
==== Front
Microbiol Spectr
Microbiol Spectr
spectrum
Microbiology Spectrum
2165-0497
American Society for Microbiology 1752 N St., N.W., Washington, DC

39078160
spectrum00634-24
10.1128/spectrum.00634-24
spectrum.00634-24
Research Article
clinical-microbiologyClinical MicrobiologyDevelopment of a TaqMan probe-based multiplex real-time PCR for the simultaneous detection of four clinically important filamentous fungi
Wei Yutong 1 2 Conceptualization Formal analysis Investigation Methodology Writing – original draft
Lin Yangxuan 1 2 Conceptualization Formal analysis Methodology Writing – original draft
Zhao Jingya 2 Conceptualization Methodology Supervision
Li Dingchen 2 Formal analysis Methodology Supervision
Yang Zhankui 2 3 Formal analysis Investigation
https://orcid.org/0000-0001-9545-1952
Chen Fangyan 2 Conceptualization Methodology Supervision Validation Writing – original draft chenfangyan1986@163.com

https://orcid.org/0000-0001-9013-8414
Han Li 1 2 Conceptualization Funding acquisition Project administration Resources Supervision Validation Writing – original draft hanlicdc@163.com

1 School of Public Health, Anhui Medical University , Anhui, China
2 Department for Disinfection and Infection Control, Chinese PLA Center for Disease Control and Prevention , Beijing, China
3 Zhengzhou University , Zhengzhou, China
Editor Kovacs Renato University of Debrecen , Debrecen, Hungary

Address correspondence to Li Han, hanlicdc@163.com
Address correspondence to Fangyan Chen, chenfangyan1986@163.com
The authors declare no conflict of interest.

9 2024
30 7 2024
30 7 2024
12 9 e00634-2409 3 2024
20 6 2024
Copyright © 2024 Wei et al.
2024
Wei et al.
https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International license.

ABSTRACT

Filamentous fungi present significant health hazards to immunocompromised individuals globally; however, the prompt and precise identification of them during infection remains challenging. In this study, a TaqMan probe-based multiplex real-time PCR (M-qPCR) assay was developed to detect simultaneously the target genes of four important pathogenic filamentous fungi: ANXC4 gene of Aspergillus fumigatus, EF1-α gene of Fusarium spp., mitochondrial rnl gene of Mucorales, and hcp100 gene of Histoplasma capsulatum. In this M-qPCR assay, the limit of detection (LoD) to all four kinds of fungi was 100 copies and the correlation coefficients (R2) were above 0.99. The specificity of this assay is 100%, and the minimum detection limit is 100 copies/reaction. In conclusion, an M-qPCR detection assay was well established with high specificity and sensitivity for rapid and simultaneous detection on four important filamentous fungi in the clinic.

IMPORTANCE

World Health Organization developed the first fungal priority pathogens list (WHO FPPL) in 2022. Aspergillus fumigatus, Mucorales, Fusarium spp., and Histoplasma spp. are the four types of pathogenic fungi with filamentous morphology in the critical priority group and high priority group of WHO FPPL. These four filamentous fungal infections have become more common and severe in immunocompromised patients with the increase in susceptible populations in recent decades, which resulted in a substantial burden on the public health system. However, prompt and precise identification of them during infection remains challenging. Our study established successfully a TaqMan probe-based multiplex real-time qPCR assay for four clinically important filamentous fungi, A. fumigatus, Fusarium spp., Mucorales, and Histoplasma capsulatum, with high sensitivity and specificity, which shows promising potential for prompt and precise diagnosis against fungal infection.

KEYWORDS

fungal infection
multiplex real-time qPCR
Aspergillus fumigatus
Mucorales
Histoplasma capsulatum
Fusarium spp
cover-dateSeptember 2024
==== Body
pmcINTRODUCTION

Fungi are ubiquitous eukaryotic organisms in the environment (1). To date, several hundred of fungal species have been known to be capable of causing various human infectious diseases (2, 3). Globally, each year, approximately 3 million people develop chronic severe fungal infections and nearly 1.9 million patients develop acute invasive fungal disease (IFD) (4). With the mortality rate ranging from 30% to 90%, invasive fungal infections have become more common and severe in immunocompromised patients with the increase in susceptible populations in recent decades (5), which resulted in a substantial burden on the public health system (3, 6).

Significantly, in response to the rising threat of fungal infections, combined with existing and emerging resistance and treatability issues, the World Health Organization (WHO) developed the first fungal priority pathogens list (WHO FPPL) in 2022 (7). Aspergillus fumigatus, Mucorales, Fusarium spp., and Histoplasma spp. are the four types of pathogenic fungi with filamentous morphology in the critical priority group and high priority group of WHO FPPL. A. fumigatus is the primary pathogen for invasive aspergillosis (IA), chronic aspergillosis, and allergic bronchopulmonary aspergillosis, etc., through the inhalation of its ubiquitous conidia by host. Recently, it has also been observed in patients with severe influenza or COVID-19 pneumonia (8). This study revealed a significant occurrence of IA exceeding 10% among intensive care unit (ICU) patients with influenza pneumonia, and this condition was linked to elevated mortality rates in critically ill individuals infected with COVID-19, ranging from 16% to 25% (9). Mucormycosis, a life-threatening infection primarily caused by the genus Rhizopus of the order Mucorales, is a rare and challenging-to-diagnose disease associated with considerable morbidity and mortality (8, 10). Furthermore, the mortality rate of mucormycosis varies between 40% and 80%, depending on the underlying conditions and sites of infection (10). Fusariosis ranks as the third most prevalent mold infection in many countries (10, 11), trailing behind aspergillosis and mucormycosis. In immunocompromised patients, infections caused by Fusarium spp. exhibit a substantial mortality rate, ranging from 50% to 70% (11, 12). Histoplasmosis, attributed to Histoplasma spp., presents a wide range of clinical manifestations, spanning from subclinical or mild respiratory disease to progressive disseminated histoplasmosis (PDH). It stands as a prominent cause of fungal respiratory infection in regions where it is endemic (13, 14); in many highly endemic countries, accurate diagnosis of histoplasmosis remains challenging and limited (15).

The scarcity of prompt and accurate diagnostic techniques significantly contributes to the elevated morbidity and mortality associated with fungal infections. The sensitivity of microscopic examination for detecting fungal infections is limited, particularly in the early stages of infection or during the optimal treatment window (5, 16). Although culture methods are considered the gold standard for identifying fungal pathogens, they are time-consuming with low positivity rate, which significantly hinders the prompt and effective treatment for patients.

With the advancement of molecular biology and sequencing technology, quantitative real‐time reverse transcription polymerase chain reaction (RT-qPCR) assay has been widely used for the detection of fungi. It has been applied in diagnosing histoplasmosis from blood and bronchoalveolar lavage (17), as well as accurately identifying clinically important fungal genera and species, such as Aspergillus spp., Fusarium spp., Scedosporium, and the Mucormycetes from paraffin-embedded tissues (18). Multiplex qPCR (M-qPCR) assay had been developed for the simultaneous and precise detection of multiple targets in a single reaction, thereby improving the speed and efficiency of diagnosis. For fungal detection, several M-qPCR assays were developed for the simultaneous detection of three types of fungi, including Sporothrix brasiliensis, Sporothrix globose, and Sporothrix schenckii (19), and the identification of Pneumocystis jirovecii, H. capsulatum, and Cryptococcus neoformans/Cryptococcus gattii in samples obtained from AIDS patients suffering from opportunistic pneumonia (20).

Up to date, no M-qPCR method was available for the simultaneous detection of four clinically important filamentous fungi, A. fumigatus, Mucorales, Fusarium spp., and Histoplasma spp. listed in the critical priority group and high priority group of WHO FPPL. In this study, a TaqMan probe-based M-qPCR assay was developed to simultaneously and specifically detect these four types of fungi for prompt clinical detection.

MATERIALS AND METHODS

Strains and growth conditions

The strains utilized in this research were obtained from the BeNa Culture Collection, China Center of Industrial Culture Collection, and the laboratory of the Department of Disinfection and Infection Control, Chinese PLA Center for Disease Control and Prevention (as indicated in Table 1). The fungi were cultivated on potato dextrose agar at a temperature of 28°C or 37°C and allowed to incubate for 2–5 days. Bacteria were cultured in Luria-Bertani (LB) liquid culture medium at 37°C on a shaker at 60 r/min overnight.

TABLE 1 Strains used in this study

Genus	Latin name	Source/strain	
Aspergillus	Aspergillus fumigatus	B5233	
Fusarium	Fusarium solani	BNCC337554	
	Fusarium oxysporum	BNCC120618	
	Fusarium fujikuroi	BNCC186248	
Mucorales	Rhizopus microsporus	BNCC145129	
	Rhizopus oryzae	BNCC336269	
	Mucor racemosus	BNCC336225	
	Mucor circinelloides	BNCC147484	
Histoplasma	Histoplasma capsulatum	Isolated strain	
Non-targeted	Penicillium oxalicum	Isolated strain	
	Penicillium chrysogenum	Isolated strain	
	Aspergillus flavus	Isolated strain	
	Aspergillus terreus	Isolated strain	
	Aspergillus niger	Isolated strain	
	Candida albicans	Isolated strain	
	Candida auris	Isolated strain	
	Candida parapsilosis	Isolated strain	
	Candida glabrata	Isolated strain	
	Cryptococcus neoformans	Isolated strain	
	Cryptococcus gattii	Isolated strain	
	Staphylococcus aureus	Isolated strain	
	Escherichia coli	Isolated strain	
	Type II human alveolar epithelial cell	A549	

Primer and probe design

The species-specific qPCR primers and probe sets used in this study for Mucorales were developed by Rui Xu (21), the detection target is the mitochondrial gene rnl, and the primers and probes for A. fumigatus, Fusarium spp., and H. capsulatum were designed and developed by software AlleleID 6.0 (Primer BioSoft, USA) in this study. The detection target selection for A. fumigatus, Fusarium spp., and H. capsulatum is annexin (ANXC4) gene, translation elongation factor 1-alpha (EF1-α) gene, and 100 kDa protein (Hcp100) gene, respectively.

Details of the target gene name, primers, and probes are listed in Table 2. The pairwise sequence alignment tool of the Basic Local Alignment Search Tool (BLAST) from the National Center for Biotechnology Information (NCBI) was used to analyze the specificity of primers and probes, confirming the absence of cross-reactivity with human and non-target fungi. All primers and probes were synthesized by Sangon Biotech (Shanghai, China).

TABLE 2 Primer and TaqMan probe sequences used in qPCR assay

Organism	Gene target	Oligonucleotide (5’−3’)	Final reaction concentration (nM)	
A. fumigatus	Annexin C4 (ANXC4)	Forward: CAGTGACGTATGAGAGTC	200	
Reverse: GGACATAACTGGACCATC	200	
Probe: FAM-CTACTCAGATACGGACGACGAG-BHQ1	100	
Mucorales	rnl	Forward: AACCGACACTGGTCTGCTG	200	
Reverse: TCTTCTATTCTGTGCCACGAC	200	
Probe: VIC-TCCCGAAGTTACGGAGTCATTTTGC- BHQ1	100	
H. capsulatum	100 kDa protein (Hcp100)	Forward: TTCCGTGCAGAAAATTCG	200	
Reverse: GATCCAATGTCCGTTCAC	200	
Probe: Texas Red-TCCCGAAGTTACGGAGTCATTTTGC-BHQ2	100	
Fusarium	Translation elongation factor 1 alpha (EF1-α)	Forward: GGTAAGGAGGACAAGACTCACC	200	
Reverse: TTGTCGATACCACCGCACTG	200	
Probe: CY5-CGTCGTCGTCATCGGCCACGTCG-BHQ2	100	

DNA extraction

Genomic DNA of all fungal/bacterial cultures was extracted using the Biospin Fungal/bacterial genomic DNA Extraction kit (BioerTechnology, Hangzhou, China), and simulated clinical samples were processed using the DNeasy Blood and Tissue Kit (Qiagen, Madrid, Spain), according to the manufacturer’s instructions. Total elution volume of DNA was 50 µL. Quantification of DNA was performed using a DeNovix spectrophotometer (DeNovix Inc., USA). Samples were then stored at −20°C until analysis.

Construction and extraction of recombinant plasmids

To obtain engineered bacteria containing the target gene, the ANXC4 gene of A. fumigatus, rnl gene of Mucorales, EF1-α gene of Fusarium spp., and Hcp100 gene of H. capsulatum were constructed into pUC57 vector by Sangon Biotech. A plasmid mini-extract kit (OMEGA company) was employed to extract the plasmid DNA containing the target gene. Quantification of DNA was performed using a DeNovix spectrophotometer (DeNovix Inc., USA). The copy number of recombination plasmids was calculated by using the following formula (22): plasmid copies/μL = (6.02 × 1023) × (ng/μL × 10−9)/[ plasmid length (bp) × 660].

Each plasmid was diluted from 1 × 1010 copies/μL to 1 × 101 copies/μL with a 10-fold gradient dilution to establish a simplex standard curve for each type of fungus. For the construction of multiplex standard curves, the plasmids of four fungi were mixed with equal mass and then diluted 10-fold gradient to 1 × 101 copies/μL. All plasmid DNA was then stored at −20°C until analysis.

Real-time qPCR assay

The real-time qPCR reaction was conducted in a 20 µL volume and performed in the Bio-Rad CFX Opus 96 System (Bio-Rad, CA, USA). For simplex qPCR (S-qPCR), the reaction mixture consisted of 10 µL 2× FsatFire qPCR Pre-Mix (Beijing Tiangen, China), 0.8 µL of each primer(10 µM), 0.4 µL of probe(10 µM), 7 µL nuclease-free water, and 1 µL DNA template. For multiplex qPCR (M-qPCR), the reaction mixture consisted of 10 µL 2× FsatFire qPCR Pre-Mix combined with all primers, probes, templates, and nuclease-free water. The concentrations of each primer and probe of A. fumigatus, Mucorales, Fusarium spp., and H. capsulatum were optimized for better outputs.

The cycling conditions encompassed an initial preincubation step at 95°C for 1 min, followed by an amplification program consisting of 40 cycles: denaturation at 95°C for 5 s and annealing/extension at 60°C for 15 s. The amplifying cycles of M-qPCR were carried out as the same as S-qPCR. The threshold for determining positivity was established as a cycle threshold (CT) value of <38. The quantification cycle values were assessed for each reaction using CFX Maestro software. In each experimental trial, both negative and positive controls were included.

Specificity, sensitivity, and reproducibility analysis of qPCR assay

Specificity and potential cross-reactivity were evaluated by using four target plasmids (A. fumigatus, Mucorales, H. capsulatum, and Fusarium spp.) and genomic DNA extracted from 13 non-target strains (Table 1) and type II human alveolar epithelial cell A549. Nuclease-free water was used as blank control. Each experiment was repeated three times.

To analyze the sensitivity of M-qPCR, 10-fold dilutions of mixtures from the four plasmids were prepared as above, with the final concentration ranging from 1 × 1010 copies/μL to 1 × 101 copies/μL. Each experiment was repeated three times.

The repeatability analysis of M-qPCR was assessed by intra-assay and inter-assay, and 10-fold dilutions of mixtures from the four plasmids were used as templates for amplification.

Validation of M-qPCR assay

The substrates used for the simulation experiments were artificial sputum medium and simulated serum (Biochemazone, Canada). To simulate clinical samples, a 10-fold dilution series of 106 to 101 conidia of A. fumigatus, three Fusarium species (F. solani, F. oxysporum, and F. fujikuroi) and sporangiospores of Mucorales (R. microsporus, R. oryzae, M. racemosus, and M. circinelloides) were added to 200 µL simulated serum and sputum, respectively. The genomic DNA was extracted as described above. Due to the fact that cultivation of H. capsulatum requires a biological safety protection third-level laboratory, we added 2 mg to 20 ng mycelium powder of H. capsulatum to simulated serum and sputum as simulated clinical samples for M-qPCR assay, and the genomic DNA was extracted as mentioned above. All the genomic DNA was stored at −20°C until analysis.

Statistical analysis

Statistical analysis was conducted using GraphPad Prism8 software (GraphPad Software, La Jolla, CA). The data in Table 4 were represented as the mean ± standard deviation of the mean from at least three independent experiments, whereas the data in Fig. 2 and 4 were represented as the mean. A linear regression analysis was used to assess the differences between the S-qPCR and M-qPCR standard curves. Variability was measured by the standard error of the mean.

RESULTS

Specificity of the S-qPCR assays

The primer and probe for each target of four fungi, A. fumigatus, M ucorales, H. capsulatum, and Fusarium spp. were established and evaluated by S-qPCR assay, respectively. The specificity of S-qPCR was confirmed with plasmid DNA of these four fungi, and genomic DNA was extracted from 13 non-target strains (Table 1) and A549. As shown in Fig. 1A, A. fumigatus sample exhibited the amplification curve in S-qPCR reaction, which included the primers and probes (Table 2) targeting ANXC4 gene of A. fumigatus, whereas the 16 non-A. fumigatus samples and the human blood sample did not yield amplification (Table S3). As shown in Fig. 1B, only the Mucorales sample exhibited the amplification curve in S-qPCR reaction, which included the primers and probes (Table 2) targeting rnl gene of Mucorales, whereas the 16 non-Mucorales samples and the human blood sample did not yield amplification (Table S3). As shown in Fig. 1C, only H. capsulatum sample exhibited the amplification curve in S-qPCR reaction, which included the primers and probes (Table 2) targeting Hcp100 gene of H. capsulatum, whereas the 16 non-H. capsulatum samples and the A549 did not yield amplification (Table S3). As shown in Fig. 1D, only the Fusarium spp. sample exhibited the amplification curve in S-qPCR reaction, which included the primers and probes (Table 2) targeting the EF1-α gene of Fusarium spp., whereas the 16 non-Fusarium spp. samples and the A549 did not yield amplification (Table S3). All the amplification curves were smooth and S-shaped.

Fig 1 Specificity of primers and probes of four fungi determined by S-qPCR assay. Plasmid DNA from A. fumigatus (A), Mucorales (B), H. capsulatum (C), and Fusarium spp. (D) and genomic DNA from 13 non-target fungi and type II human alveolar epithelial cell A549 were used as the template for S-qPCR reaction mixtures.

Standard curves of S-qPCR assay

The efficiency of S-qPCR for each target was investigated by constructing a standard curve based on the serial dilution of plasmid DNA. The standard curves showed linearity for A. fumigatus (Fig. 2A), with high efficiencies of 101%, 99.27% for Mucorales (Fig. 2B), 96.52% for H. capsulatum (Fig. 2C), and 93.84% for Fusarium spp. (Fig. 2D). The amplification curves of the four fungi had a good linear relationship with the CT values, with all R2 values above 0.99. All target species were detected at the minimum plasmid DNA concentration of 1 × 102 copies/μL, corresponding with CT values of 36.5 ± 0.26 for A. fumigatus, 37.79 ± 0.26 for Mucorales, 37.18 ± 0.41 for H. capsulatum, and 37.51 ± 0.49 for Fusarium spp. (Table S1).

Fig 2 The standard curve of A. fumigatus, Mucorales, H. capsulatum, and Fusarium spp. by S-qPCR assay. The standard curve was established using the obtained CT values as the vertical coordinates and the logarithm of the concentration of the plasmid as the horizontal coordinate (102–107 copies/μL). A. fumigatus (A), Mucorales (B), H. capsulatum (C), and Fusarium spp. (D). All data points are from an average of three technical replicates.

Optimization of M-qPCR reaction conditions

In order to optimize the reaction condition of M-qPCR assay, the concentration of each primer and probe in the whole reaction was combined using an orthogonal design (Table S2). In total, 25 different combinations were tested, and the lowest plasmid DNA concentration detected was in group 13. Taken together, the concentrations of primers and probes for four fungi ultimately applied to M-qPCR reaction were all 100 nM and 200 nM, respectively.

Specificity of M-qPCR assay

The specificity of M-qPCR was testified in the above optimal reaction system with DNA templates as the same as S-qPCR. As shown in Fig. 3, the targeted genes of four fungi were amplified simultaneously and separately with a slight variation in CT values in comparison to the amplifications in S-qPCR, whereas the 13 non-target strains and A549 did not yield any amplification (Table S4). The specificity and sensitivity of each fungus in M-qPCR were similar to those observed in S-qPCR reactions.

Fig 3 Specificity analysis of M-qPCR assay. Positive control from four plasmids targeted to A. fumigatus (blue), Mucorales (green), H. capsulatum (red), and Fusarium spp. (purple) and genomic DNA from 13 non-target strains and type II human alveolar epithelial cell A549 were used as templates for M-qPCR assay.

Standard curves of M-qPCR assay

To estimate the efficiency of M-qPCR, a standard curve was constructed based on the serial dilutions of mixed plasmid DNA to estimate the multiplex qPCR efficiency for each target. As shown in Fig. 4, all target species were detected at the minimum plasmid DNA concentration of 1 × 102 copies/μL with similar CT values to those observed in S-qPCR. The standard curves of four fungi showed good linearity; the efficiency of A. fumigatus was 93.50 (R2 = 0.999), 92.29 for Mucorales (R2 = 0.999), 97.69 for H. capsulatum (R2 = 0.998), and 96.85 for Fusarium spp. (R2 = 0.999), respectively.

Fig 4 Sensitivity analysis and standard curves of M-qPCR. Concomitant amplification (A) and standard curves (104–108 copies/μL) (B) of four DNA targets by M-qPCR were illustrated and differentiated by A. fumigatus (blue), Mucorales (green), H. capsulatum (red), and Fusarium spp. (purple). All data points are from an average of three technical replicates.

Reproducibility of M-qPCR assay

The reproducibility of the M-qPCR assay was evaluated by intra-assay and inter-assay with the 10-fold serial dilutions of the mixed plasmid DNA (1 × 1010 copies/µL ~ 1 × 101 copies/µL). For intra-assay, the plasmids with different dilutions were amplified three times simultaneously. For inter-assay, they were performed at three separate times with standards from different batches. As shown in Table 3, the standard deviation (SD) and coefficients of variation (CV) of CT values were from 0.02 to 0.53 and from 0.036% to 1.67% in intra-group, whereas they were from 0.08 to 1.62 and from 0.35% to 8.21% in inter-group, respectively. This indicated that the newly developed M-qPCR assay had good intra- and inter-reproducibility at the concentration from 1 × 102 copies/µL to 1 × 1010 copies/µL.

TABLE 3 Analysis of the reproducibility of M-qPCR

Species	Copies/μL	Intra-assay	Inter-assay	
CT (mean ± SD)	CV%	CT (mean ± SD)	CV%	
A. fumigatus	1 × 101	NDb	ND	ND	ND	
	1 × 102	36.66a	ND	36.95 ± 0.29	0.78	
	1 × 103	35.63 ± 0.53	1.49	36.04 ± 0.59	1.63	
	1 × 104	34.24 ± 0.49	1.43	34.03 ± 0.49	1.5	
	1 × 105	30.49 ± 0.09	0.3	30.57 ± 0.20	0.65	
	1 × 106	27.33 ± 0.29	1.06	27.29 ± 0.25	0.92	
	1 × 107	23.85 ± 0.08	0.34	23.97 ± 0.15	0.63	
	1 × 108	20.1 ± 0.05	0.25	19.63 ± 1.4	7.13	
	1 × 109	16.72 ± 0.28	1.67	16.73 ± 0.2	1.2	
	1 × 1010	13.19 ± 0.05	0.38	13.24 ± 0.09	0.68	
Mucorales	1 × 101	ND	ND	ND	ND	
	1 × 102	37.01 ± 0.23	0.62	36.06 ± 0.88	2.44	
	1 × 103	35.4 ± 0.46	1.3	34.68 ± 0.0.82	2.36	
	1 × 104	34.2 ± 0.29	0.85	33.39 ± 0.68	2.04	
	1 × 105	31.01 ± 0.17	0.55	30.31 ± 0.56	1.85	
	1 × 106	27.7 ± 0.28	1.01	26.98 ± 0.62	2.3	
	1 × 107	24.12 ± 0.03	0.12	23.51 ± 0.5	2.13	
	1 × 108	20.91 ± 0.04	0.19	19.73 ± 1.62	8.21	
	1 × 109	17.57 ± 0.24	1.37	16.92 ± 0.54	3.19	
	1 × 1010	13 ± 0.04	0.31	13.18 ± 0.2	1.52	
H. capsulatum	1 × 101	ND	ND	ND	ND	
	1 × 102	35.67 ± 0.13	0.036	35.38 ± 0.55	1.55	
	1 × 103	34.09 ± 0.07	0.21	33.66 ± 0.33	0.98	
	1 × 104	33.08 ± 0.41	1.24	33.38 ± 0.49	1.47	
	1 × 105	30.14 ± 0.19	0.63	30.11 ± 0.16	0.53	
	1 × 106	27.06 ± 0.21	0.78	26.86 ± 0.23	0.86	
	1 × 107	22.97 ± 0.06	0.26	22.86 ± 0.08	0.35	
	1 × 108	20.07 ± 0.06	0.3	19.98 ± 0.17	0.85	
	1 × 109	16.74 ± 0.27	1.61	16.57 ± 0.21	1.27	
	1 × 1010	13.36 ± 0.04	0.3	13.24 ± 0.11	0.83	
Fusarium spp.	1 × 101	ND	ND	ND	ND	
	1 × 102	36.98 ± 0.36	0.97	37.14 ± 0.69	1.86	
	1 × 103	35 ± 0.41	1.17	35.33 ± 0.52	1.47	
	1 × 104	34.34 ± 0.13	0.38	34.25 ± 0.22	0.64	
	1 × 105	31.12 ± 0.17	0.55	31.04 ± 0.14	0.45	
	1 × 106	27.85 ± 0.2	0.72	27.68 ± 0.28	1.01	
	1 × 107	24.19 ± 0.05	0.21	24.16 ± 0.13	0.54	
	1 × 108	20.99 ± 0.04	0.19	20.79 ± 0.18	0.87	
	1 × 109	17.56 ± 0.25	1.42	17.4 ± 0.21	1.21	
	1 × 1010	13.83 ± 0.02	0.14	13.77 ± 0.13	0.94	
a There was only one positive result among three assays.

b ND, not detected.

Detection of targets in unequal quadruple mixtures

To evaluate the performance of M-qPCR in detecting the mixed infections, plasmids encoding the targeted gene of four fungi were mixed to produce an unequal mixture of four targets at low, middle, and high concentrations (104, 106, and 108 copies/µL); the specific combinations are shown in Table 4. As shown in Fig. 5, the CT value for each target in these mixed templates was similar to the CT value for that target alone, and all values were tightly clustered, with standard deviations within the range of 0.30–0.91 (A. fumigatus), 0.18–0.44 (Mucorales), 0.16–0.44 (H. capsulatum), and 0.52–0.91 (Fusarium spp.). Therefore, all components within a quadruple mixture, including the minority component, could be accurately quantified despite the presence of other components at different concentrations.

TABLE 4 Matrix for mixture compositionsa

Mixture	A. fumigatus	Mucorales	H. capsulatum	Fusarium spp.	
1	A	A	A	A	
2	A	B	C	B	
3	A	C	B	C	
4	B	A	C	C	
5	B	B	B	A	
6	B	C	A	B	
7	C	A	B	B	
8	C	B	A	C	
9	C	C	C	A	
a Orthogonal test table: A = 108 gene copies/μL, B = 106 gene copies/μL, C = 104 gene copies/μL.

Fig 5 The distribution of CT values of mixed concentration detection and single concentration detection CT value. A. fumigatus (A), Mucorales (B), H. capsulatum (C), and Fusarium spp. (D).

Validation with simulated clinical samples

The simulated clinical samples comprised a 10-fold dilution series ranging from 1 × 106 to 1 × 101 conidia/sporangiospores of A. fumigatus, M. circinelloides, M. racemosus, R. oryzae, R. microspores, F. fujikuroi, F. solani, and F. oxysporum, ranging from 2 mg to 20 ng mycelium powder of H. capsulatum, mixed with 200 µL of serum or sputum. In terms of the simulated serum samples, the LoDs of M-qPCR were determined to be 10 CFU conidia/reaction for A. fumigatus, M. racemosus, R. microspores, F. fujikuroi, F. solani, and F. oxysporum; 102 CFU conidia/reaction for M. circinelloides and R. oryzae; and 200 ng mycelium powder/reaction for H. capsulatum. In terms of the Sputum samples, the LoDs of M-qPCR were determined to be 101 CFU conidia/reaction for A. fumigatus, R. microsporus, and Fusarium spp.; 102 CFU conidia/reaction for M. circinelloides, M. racemosus, and R. oryzae; and 200 ng mycelium powder/reaction for H. capsulatum (Table 5).

TABLE 5 LoD (CFU) of simulated clinical samples tested by M-qPCR

Species	Saline	Serum	Sputum	
LoD	CT value	LoD	CT value	LoD	CT value	
A. fumigatus	101	35.93 ± 0.47	101	37.03 ± 0.84	101	37.6 ± 0.58	
M. circinelloides	102	35.36 ± 0.81	102	36.07 ± 0.73	102	36.32 ± 0.59	
M. racemosus	101	37.34 ± 0.5	101	37.1 ± 0.19	102	35.04 ± 0.03	
R. oryzae	102	35.33 ± 0.46	102	36.01 ± 0.45	102	35.58 ± 0.39	
R. microsporus	101	36.98 ± 0.29	101	36.07 ± 0.33	101	37.1 ± 0.49	
F. fujikuroi	101	34.37 ± 0.28	101	34.31 ± 1.17	101	34.81 ± 0.02	
F. solani	101	35.34 ± 0.86	101	35.48 ± 0.46	101	35.7 ± 0.76	
F. oxysporum	101	35.66 ± 0.14	101	35.65 ± 0.1	101	35.26 ± 0.83	
H. capsulatum a	20	37.72 ± 0.9	200	35.57 ± 0.42	200	33.94 ± 0.16	
a The unit of this group is ng.

DISCUSSION

In the present study, a TaqMan probe-based multiplex real-time qPCR assay was developed to quantify simultaneously and specifically the DNA from A. fumigatus, Fusarium spp., Mucorales, and H. capsulatum. It has been reported that Aspergillus spp., particularly A. fumigatus, are the leading cause of invasive fungal infections caused by filamentous fungi around the world, followed by Fusarium spp. and Mucormycetes (23). Additionally, in 2022, WHO announced the fungal priority pathogens list according to the clinical significance of different fungi, which classified the 19 kinds of clinically important pathogenic fungi into three levels, critical, high, and medium priority (7). A. fumigatus, Fusarium spp., and Mucorales were the most important filamentous fungi in the critical and high groups. H. capsulatum is a dimorphic fungus causing invasive fungal infections of the lung and systemic bloodstream infections with high mortality through inhalation of hyphae and microconidia in soil by the host (24–26). Moreover, with the increase in reports of histoplasmosis in China, the detection of H. capsulatum is also becoming more crucial (27). Thus, A. fumigatus, Fusarium spp., Mucorales, and H. capsulatum were selected for a combined and rapid detection with practical significance.

In the assay, four pairs of primer–probe sets can be mixed into one tube system, thus allowing us to detect the target pathogens simultaneously in one reaction. Remarkably, the assay has good specificity and no cross-reactivity with the other 13 pathogens. The minimum detection limit for all target species is about 1 × 102 copies/µL, with a coefficient of variation below 4%, suggesting good sensitivity and reproducibility. In simulated clinical specimens, the LoD of this M-qPCR assay was about 10 CFU conidia/reaction. The primers and probes for each target of four fungi were designed on the base of S-qPCR, respectively.

For A. fumigatus, a number of studies have successfully detected A. fumigatus by targeting the conserved sequence of the membrane-bound protein ANXC4 gene in combination with qPCR or other detection techniques (28, 29). For example, the primer designed for ANXC4 gene in combination with loop-mediated isothermal amplification and lateral flow biosensor (LAMP-LFB) was successfully applied to the detection of A. fumigatus, with a minimum detection concentration of 10 fg (28). In addition, there are studies that have designed primers for the detection of A. fumigatus based on ANXC4 gene, and the diagnostic accuracy was 100% (30). The 18S ribosomal RNA gene (4–6) and 28S rDNA (5, 31) have ever been targeted to detect the Mucorales, which appeared to be less suitable as a marker for the Mucorales (21). In our previous study, rnl gene was selected as a target to successfully detect the Mucorales by qPCR and recombinase polymerase amplification (RPA) (21). Therefore, rnl gene was also chosen for the detection of Mucorales in this M-qPCR assay. Since the EF1α gene has been targeted successfully to detect and quantify Fusarium spp (32, 33), the EF1α gene became the preferred sequence for the identification of Fusarium spp.; in contrast, the internal transcriptional spacer (ITS) of fungal rDNA is not suitable for species differentiation of Fusarium spp., although it is frequently used for fungal diversity studies. The Hcp100 protein is a regulatory protein of H. capsulatum and has been proposed by many mycologists as a novel therapeutic target for histoplasmosis treatment (34, 35). Interestingly it has also been proved to be an excellent target for molecular detection and identification in clinical samples, since a combination of nested PCR and qPCR targeted to Hcp100 gene has been designed to successfully detect H. capsulatum with 100% specificity (36, 37).

In this study, the primer and probe were first designed for the above four target genes and evaluated for specificity and sensitivity by S-qPCR, respectively. Afterward, they were optimized successfully and established for M-qPCR assay. In order to optimize the CT value of M-qPCR close to that of S-qPCR and evaluate the LoD of M-qPCR, the respective concentration of four primers and probes were adjusted using orthogonal experiments in the multiplex detection system. In our optimal system, the LoD for M-qPCR and S-qPCR were the same, both of which were around 102 copies/reaction. However, the CT value of each target gene in the M-qPCR is slightly higher than that of S-qPCR, this may be due to the fact that multiplex PCR is a highly complex reaction that can be interfered with by mixed amplification of many targets (38).

Apparently, the sensitivity of multiplex detection is slightly lower than that of single detection in our study. This was in line with some other studies about the multiplex detection of porcine virus, in which the sensitivity of S-qPCR was as less as 10 copies in contrast to approximately 100 copies in M-qPCR. This difference was probably attributed to the competition between primers, probes, templates, and reagents in M-qPCR system (39). Moreover, different annealing temperatures of 56°C, 58°C, and 60°C were also experimented, and no significant difference was found in the detection sensitivity. However, since the specificity of M-qPCR assay could be improved by a higher annealing temperature (40), the annealing temperature was still set to 60°C in the M-qPCR assay. At the same time, the LoD value of the control group within normal saline was generally lower than that within the simulated serum or sputum; this might be due to the complex composition of sputum and serum, as well as the effect of the DNA extraction process. This result was in line with the findings in the study of a rapid detection of Mucorales by Xu et al. (21).

It is worth mentioning that unlike mammalian cells and viruses, the fungal cells are covered by a cell wall that is rich in polysaccharides and chitin, which makes the DNA of fungi difficult, and only a small amount of DNA of fungi can be obtained by normal extraction of clinical samples (41, 42). In our newly established M-qPCR system, only 1 µL of template of fungal DNA was used, which was lower than the 2 µL and 5 µL used in other studies (43, 44), and the LoD in the simulated samples was about 10 CFU/reaction. This result indicated that the M-qPCR assay possessed a higher sensitivity with less prerequisite of the amount of DNA template and the volume of clinical samples such as blood and sputum. In addition, M-qPCR can detect multiple fungal pathogens at a single time point in less than 2 hours. It was time-efficient and cost-effective; however, this M-qPCR assay needs further validation with real clinical blood, bronchoalveolar lavage fluid (BALF), or sputum samples, and the utilization of M-qPCR assay for diagnosis of fungal infection needs more advocation in clinic.

In a word, this study successfully established a TaqMan probe-based multiplex real-time qPCR assay for four clinically important filamentous fungi, A. fumigatus, Fusarium spp., Mucorales, and H. capsulatum with high sensitivity and specificity, which brings a promising potential for prompt and precise diagnosis against fungal infection.

ACKNOWLEDGMENTS

The authors express their gratitude to the Special Key Project of Biosafety Technologies for the National Major Research & Development Program of China and the National Natural Science Foundation of China for their generous support.

The author(s) declare financial support was received for the research, authorship, and/or publication of this article. This work was supported by the Special Key Project of Biosafety Technologies (2022YFC2604000) for the National Major Research & Development Program of China, the National Natural Science Foundation of China under Grant (nos. 82372273, 82172293). The funders had no role in study design, data collection and analysis, decision to publish or preparation of manuscript.

SUPPLEMENTAL MATERIAL

The following material is available online at https://doi.org/10.1128/spectrum.00634-24.

10.1128/spectrum.00634-24.SuF1 Supplemental tables spectrum.00634-24-s0001.docx

Tables S1-S4.

ASM does not own the copyrights to Supplemental Material that may be linked to, or accessed through, an article. The authors have granted ASM a non-exclusive, world-wide license to publish the Supplemental Material files. Please contact the corresponding author directly for reuse.
==== Refs
REFERENCES

1 Powers-Fletcher MV, Kendall BA, Griffin AT, Hanson KE. 2016. Filamentous fungi. Microbiol Spectr 4 . doi:10.1128/microbiolspec.DMIH2-0002-2015
2 Köhler JR, Hube B, Puccia R, Casadevall A, Perfect JR. 2017. Fungi that infect humans. Microbiol Spectr 5 . doi:10.1128/microbiolspec.FUNK-0014-2016
3 Heung LJ, Wiesner DL, Wang K, Rivera A, Hohl TM. 2023. Immunity to fungi in the lung. Semin Immunol 66 :101728. doi:10.1016/j.smim.2023.101728 36841146
4 Rickerts V, Mousset S, Lambrecht E, Tintelnot K, Schwerdtfeger R, Presterl E, Jacobi V, Just-Nübling G, Bialek R. 2007. Comparison of histopathological analysis, culture, and polymerase chain reaction assays to detect invasive mold infections from biopsy specimens. Clin Infect Dis 44 :1078–1083. doi:10.1086/512812 17366453
5 Springer J, Goldenberger D, Schmidt F, Weisser M, Wehrle-Wieland E, Einsele H, Frei R, Löffler J. 2016. Development and application of two independent real-time PCR assays to detect clinically relevant Mucorales species. J Med Microbiol 65 :227–234. doi:10.1099/jmm.0.000218 26743820
6 Springer J, Lackner M, Ensinger C, Risslegger B, Morton CO, Nachbaur D, Lass-Flörl C, Einsele H, Heinz WJ, Loeffler J. 2016. Clinical evaluation of a Mucorales-specific real-time PCR assay in tissue and serum samples. J Med Microbiol 65 :1414–1421. doi:10.1099/jmm.0.000375 27902424
7 Fisher MC, Denning DW. 2023. The WHO fungal priority pathogens list as a game-changer. Nat Rev Microbiol 21 :211–212. doi:10.1038/s41579-023-00861-x 36747091
8 Lionakis MS, Drummond RA, Hohl TM. 2023. Immune responses to human fungal pathogens and therapeutic prospects. Nat Rev Immunol 23 :433–452. doi:10.1038/s41577-022-00826-w 36600071
9 Cadena J, Thompson III GR, Patterson TF. 2021. Aspergillosis: epidemiology, diagnosis, and treatment. Infect Dis Clin North Am 35 :415–434. doi:10.1016/j.idc.2021.03.008 34016284
10 Cornely OA, Alastruey-Izquierdo A, Arenz D, Chen SCA, Dannaoui E, Hochhegger B, Hoenigl M, Jensen HE, Lagrou K, Lewis RE, et al. . 2019. Global guideline for the diagnosis and management of mucormycosis: an initiative of the European confederation of medical mycology in cooperation with the mycoses study group education and research consortium. Lancet Infect Dis 19 :e405–e421. doi:10.1016/S1473-3099(19)30312-3 31699664
11 Hoenigl M, Jenks JD, Egger M, Nucci M, Thompson III GR. 2023. Treatment of fusarium infection of the central nervous system: a review of past cases to guide therapy for the ongoing 2023 outbreak in the United States and Mexico. Mycopathologia 188 :973–981. doi:10.1007/s11046-023-00790-6 37653167
12 Hayashida MZ, Seque CA, Enokihara M, Porro AM. 2018. Disseminated fusariosis with cutaneous involvement in hematologic malignancies: report of six cases with high mortality rate. An Bras Dermatol 93 :726–729. doi:10.1590/abd1806-4841.20187476 30156626
13 Sil A. 2019. Molecular regulation of Histoplasma dimorphism. Curr Opin Microbiol 52 :151–157. doi:10.1016/j.mib.2019.10.011 31739263
14 Tobón AM, Gómez BL. 2021. Pulmonary histoplasmosis. Mycopathologia 186 :697–705. doi:10.1007/s11046-021-00588-4 34498137
15 Toscanini MA, Nusblat AD, Cuestas ML. 2021. Diagnosis of histoplasmosis: current status and perspectives. Appl Microbiol Biotechnol 105 :1837–1859. doi:10.1007/s00253-021-11170-9 33587157
16 Koltsida G, Zaoutis T. 2021. Fungal lung disease. Paediatr Respir Rev 37 :99–104. doi:10.1016/j.prrv.2020.04.009 32527608
17 Alanio A, Gits-Muselli M, Lanternier F, Sturny-Leclère A, Benazra M, Hamane S, Rodrigues AM, Garcia-Hermoso D, Lortholary O, Dromer F, Bretagne S, French Mycoses Study Group. 2021. Evaluation of a new Histoplasma spp. quantitative RT-PCR assay. J Mol Diagn 23 :698–709. doi:10.1016/j.jmoldx.2021.02.007 33706012
18 Salehi E, Hedayati MT, Zoll J, Rafati H, Ghasemi M, Doroudinia A, Abastabar M, Tolooe A, Snelders E, van der Lee HA, Rijs A, Verweij PE, Seyedmousavi S, Melchers WJG. 2016. Discrimination of aspergillosis, mucormycosis, fusariosis, and scedosporiosis in formalin-fixed paraffin-embedded tissue specimens by use of multiple real-time quantitative PCR assays. J Clin Microbiol 54 :2798–2803. doi:10.1128/JCM.01185-16 27605714
19 Della Terra PP, Gonsales FF, de Carvalho JA, Hagen F, Kano R, Bonifaz A, Camargo Z de, Rodrigues AM. 2022. Development and evaluation of a multiplex qPCR assay for rapid diagnostics of emerging sporotrichosis. Transbound Emerg Dis 69 :e704–e716. doi:10.1111/tbed.14350 34687495
20 Gago S, Esteban C, Valero C, Zaragoza O, Puig de la Bellacasa J, Buitrago MJ. 2014. A multiplex real-time PCR assay for identification of Pneumocystis jirovecii, Histoplasma capsulatum, and Cryptococcus neoformans/Cryptococcus gattii in samples from AIDS patients with opportunistic pneumonia. J Clin Microbiol 52 :1168–1176. doi:10.1128/JCM.02895-13 24478409
21 Xu R, Li D, Zhao J, Zhong H, Chen H, Jia Y, Chen F, Han L. 2023. Rapid detection of Mucorales based on recombinase polymerase amplification and real-time PCR. Front Microbiol 14 :1273073. doi:10.3389/fmicb.2023.1273073 37954252
22 Huang YL, Pang VF, Pan CH, Chen TH, Jong MH, Huang TS, Jeng CR. 2009. Development of a reverse transcription multiplex real-time PCR for the detection and genotyping of classical swine fever virus. J Virol Methods 160 :111–118. doi:10.1016/j.jviromet.2009.04.029 19414034
23 Kojabad AA, Farzanehpour M, Galeh HEG, Dorostkar R, Jafarpour A, Bolandian M, Nodooshan MM. 2021. Droplet digital PCR of viral ‎DNA/RNA, current progress, challenges, and future perspectives. J Med Virol 93 :4182–4197. doi:10.1002/jmv.26846 33538349
24 Valdez AF, Miranda DZ, Guimarães AJ, Nimrichter L, Nosanchuk JD. 2022. Pathogenicity & virulence of Histoplasma capsulatum - a multifaceted organism adapted to intracellular environments. Virulence 13 :1900–1919. doi:10.1080/21505594.2022.2137987 36266777
25 Wheat LJ, Azar MM, Bahr NC, Spec A, Relich RF, Hage C. 2016. Histoplasmosis. Infect Dis Clin North Am 30 :207–227. doi:10.1016/j.idc.2015.10.009 26897068
26 Limper AH, Adenis A, Le T, Harrison TS. 2017. Fungal infections in HIV/AIDS. Lancet Infect Dis 17 :e334–e343. doi:10.1016/S1473-3099(17)30303-1 28774701
27 Wassen MH, Lammens J, Tekoppele JM, Sakkers RJ, Liu Z, Verbout AJ, Bank RA. 2000. Collagen structure regulates fibril mineralization in osteogenesis as revealed by cross-link patterns in calcifying callus. J Bone Miner Res 15 :1776–1785. doi:10.1359/jbmr.2000.15.9.1776 10976997
28 Jiang L, Li X, Gu R, Mu D. 2021. Rapid detection of Aspergillus fumigatus using multiple cross displacement amplification combined with nanoparticles-based lateral flow. Front Cell Infect Microbiol 11 :622402. doi:10.3389/fcimb.2021.622402 33928041
29 Khalaj V, Smith L, Brookman J, Tuckwell D. 2004. Identification of a novel class of annexin genes. FEBS Lett 562 :79–86. doi:10.1016/S0014-5793(04)00186-3 15044005
30 Jiang L, Gu R, Li X, Mu D. 2021. Simple and rapid detection Aspergillus fumigatus by loop-mediated isothermal amplification coupled with lateral flow biosensor assay. J Appl Microbiol 131 :2351–2360. doi:10.1111/jam.15092 33788361
31 Bergallo M, Tullio V, Roana J, Allizond V, Mandras N, Daprà V, Dini M, Comini S, Cavallo L, Gambarino S, Cuffini AM, Banche G. 2022. A rapid and specific real-time PCR assay for the detection of clinically relevant Mucorales species. Int J Mol Sci 23 :15066. doi:10.3390/ijms232315066 36499395
32 Sohlberg E, Virkajärvi V, Parikka P, Rämö S, Laitila A, Sarlin T. 2022. Taqman qPCR quantification and fusarium community analysis to evaluate toxigenic fungi in cereals. Toxins (Basel) 14 :45. doi:10.3390/toxins14010045 35051022
33 Boutigny AL, Gautier A, Basler R, Dauthieux F, Leite S, Valade R, Aguayo J, Ioos R, Laval V. 2019. Metabarcoding targeting the EF1 alpha region to assess Fusarium diversity on cereals. PLoS One 14 :e0207988. doi:10.1371/journal.pone.0207988 30633747
34 Toscanini MA, Maglio DG, Capece P, Posse G, Iovannitti CA, Nusblat AD, Cuestas ML. 2020. Histoplasma capsulatum 100-kilodalton antigen: recombinant production, characterization, and evaluation of its possible application in the diagnosis of histoplasmosis. Appl Microbiol Biotechnol 104 :5861–5872. doi:10.1007/s00253-020-10570-7 32377899
35 González-González AE, Taylor ML, Curiel-Quesada E. 2012. [Relevant aspects of the Hcp100 molecular marker of Histoplasma capsulatum and its potential therapeutic use in histoplasmosis]. Rev Iberoam Micol 29 :115–119. doi:10.1016/j.riam.2011.09.001 22037114
36 Moreira LM, Meyer W, Chame M, Brandão ML, Vivoni AM, Portugal J, Wanke B, Trilles L. 2022. Molecular detection of Histoplasma capsulatum in Antarctica. Emerg Infect Dis 28 :2100–2104. doi:10.3201/eid2810.220046 36148943
37 Gómez LF, Gade L, Litvintseva AP, McEwen JG, Peláez CA, Arango M, Jiménez MDP. 2022. Comparison between two molecular techniques: nested and real-time polymerase chain reaction targeting 100-kDa HC protein for detection of Histoplasma capsulatum in environmental samples. Am J Trop Med Hyg 106 :1329–1332. doi:10.4269/ajtmh.20-1396 35292592
38 Kim MY, Jung S, Kim J, Lee HJ, Jeong S, Sim SJ, Kim SK. 2021. Highly sensitive and multiplexed one-step RT-qPCR for profiling genes involved in the circadian rhythm using microparticles. Sci Rep 11 :6463. doi:10.1038/s41598-021-85728-y 33742035
39 Huang X, Chen J, Yao G, Guo Q, Wang J, Liu G. 2019. A TaqMan-probe-based multiplex real-time RT-qPCR for simultaneous detection of porcine enteric coronaviruses. Appl Microbiol Biotechnol 103 :4943–4952. doi:10.1007/s00253-019-09835-7 31025076
40 Markoulatos P, Siafakas N, Moncany M. 2002. Multiplex polymerase chain reaction: a practical approach. J Clin Lab Anal 16 :47–51. doi:10.1002/jcla.2058 11835531
41 Gow NAR, Lenardon MD. 2023. Architecture of the dynamic fungal cell wall. Nat Rev Microbiol 21 :248–259. doi:10.1038/s41579-022-00796-9 36266346
42 Hopke A, Brown AJP, Hall RA, Wheeler RT. 2018. Dynamic fungal cell wall architecture in stress adaptation and immune evasion. Trends Microbiol 26 :284–295. doi:10.1016/j.tim.2018.01.007 29452950
43 Eckford-Soper LK, Daugbjerg N. 2015. Development of a multiplex real-time qPCR assay for simultaneous enumeration of up to four marine toxic bloom-forming microalgal species. Harmful Algae 48 :37–43. doi:10.1016/j.hal.2015.06.009 29724474
44 Leach L, Zhu Y, Chaturvedi S. 2018. Development and validation of a real-time PCR assay for rapid detection of Candida auris from surveillance samples. J Clin Microbiol 56 :e01223-17. doi:10.1128/JCM.01223-17 29187562
