An update on methods and approaches for interrogating mitochondrial reactive oxygen species production. Redox Biol. 2021 Sep;45 :102044. doi: 10.1016/j.redox.2021.102044 34157640
17 Halliwell B. , Gutteridge J.M.C. Free Radicals in Biology and Medicine. Clarendon Press, Oxford, England, 1999.
18 Toyokuni S. , Okamoto K. , Yodoi J. , et al . Persistent oxidative stress in cancer. FEBS Lett 1995; 358 (1 ):1–3. doi: 10.1016/0014-5793(94)01368-b 7821417
19 Wu Zheng , Sainz Alva G , Shadel Gerald S .Mitochondrial DNA: cellular genotoxic stress sentinel. Trends Biochem Sci 2021; 46 (10 ):812–821.34088564
20 Boulden BM , Widder JD , Allen JC , et al . Early determinants of H2O2-induced endothelial dysfunction. Free Radic Biol Med. 2006 Sep 1;41 (5 ):810–7. doi: 10.1016/j.freeradbiomed.2006.05.030 16895801
21 Chen J , Kadlubar FF , Chen JZ . DNA supercoiling suppresses real-time PCR: a new approach to the quantification of mitochondrial DNA damage and repair. Nucleic Acids Res. 2007;35 (4 ):1377–88. doi: 10.1093/nar/gkm010 17284464
22 Chan SW , Chen JZ . Measuring mtDNA damage using a supercoiling-sensitive qPCR approach. Methods Mol Biol. 2009;554 :183–97. doi: 10.1007/978-1-59745-521-3_12 19513675
23 Kumar P , Nagarajan A , Uchil PD . Analysis of Cell Viability by the MTT Assay. Cold Spring Harb Protoc. 2018 Jun 1;2018 (6 ). doi: 10.1101/pdb.prot095505 29858338
24 Bourton Emma C , Plowman Piers N , Zahir Sheba Adam , et al . Multispectral imaging flow cytometry reveals distinct frequencies of ɤ-H2AX foci induction in double strand break repair defective human cell Lines. Cytometry A 2012; 81 (2 ):130–7.22170789
25 Sharma A , Singh K , Almasan A . Histone H2AX phosphorylation: a marker for DNA damage. Methods Mol Biol. 2012;920 :613–26. doi: 10.1007/978-1-61779-998-3_40 22941631
26 Luke AM , Nakamura J . O-hydroxylamine-coupled alkaline gel electrophoresis assay for the detection and measurement of DNA single-strand breaks. Methods Mol Biol. 2012;920 :307–13. doi: 10.1007/978-1-61779-998-3_21 22941612
27 Andreoli C , Rossi S , Leopardi P , et al . DNA damage by hydroquinone in human white blood cells: analysis by alkaline single-cell gel electrophoresis. Mutat Res.1999; 438 (1 ):37–45. doi: 10.1016/s1383-5718(98)00160-0 9858677
28 Chan Sam W. , Nguyen Phuong-Nam , Chen Junjian Z. , et al . Mitochondrial DNA damage is sensitive to exogenous H2O2 but independent of cellular ROS production in prostate cancer cells. Mutation Research, 2011, 716 : 40–50.21843533
29 Tammaro M , Barr P , Ricci B , et al . Replication-dependent and transcription-dependent mechanisms of DNA double-strand break induction by the topoisomerase 2-targeting drug etoposide. PLoS One. 2013 Nov 7;8 (11 ):e79202. doi: 10.1371/journal.pone.0079202 24244448
30 Hansen Lasse Tengbjerg , Lundin Cecilia , Spang-Thomsen Mogens , et al . The role of RAD51 in etoposide (VP16) resistance in small cell lung cancer. Int J Cancer 2003; 105 (4 ):472–9. doi: 10.1002/ijc.11106 12712436
31 Kuo Linda J , Yang Li-Xi . Gamma-H2AX—a novel biomarker for DNA double-strand breaks. In Vivo 2008;22 (3 ):305–9. 18610740
32 Kobayashi Junya . Molecular mechanism of the recruitment of NBS1/hMRE11/hRAD50 complex to DNA double-strand breaks: NBS1 binds to γ-H2AX through FHA/BRCT domain. J Radiat Res 2004; 45 (4 ):473–8.15635255
33 Lee Pei Yun , Costumbrado John , Hsu Chih-Yuan , et al . Agarose gel electrophoresis for the separation of DNA fragments. J Vis Exp 2012; 20 (62 ):3923. doi: 10.3791/3923 22546956
34 Liu SS . Generating, partitioning, targeting and functioning of superoxide in m- itochondria. Biosci Rep 1997; 17 (3 ):259–72. doi: 10.1023/a:1027328510931 9337481
35 J Poulton V Macaulay, D R Marchington. Mitochondrial genetics’98 is the bottle neck cracked. Am J Hum Genet 1998; 62 (4 ):752–7.9529369
36 Bianchi NO , Bicmchi MS , Rich SM . Mitochondrial genome instability in human cancers. Mutat Res 2001;488 (1 ):9–23. doi: 10.1016/s1383-5742(00)00063-6 11223402
37 Loeb LA . A mutator phenotype in cancer. Cancer Res 2001; 61 (8 ):3230–9. 11309271
38 Penta JS , Johnson FM , Wachsman JT , et al . Mitochondrial DNA in human malignancy. Mutat Res 2001; 488 (2 ):119–33. doi: 10.1016/s1383-5742(01)00053-9 11344040
