
==== Front
BMC Vet Res
BMC Vet Res
BMC Veterinary Research
1746-6148
BioMed Central London

4233
10.1186/s12917-024-04233-2
Research
Terminalia bellirica and Andrographis paniculata dietary supplementation in mitigating heat stress-induced behavioral, metabolic and genetic alterations in broiler chickens
Fayed Rabie H. 1
Ali Sara E. 2
http://orcid.org/0000-0002-5613-5743
Yassin Aya M. ayamohye@cu.edu.eg

3
Madian K. 4
Bawish Basma M. 1
1 https://ror.org/03q21mh05 grid.7776.1 0000 0004 0639 9286 Department of Veterinary Hygiene and Management, Faculty of Veterinary Medicine, Cairo University, Giza, 12211 Egypt
2 https://ror.org/03q21mh05 grid.7776.1 0000 0004 0639 9286 Department of Physiology, Faculty of Veterinary Medicine, Cairo University, Giza, 12211 Egypt
3 https://ror.org/03q21mh05 grid.7776.1 0000 0004 0639 9286 Department of Biochemistry and Molecular Biology, Faculty of Veterinary Medicine, Cairo University, Giza, 12211 Egypt
4 https://ror.org/03q21mh05 grid.7776.1 0000 0004 0639 9286 Department of Poultry Diseases, Faculty of Veterinary Medicine, Cairo University, Giza, 12211 Egypt
3 9 2024
3 9 2024
2024
20 38824 5 2024
12 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Background

Heat stress (HS) is one of the most significant environmental stressors on poultry production and welfare worldwide. Identification of innovative and effective solutions is necessary. This study evaluated the effects of phytogenic feed additives (PHY) containing Terminalia bellirica and Andrographis paniculata on behavioral patterns, hematological and biochemical parameters, Oxidative stress biomarkers, and HSP70, I-FABP2, IL10, TLR4, and mTOR genes expression in different organs of broiler chickens under chronic HS conditions. A total of 208 one-day-old Avian-480 broiler chicks were randomly allocated into four treatments (4 replicate/treatment, 52 birds/treatment): Thermoneutral control treatment (TN, fed basal diet); Thermoneutral treatment (TN, fed basal diet + 1 kg/ton feed PHY); Heat stress treatment (HS, fed basal diet); Heat stress treatment (HS, fed basal diet + 1 kg/ton feed PHY).

Results

The findings of the study indicate that HS led to a decrease in feeding, foraging, walking, and comfort behavior while increasing drinking and resting behavior, also HS increased red, and white blood cells (RBCs and WBCs) counts, and the heterophile/ lymphocyte (H/L) ratio (P < 0.05); while both mean corpuscular volume (MCV), and mean corpuscular hemoglobin (MCH) were decreased (P < 0.05). In addition, HS negatively impacted lipid, protein, and glucose levels, liver and kidney function tests, and oxidative biomarkers by increasing malondialdehyde (MDA) levels and decreasing reduced glutathion (GSH) activity (P < 0.05). Heat stress (HS) caused the upregulation in HSP70, duodenal TLR4 gene expression, and the downregulation of I-FABP2, IL10, mTOR in all investigated tissues, and hepatic TLR4 (P < 0.05) compared with the TN treatment. Phytogenic feed additives (PHY) effectively mitigated heat stress’s negative impacts on broilers via an improvement of broilers’ behavior, hematological, biochemical, and oxidative stress biomarkers with a marked decrease in HSP70 expression levels while all tissues showed increased I-FABP2, IL10, TLR4, and mTOR (except liver) levels (P < 0.05).

Conclusion

Phytogenic feed additives (PHY) containing Terminalia bellirica and Andrographis paniculata have ameliorated the HS-induced oxidative stress and improved the immunity as well as the gut health and welfare of broiler chickens.

Keywords

Andrographis paniculata
HSP70
Oxidative stress
Terminalia bellirica
Welfare
Cairo UniversityOpen access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Heat stress (HS) is one of the most significant environmental stressors in livestock and poultry production around the world [1], resulting in a significant economic loss that is expected to surge in the next years as global temperatures [2, 3]. The HS occurs when an animal’s body generates more heat than it dissipates to its immediate environment [4]. Broilers are sensitive to HS conditions for many reasons such as the fast growth rate, high metabolic rate, and lack of sweat glands in their skin [5, 6]. The HS poses a significant threat to the poultry industry, and this concern will intensify as climate change continues to elevate environmental temperatures [2, 3]. Under HS circumstances, the physiological blood parameters of broilers are changed, resulting in changes in behavioral patterns and impairing their welfare [6, 7]. The detrimental effects of HS on avian physiology and behavior are mainly mediated by the development of oxidative stress and redox imbalance [8, 9]. Previous studies have shown that long-term HS can disrupt the body’s redox balance, resulting in the formation of reactive oxygen species (ROS), and oxidative damage that harms metabolism in chickens [10, 11]. Elevated ambient temperature causes oxidative stress in broiler liver tissues, exacerbating the disruption of lipid metabolism [12]. Free radicals rise in broilers under HS, while antioxidant enzyme activity and the capacity to scavenge free radicals fall [13]. Additionally, Ghanima et al. [11]; Ma et al. [14] showed that exposure to HS suppresses the innate immune response and induces immune disorders via altering the organs’ immune functions.

In an adaptive response to HS in poultry, the sympathetic adreno-medullary (SAM) pathway is activated. This leads to the release of catecholamines from the adrenal medulla, including epinephrine and norepinephrine. Additionally, the hypothalamic-pituitary-adrenal (HPA) axis is activated, which causes the adrenal cortex to secrete glucocorticoids (GC), such as cortisol and corticosterone [15–18]. The high corticosterone levels can in turn weaken the intestinal barrier. In chickens exposed to HS, damage to the intestinal barrier can cause intestinal inflammation. This has been shown to reduce the life span of intestinal cells, cause crypt hyperplasia and villous atrophy in ducks [19], and raise the concentration of plasma endotoxins in chickens [20].

The body’s HS response is exacerbated when the balance of pro- and anti-inflammatory factors is disrupted in the digestive tract or throughout the body [21]. Defense mechanisms that shield cells from heat-induced stress include the expression of early stress response genes that code for heat shock protein (HSP); genes related to the immune system, such as cytokines and toll-like receptors (TLRs); and antioxidant enzymes, such as superoxide dismutase (SOD) and catalase (CAT) [22].

Mitigation strategies are crucial for alleviating the deleterious effects of environmental stressors and climate change on broiler behavioral response, immune functions, and antioxidant capacity, particularly under HS conditions. Several mitigating techniques have previously been employed, including feed additives such as trace elements [3, 23] vitamins [24, 25], probiotics [26], and herbal products [27, 28]. It has been demonstrated that using herbs and their extracts in poultry diets is typically useful in preserving their health, behavior, and welfare, as well as oxidative stability and metabolism [29]. Terminalia bellirica (Gaertn.) Roxb. (Family Combretaceae), commonly known as ‘Belleric myrobalan,’ is a huge deciduous tree native to the Indian subcontinent, Nepal, Sri Lanka, and Southeast Asia [30]. T. bellirica is linked to the diverse pharmacological effects exhibited by its various bioactive secondary metabolites, which include alkaloids, flavones, lignans, tannins, phenols, terpenoids, glycosides, and saponins [31]. Modern studies suggest that the various chemicals in T. bellirica may be responsible for its acclaimed health benefits, such as antipyretic, antioxidant, anti-inflammatory, and immunomodulatory Activity [32, 33]. T. bellirica components were proven to boost macrophage activities and immune response in terms of free radical scavenging and reactive oxygen species neutralization [34].

Andrographis paniculata is a widely grown herb in East and Southeast Asia that belongs to the Acanthaceae family [35]. It has been identified as the “King of Bitter” because of its capacity to thrive in diverse soil types and shady situations [36]. A. paniculata Secondary metabolites including terpenoids, saponins, phenols, alkaloids, glycoside, and flavonoids have several pharmacological activities [37]. A. paniculata has anti-inflammatory, antibacterial, antipyretic, and immunostimulant activities [38]. It has been proven that A. paniculata considerably increases the antioxidant, and immunological function in broiler chicken [39, 40]. Gao et al., (2022) [41] reported that the polyherbal supplement including A. paniculata increased blood IgG levels in broiler chicks, suggesting that it protects the immune system and reduces inflammatory cytokine production.

The possible interactions between the various combinations of T. bellirica and A. paniculata have not been thoroughly investigated in broiler chickens subjected to HS environment. Therefore, this experiment aims to determine the effect of the dietary use of T. bellirica and A. paniculata combination on the behavioral patterns, haematological, biochemical, Oxidative stress biomarkers, and HSP70, mTOR, TLR4, IL10, and I-FABP2 genes expression in broiler chickens under chronic HS conditions.

Materials and methods

Ethical approval

The husbandry and the following procedures were approved by the Institutional Animal Care and Use Committee (IACUC), Faculty of Veterinary Medicine, Cairo University, Egypt ((Ethical reference No: Vet CU 09092023779) and in accordance to ARRIVE guidelines.

Experimental design

Housing and diets

A total of 208 one-day-old Avian-480 broiler chicks were obtained from a commercial hatchery, which were individually weighed and placed in 16-floor pens (1 × 1.3 m2, 13 chicks/pen). The pens were located in 2 environmentally controlled rooms (8 pens each, 104 birds/room) at the Poultry Research Unit, Department of Veterinary Hygiene and Management, Faculty of Veterinary Medicine, Cairo University, Egypt. Each pen is covered with 8 cm fresh wood shaving and equipped with separate feeders and drinkers.

The experiment was conducted in a complete randomized design with two experimental diets within each room for 35 days: A three-phase corn-soybean-based diet formulated to fulfill Avian-480 broilers’ nutritional needs [42] (Table 1), and a diet fortified with the (1 kg/ton feed) Phytogenic feed additive (PHY) “Herb-ALL™ COOL” preparation, (Life Circle Nutrition AG, Häm¬merli 2d, 8855, Wangen SZ, Switzerland), according to the manufacturer’s recommendation. The “Herb-ALL™ COOL” was added to the diet during the three growing phases: starter (d0–14), grower (d15–28), and finisher (d29–35) as recommended by the manufacturer. The birds were fed a mash diet for one to thirty-five days to ensure adequate mixing. Terminalia bellirica and Andrographis paniculata are two of the pre-standardized, tested herbs in the polyherbal preparation “Herb-ALL™ COOL”. The herbal composition (as provided by the manufacturer) is as follows: polyphenols: 3.32 g GAE /100 g (GAE: gallic acid equivalents), 25.7% (%W/W) water-soluble extract value, 13.5% crude fiber, 6.5% crude protein, 2.5% crude fat, 8.5% crude ash, 0.02% sodium, 0.2% lysine, and 0.1% methionine, 8.9% humidity. Feed and water were available ad libitum.

Table 1 Ingredients and nutrient composition of the basal diets for each growing period

Ingredients%	Starter
(0 to 14 days)	grower
(15 to 28 days)	finisher
(29 to 35 days)	
Yellow corn	57.94	61.67	66.65	
Soybean meal 46%	37.0	33.5	28.5	
Soy oil	1.40	1.50	2.00	
Limestone	1.40	1.40	1.30	
Monocalcium phosphate	0.7	0.55	0.5	
Sodium bicarbonate	0.15	0.15	0.15	
Salt	0.2	0.2	0.2	
DL. Methionine	0.35	0.3	0	
L. Lysine HCl 78.5%	0.31	0.23	0.23	
L- Valine	0.01	0	0	
L. Therionine	0.13	0.1	0.07	
Choline chloride 60%	0.07	0.07	0.07	
Vitamin mineral premix 1	0.21	0.2	0.2	
Mycotoxin binder 2	0.10	0.10	0.10	
Total 3	100	100	100	
Chemical analysis:				
Metabolizable Energy (Kcal/kg)	3100	3150	3240	
Crude Protein (%)	23.00	21.5	19.5	
Crude Fiber	2.3	2.2	2.2	
Crude Fat (%)	4.5	4.7	5.5	
Calcium (%)	1.00	0.95	0.9	
Available phosphorus (%)	0.48	0.435	0.395	
1 Vitamin and mineral mixture contained: 13,000,000 IU vitamin A; 80,000 mg vitamin E; 6,000,000 IU vitamin D3; 4000 mg vitamin K; 5000 mg vitamin B1; 9000 mg vitamin B2; 5000 mg vitamin B6; 35 mg vitamin B12; 20,000 mg pantothenic acid; 2000 mg Folic acid; 70,000 mg Nicotinic acid; 250 mg Biotin; 100,000 mg Zinc oxide; 400,000 mg Manganese oxide; 1000 calcium Iodide; 15,000 mg Copper sulphate; 350 mg Selenium selenite; 50,000 mg ferrous sulphate

2 Mycotoxin binder: Rovi-yeast

3 Phytase (PHYTASE HT8 5 K) = 0.02% and Energy enzyme (Axtra® XB 201) Xylanase and Beta glucanase = 0.01%

Heat-challenged environment and bird allocation

The ambient temperature in room 1 (thermoneutral (TN) treatments) gradually decreased from 33◦C at 1d to 24◦C at 21 d (0.5◦C/d) and maintained for the rest of the experiment. In the 2nd room (heat stressed (HS) treatments, the temperature was maintained at 33 °C in the 1st week and 30 °C in the 2nd week, then the temperature was kept at 32◦C from the 3rd week for 10 h (8 am–6 pm) daily and was reduced to 24 °C each night until the end of the trial [43]. This creates four experimental treatments (4 replicate/treatment, 52 birds/treatment): Thermoneutral control treatment (TN, fed basal diet); Thermoneutral treatment (TN, fed basal diet + 1 kg/ton feed PHY); Heat stress treatment (HS, fed basal diet); Heat stress treatment (HS, fed basal diet + 1 kg/ton feed PHY). The relative humidity (RH) in both rooms ranged between 55 and 60%. The lighting program was 24 h. light for the first three days, then 23 L:1D for the rest of the trial. The vaccination program was Newcastle disease virus (NDV) Hitchner B1 vaccination on the 6th day, NDV-Lasota vaccination and Avian Influenza (H5N1) on the 10th day, and Infectious Bursal Disease (IBD) on the 14th day.

Behavioral observation

The behavioral observation was started from 7 to 35 days old and recorded using a video camera. According to [44], the scanning technique was used to observe bird behavior directly throughout the investigation. All birds in each replicate were observed two days/week, each replicate was observed 10 min daily, and the number of birds performing each behavior pattern was recorded once every 1 min (i.e. each replicate scored 10 times/day). Then the percentage of chicks performing the following behaviors was recorded: feeding, drinking, standing/walking, resting, floor pecking, wing stretching, preening, head-scratching, dust bathing, and wing flapping [45].

Blood sampling

At the end of the trial (day 35 ), The birds were fasted overnight, then slaughtered by severing the jugular vein using a sharp knife, and then the sacrificed birds were de-feathered and eviscerated. Three blood samples were randomly taken from 3 birds/ replicate in each treatment, the first was collected on an EDTA anticoagulant tube for hematological parameters estimation, the second on a heparinized anticoagulant tube for GSH activity and centrifuged at 5000 rpm/20 min for obtaining plasma sample for MDA and TAC determination, the third was on a gel separator tube centrifuged at 5000 rpm/20 min to obtain serum samples for metabolic parameters, liver, and kidney function tests.

Tissue sampling

60 mg of the liver, duodenum, and jejunum specimens were cut, gathered on liquid nitrogen, and kept at -80 °C to extract RNA.

Hematological parameters

The hematocrit (HTC) percentage was estimated using the method described by [46]. Hemoglobin (Hb) concentration was determined using commercial kits (Biodiagnostic Company, Egypt) following the [47] method. Erythrocytes (RBCs) were manually counted using a hemocytometer counting chamber based on the [47] method. Blood indices were calculated following the [46] method. The mean corpuscular volume (MCV) was calculated as (HTC*10)/RBCs count, the mean corpuscular hemoglobin (MCH) as (Hb*10)/RBCs count, and the mean corpuscular hemoglobin concentration (MCHC %) as (Hb/ HTC) * 100. The leukocytes (WBCs) and differential leukocytic counts were estimated following the [48] method. Heterophils and lymphocytes were identified based on their characteristics as described by [49]. The heterophil to lymphocyte (H: L) ratio was then calculated [50].

Metabolic parameters

Serum Metabolic parameters including lipid, protein profiles, and blood glucose levels were measured spectrophotometrically using commercial kits supplied by Spectrum Diagnostics Egyptian Company for Biotechnology; according to the manufacturer’s instructions (UV-2100 Spectrophotometer, USA) [51].

The lipid profile including total cholesterol, total glycerides, and HDL cholesterol concentrations were estimated following the methods described by [52, 53], and [54]; respectively, while LDL and VLDL cholesterol concentrations were calculated according to [55].

VLDL cholesterol concentration = Triglycerides/5.

LDL cholesterol concentration = Total cholesterol – (HDL + VLDL).

Briefly, a series of reactions are involved in the cholesterol assay; cholesterol esters are enzymatically hydrolyzed by cholesterol esterase to produce cholesterol and free fatty acids. The resultant cholesterol, in turn, oxidized by cholesterol oxidase to cholest-4-en-3-one and hydrogen peroxide. Triglycerides assessment requires the action of lipoprotein lipase (LPL) to produce glycerol which is then phosphorylated to glycerol-3-phosphate by glycerol kinase in the presence of ATP. Glycerol-3-phosphate is then oxidized by glycerol phosphate oxidase forming dihydroxy acetone phosphate and hydrogen peroxide. Hydrogen peroxide, either from cholesterol or triglycerides, reacts with phenol and 4 amino antipyrine in the presence of peroxidase forming quinoneimine dye which can be quantified at 546 nm.

For HDL cholesterol quantification, LDL and VLDL in the samples precipitate with phosphotungstate and magnesium ions. after centrifugation at 4000 rpm for 10 min, the cholesterol of HDL fraction remains in the supernatant which can be determined with the same procedures as total cholesterol.

The protein profile -including total protein, and albumin was estimated colorimetrically following the methods described by [56, 57]. On the other hand, globulin was calculated as total protein minus albumin and A/G ratio according to [58]. Briefly, Protein quantification depends on the reaction of copper with peptide bonds of proteins to form a characteristic pink-to-purple biuret complex that can be assessed at 546 nm. The measurement of albumin is based on its binding to bromocresol green (BCG) in pH 4.1, forming a blue-green colored complex measured at 623 nm.

Blood glucose level was estimated according to [54] where glucose is enzymatically oxidized by glucose oxidase to produce hydrogen peroxide which in turn reacts with phenol and 4 aminoantipyrine under the catalysis of peroxidase to produce red violet quinoneimine dye measured at 546 nm.

Liver and kidney function biomarkers

Liver and kidney function parameters were evaluated in serum using commercial kits provided by Spectrum, Egypt. The activities of liver enzymes, alanine aminotransferase (ALT) and aspartate aminotransferase (AST), were assessed based on the method established by [52]. Kidney function tests, including uric acid and creatinine levels, were measured according to the procedures described by [56, 57]; respectively.

Oxidative stress biomarkers

Reduced glutathione (GSH) activity was determined using heparinized whole blood, while the total antioxidant capacity (TAC) and malondialdehyde (MDA) levels were estimated in heparinized plasma following the instructions supplied by the manufacturer of the commercial Kits (Biodiagnostic Company, Egypt) according to [59, 60], and [61]; respectively.

Briefly; the measurement of GSH depends on the reduction of 5,5’ dithiobis (2-nitrobenzoic acid ) (DTNB) with GSH to produce a yellow compound which can be measured at 405 nm and results are expressed as mg/dl. The determination of TAC depends on the elimination of exogenously added hydrogen peroxide by the anti-oxidants in the sample. The residual hydrogen peroxide is determined colorimetrically by an enzymatic reaction which involves the conversion of 3,5 dichloro-2-hydroxy benzenesulfonate to a colored product measured at 505 nm and the results expressed as mM/L. MDA is a degradation product of lipid peroxides and was determined using the thiobarbituric acid (TBA) method. MDA condenses with TBA to form a red product with a maximum absorption peak at 534 nm and data are expressed as nmol/ml.

Quantitative real-time RT-PCR analysis

Total RNA was extracted from the liver, duodenum, and jejunum tissues, measuring its concentration and purity, and reverse transcribed according to [62] using total RNA purification kit (Jena Bioscience, Germany, Cat. #PP-210 S) and Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, USA, Cat. #K1622) with following the manufacturer instruction. The fluorescence-based real-time detection method was employed to estimate each gene’s level of mRNA expression relative to β-actin (ACTB), an endogenous reference gene. The method used iQ SYBR® Green Supermix (Bio-Rad 1708880, USA). The primers listed in Table 2 were used to perform real-time RT-PCR for every gene. The cycling protocol involved an initial denaturation of the sample for three minutes at 95 °C, followed by 40 cycles of denaturation (15 s at 95 °C), annealing (30 s at 60 °C), and extending (30 s at 72 °C). At the end of each reaction, the melting curves were examined to determine the specificity of the PCR products. Every experiment was carried out in three triplicates with a no-template negative control (NTC) present. The expression in comparison to the control was determined by applying the Eq. 2-ΔΔCT [63].

Table 2 Primers sequences used for qRT-PCR analysis

Gene symbol	Amplicon size (bp)	Gene description	Accession number/REF.	Primer Sequence	
1	House keeping gene:	
β-actin (ACTB)	177 bp	Beta-actin	L08165.1	F:- 5′-CCCACACCCCTGTGATGAAA-3′

R:- 5′-TAGAACTTTGGGGGCGTTCG-3′

	
2	Heat stress responsive gene:	
HSP-70	145 bp	Heat shock protein − 70	Calik et al., 2022 [1]	F: 5′-CGTCAGTGCTGTGGACAAGAGTA-3′

R: 5′-CCTATCTCTGTTGGCTTCATCCT-3′

	
3	Gut health biomarker:	
I-FABP-2	77 bp	Intestinal fatty acid binding protein 2	Chen et al., 2015 [140]	F:5-′AAAGATAATGGAAAAGTACTCACAGCAT-3′

R:5′-CCTTCGTACACGTAGGTCTGTATGA-3′

	
4	Immunity related genes:	
IL-10	174 bp	Interleukin-10	NM_001004414.4	F: 5′- TGTACCATTTGTGGCAGTGC − 3′

R: 5′- TCGTCTGGTGTTTGCAGTTG − 3′

	
TLR-4	158 bp	Toll-like receptor 4	NM_001030693.1	F: 5′-ATGTCCTCTTGCCATCCCAA-3′

R: 5′-TCTCCCCTTTCTGCAGAGTG-3′

	
5	Nutrient sensing pathway:	
mTOR	213 bp	Mechanistic Target of Rapamycin	XM_417614.6	F: 5′-CGCAGTGAAGAAACAAGGGC-3′

R: 5′-GGTGGCGTTACCTCCTTCAA-3′

	

Statistical analysis

The Shapiro-Wilk test was used to verify for normality, and the Levene test was used to check for variance homogeneity. The mean and standard error were calculated for each variable. The data were analyzed by analysis of variance (ANOVA) to identify the significantly different treatments at (P < 0.05) by one-way ANOVA using the SPSS software statistical program (SPSS for Windows ver.27, USA). Graph Pad Prism version 6.0 was used to create the graphs.

Results

Behavioral observation

The data presented in Figs. (1–4) demonstrated the effect of PHY feed additives as an anti-heat stressors on the different behavioral patterns percentage in broiler chickens subjected to chronic HS. A significant decrease in the feeding behavior and an increase in the drinking behavior were noticed in the HS treatment compared with the TN (Cont.) treatment (P < 0.05), Moreover, there was a significant decrease in walking and foraging behavior and an increase in the resting behavior in HS treatment versus the TN treatment (P < 0.05). The comfort behavior (preening, wing stretching, head-scratching, dust bathing, and wing flapping was significantly decreased in the HS treatment compared with the TN treatment (P < 0.05) .

The PHY fortification under HS conditions in (HS + PHY) treatment increased the feeding, drinking, foraging, and walking behavior while the resting behavior was significantly reduced when compared to the HS treatment (P < 0.05). The comfort behavior improved significantly (P < 0.05) in the HS + PHY treatment as observed in preening and wing stretching behavior with no significant effect on head scratching, dust bathing, and wing flapping behavior in comparison to the HS treatment (P > 0.05). Additionally, the PHY feed additive under TN conditions showed an increase in the feeding, drinking, foraging, walking, preening, and wing stretching behavior while the resting behavior decreased in the TN + PHY treatment compared to the TN treatment (P < 0.05), while no significant effect on the other comfort behavior between them (P > 0.05).

Hematological parameters

The hematological parameters presented in Table 3 show that the HS treatment experienced a significant increase in RBCs count, while both MCV and MCH decreased compared to the TN treatment (P < 0.05). Additionally, the WBCs count was elevated, primarily due to a rise in heterophile % and reduction in the lymphocyte % leading to a significant increase in the H/L ratio when compared with the TN treatment (P < 0.05). The other hematological tests in the HS treatment did not change significantly compared to the TN treatment. The treatments receiving PHY herbal fortification (TN + PHY and HS + PHY) did not display significant changes in hematological parameters when compared to the TN treatment (P > 0.05).

Table 3 Effect of phytogenic feed additives (PHY) on hematological parameters of thermoneutral, and heat-stressed broiler chickens

Parameters	TN	TN + PHY	HS	HS + PHY	
Hematocrit (%)	37.8 ± 0.37 a	38.2 ± 0.58 a	39.4 ± 0.51 a	38.4 ± 0.51 a	
Hb conc (g/dl)	7.82 ± 0.06 a	8.16 ± 0.29 a	7.96 ± 0.06 a	7.96 ± 0.08 a	
RBCs count (* 106 cell/mm3)	2.77 ± 0.04 b	2.85 ± 0.04 b	3.58 ± 0.1 a	2.88 ± 0.04 b	
MCV (fl.)	136.74 ± 0.93 a	134.04 ± 0.47 ab	110.25 ± 1.71 c	133.35 ± 0.52 ab	
MCH (pg)	28.31 ± 0.85a	28.59 ± 0.64 a	22.3 ± 0.49 b	27.65 ± 0.18 a	
MCHC (%)	20.7 ± 0.09 ab	21.33 ± 0.49 a	20.22 ± 0.15 b	20.73 ± 0.12 ab	
WBCs count (* 103 cell/mm3)	11.08 ± 0.31 b	11.30 ± 0.24 b	14.96 ± 0.39 a	11.89 ± 0.32 b	
Heterophile (H) %	29.81 ± 0.71 b	29.47 ± 0.51 b	41.23 ± 1.5 a	31.10 ± 0.33 b	
Lymphocyte (L) %	65.19 ± 0.64 a	65.53 ± 0.49 a	53.77 ± 0.9 b	63.90 ± 0.32 a	
H/L	0.46 ± 0.02 b	0.45 ± 0.01 b	0.77 ± 0.05a	0.48 ± 0.008 b	
a, b, c Means within a row with different superscripts significantly differ (Tukey’s test; P < 0.05)

TN (control): Thermoneutral treatment, fed basal diet; TN + PHY: Thermoneutral treatment fed basal diet + 1 kg/ton feed PHY; HS: Heat stress treatment, fed basal diet; HS + PHY: Heat stress treatment, fed basal diet + 1 kg/ton feed PHY.

Hb conc: Hemoglobin concentration; RBCs count: Red blood cells count; MCV: Mean corpuscular volume; MCH: Mean corpuscular hemoglobin; MCHC; Mean corpuscular hemoglobin concentration; WBCs count: White blood cells count; (H/L) ratio: heterophile/ lymphocyte ratio

Data are means ± SEM (standard error of the mean)

Number of sampled birds (n) = 3 birds/replicate (12 birds/ treatment)

Metabolic parameters

The PHY fortification improved lipid profile where it significantly decreased cholesterol, triglyceride, and VLDL cholesterol levels when compared to the control treatment, while the HS treatment displayed negative impacts on lipid profile where it significantly increased cholesterol, triglyceride, LDL & VLDL cholesterol levels when compared to the TN treatment (P < 0.05). Furthermore, the HS + PHY treatment could enhance the ameliorating effects of HS where it showed no significant difference in lipid profile when compared to the TN treatment (P > 0.05) as displayed in Table 4. The protein profile displayed in Table 4 shows that the HS treatment significantly reduced total protein, albumin, and globulin but increased the A/G ratio when compared to the TN treatment (P < 0.05). The HS + PHY treatment significantly increased total protein and globulin while decreasing the A/G ratio when compared to the HS treatment (P < 0.05). The glucose level shown in Table 4 displayed a significant increase in the HS treatment (P < 0.05) while the other treatment did not show any change compared to the control one (P > 0.05).

Table 4 Effect of phytogenic feed additives (PHY) on metabolic parameters (lipid profile, protein profile and glucose level) of thermoneutral, and heat-stressed broiler chickens

Parameters	TN	TN + PHY	HS	HS + PHY	
Triglycerides	50.49 ± 1.01 b	37.8 ± 1.88 c	60.09 ± 0.6 a	51.91 ± 1.84 b	
Cholesterol	95.1 ± 1.71 b	85.16 ± 1.08 c	120.57 ± 3.77 a	92.91 ± 1.28 b	
“HDL chol”	72.56 ± 1.76 b	67.59 ± 1.39 b	76.27 ± 2.78 a	69.91 ± 1.55 b	
“LDL chol”	12.43 ± 0.55 b	10.01 ± 0.37 b	32.29 ± 1.44 a	12.62 ± 0.73 b	
“VLDL chol”	10.1 ± 0.20 b	7.56 ± 0.38 c	12.02 ± 0.12 a	10.38 ± 0.37 b	
Total protein	3.27 ± 0.29 a	3.26 ± 0.17 a	1.95 ± 0.03 c	2.7 ± 0.09 b	
Albumin	1.68 ± 0.14 a	1.64 ± 0.08 a	1.09 ± 0.02 b	1.29 ± 0.08 b	
Globulin	1.59 ± 0.16 a	1.62 ± 0.11 a	0.86 ± 0.01 b	1.41 ± 0.02 a	
“A/G ratio”	1.07 ± 0.05 b	1.02 ± 0.05 b	1.27 ± 0.03 a	0.92 ± 0.05 b	
Glucose	147.27 ± 7.34 b	144.24 ± 5.66 b	225.11 ± 6.09 a	160.48 ± 2.48 b	
a, b, c Means within a row with different superscripts significantly differ (Tukey’s test; P < 0.05)

TN (control): Thermoneutral treatment, fed basal diet; TN + PHY: Thermoneutral treatment fed basal diet + 1 kg/ton feed PHY; HS: Heat stress treatment, fed basal diet; HS + PHY: Heat stress treatment, fed basal diet + 1 kg/ton feed PHY.

HDL chol: High-density lipoprotein cholesterol; LDL chol: Low-density lipoprotein cholesterol; VLDL chol: Very low-density lipoprotein cholesterol; A/G ratio: albumin/ globulin ratio

Data are means ± SEM (standard error of the mean)

Number of sampled birds (n) = 3 birds/replicate (12 birds/ treatment)

Liver and kidney function biomarkers

Heat stress had a negative impact on liver and kidney function tests, with significant increases in ALT, AST, uric acid, and creatinine compared to the TN treatment (P < 0.05), while PHY fortification can improve the negative effects that result from HS. It can reduce the parameters that are negatively affected by HS. Additionally, the treatments TN + PHY and HS + PHY did not display any significant changes in liver and kidney function tests when compared to the TN treatment (P > 0.05) as shown in Table 5.

Table 5 Effect of phytogenic feed additives (PHY) on liver enzymes (ALT and AST) activities, and kidney function tests (uric acid and creatinine levels) of thermoneutral, and heat-stressed broiler chickens

Parameters	TN	TN + PHY	HS	HS + PHY	
ALT (U/l)	3.99 ± 0.28 b	3.74 ± 0.18 b	12.61 ± 0.79 a	4.33 ± 0.26 b	
AST (U/l)	51.45 ± 2.27 b	39.0 ± 1.41 c	77.4 ± 2.2 a	57.2 ± 1.98 b	
Uric acid (mg/dl)	3.35 ± 0.18 b	3.48 ± 0.25 b	8.06 ± 0.60 a	3.90 ± 0.13 b	
Creatinine (mg/dl)	0.45 ± 0.04 b	0.38 ± 0.04 b	0.79 ± 0.03 a	0.5 ± 0.03 b	
a, b, c Means within a row with different superscripts significantly differ (Tukey’s test; P < 0.05)

TN (control): Thermoneutral treatment, fed basal diet; TN + PHY: Thermoneutral treatment fed basal diet + 1 kg/ton feed PHY; HS: Heat stress treatment, fed basal diet; HS + PHY: Heat stress treatment, fed basal diet + 1 kg/ton feed PHY.

ALT: Alanine aminotransferase ; AST: Aspartate aminotransferase

Data are means ± SEM ( standard error of the mean)

Number of sampled birds (n) = 3 birds/replicate (12 birds/ treatment)

Oxidative stress biomarkers

The total antioxidant capacity and reduced glutathione activity decreased while MDA rose in the HS treatment compared to the TN treatment. The PHY fortification improved antioxidant activity where it increased TAC, and GSH activity, but lowered MDA level when compared to the TN treatment (P < 0.05). The HS + PHY treatment showed a significant increase in TAC, and GSH but, a decrease in MDA level in comparison to the HS treatment (P < 0.05) as shown in Fig. 5.

Fig. 1 Effect of phytogenic feed additives (PHY) on (a) feeding, (b) drinking, and (c) foraging behavior percentage of heat-stressed broiler chickens; Data are presented as mean ± standard error. Different alphabets indicate significant differences at P < 0.05

Fig. 2 Effect of phytogenic feed additives (PHY) on (a) resting, and (b) walking behavior percentage of heat-stressed broiler chickens; Data are presented as mean ± standard error. Different alphabets indicate significant differences at P < 0.05

Fig. 3 Effect of phytogenic feed additives (PHY) on (a) preening, (b) wing stretching, and (c) head-scratching behavior percentage of heat-stressed broiler chickens; Data are presented as mean ± standard error. Different alphabets indicate significant differences at P < 0.05

Fig. 4 Effect of phytogenic feed additives (PHY) on (a) dust bathing, and (b) wing flapping behavior percentage of heat-stressed broiler chickens; Data are presented as mean ± standard error. Different alphabets indicate significant differences at P < 0.05

Fig. 5 Effect of phytogenic feed additives (PHY) on oxidative stress biomarkers: (a) total antioxidant capacity, (b) malondialdehyde (MDA) level, and (c) reduced glutathione (GSH) activity of heat-stressed broiler chickens; Data are presented as mean ± standard error (n = 12). Different alphabets indicate significant differences at P < 0.05

Gene expression analysis

Heat stress-responsive gene (HSP70)

In the present study, the HSP70 showed the highest significant up-regulation in the HS treatment followed by the HS + PHY in the liver, duodenum, and jejunum (P < 0.05). Meanwhile, there was no significant difference between the TN treatment and the TN + PHY treatment (P > 0.05) (Fig. 6).

Fig. 6 Effect of phytogenic feed additives (PHY) on the relative expression level of (a) duodenal (b) jejunal and (c) liver HSP70 gene of heat stressed broiler chickens; Data are presented as mean ± standard error (n = 12). Different alphabets indicate significant differences at P < 0.05

Gut health biomarker (I-FABP2)

The I-FABP2 expression pattern in the duodenum showed significant upregulation in the TN + PHY and HS + PHY treatments. Meanwhile, it was downregulated in the HS treatment (P < 0.05). Regarding its expression in the jejunum, it showed no significant difference between treatments except for the HS + PHY treatment which showed significant upregulation (P < 0.05) (Fig. 7),

Fig. 7 Effect of phytogenic feed additives (PHY) on the relative expression level of (a) duodenal (b) jejunal and (c) liver FABP2 gene of heat stressed broiler chickens; Data are presented as mean ± standard error (n = 12). Different alphabets indicate significant differences at P < 0.05

Immunity-related genes (TLR4 and IL10)

As shown in Fig. 8, the TLR4 gene in the liver showed significant upregulation in the TN + PHY and HS + PHY treatments, while it was downregulated in the HS treatment (P < 0.05). Duodenal TLR4 showed significant upregulation in the HS and HS + PHY treatments, while it was downregulated in the TN + PHY treatment (P < 0.05). Jejunal TLR4 showed significant upregulation in the HS + PHY treatment while the rest of the treatments showed no significant difference from the TN treatment (P > 0.05).

Fig. 8 Effect of phytogenic feed additives (PHY) on the relative expression level of (a) duodenal (b) jejunal and (c) liver TLR4 gene of heat stressed broiler chickens; Data are presented as mean ± standard error (n = 12). Different alphabets indicate significant differences at P < 0.05

The IL-10 showed marked-up regulation in hepatic, duodenal, and jejunal tissues for the TN + PHY treatment, and in the HS + PHY treatment (P < 0.05). Meanwhile, the HS treatment showed significant downregulation in the hepatic, duodenal, and jejunal tissue (P < 0.05) (Fig. 9).

Fig. 9 Effect of phytogenic feed additives (PHY) on the relative expression level of (a) duodenal (b) jejunal and (c) liver IL10 gene of heat-stressed broiler chickens; Data are presented as mean ± standard error (n = 12). Different alphabets indicate significant differences at P < 0.05

Nutrient-sensitive pathway (mTOR)

Regarding the expression level of the mTOR gene, it showed a marked significant up-regulation in the hepatic and duodenal tissue of the TN + PHY treatment, and the duodenum and jejunum of the HS + PHY treatment (P < 0.05).

The mTOR was observed to be downregulated in the HS and HS + PHY treatments for the liver. Also, the jejunum of HS and TN + PHY treatments showed downregulation in mTOR, while in the duodenum; only the HS treatment showed significant downregulation (P < 0.05) (Fig. 10).

Fig. 10 Effect of phytogenic feed additives (PHY) on the relative expression level of (a) duodenal (b) jejunal and (c) liver mTOR gene of heat-stressed broiler chickens; Data are presented as mean ± standard error (n = 12). Different alphabets indicate significant differences at P < 0.05

Discussion

Global research efforts have increased to identify alternative supplements in response to the “raised without antibiotics” demand and the prohibition on their subtherapeutic use as feed additives [64]. Animal performance is enhanced by the use of phytogenic or phytobiotic feed additives, which are made from plants, herbs, and spices [65]. The PHY additives positive effects on growth, immune system, and stress-relieving response have made them extremely successful, even though the underlying mechanisms are not fully understood. The current study aimed to ascertain the impact and mode of action of a new polyherbal formulation of Terminalia bellirica and Andrographis paniculata on the broilers raised under HS conditions.

In earlier studies, the phytochemical analysis of Andrographis paniculata revealed the presence of 32 bioactive compounds including diterpene lactones (deoxyandrographolide, andrographolide, neoandrographolide, and 14-deoxy-11, 12-didehydroandrographolide), diterpene glucoside, 30 flavonoids, 5 noriridoids, 7-ent-labdane diterpenoids, 2 quinic acid derivatives, 55-ent-labdane diterpenoids, 4 xanthones, 8 quinic acids, and andrographidoids [66–68]. Nonetheless, it has been discovered that the primary component, andrographolide, is in charge of its essential medicinal qualities [69]. Meanwhile, T. bellirica contains several major phytoconstituents, including triterpenoids, flavone, tannins, poly phenols, phenyllemblin, galloyl glucose, ethyl gallate, ellagic acid, bellericanin, chebulaginic acid, gallic acid, corilagin, ellargic acid, termilignan, β-sitosterol.,and thannilignan [70, 71].

Effects of PHY on behavioral parameters

Behavioral parameters could be regarded as a valuable tool for assessing the welfare state of the broiler [72]. It is well known that when birds are exposed to a stressful stimulus like thermal stress their behavior changes to adapt to the new situation [73]. The presence of significant negative effects of HS on broiler behavior and physiology was observed in our results. High ambient temperature in birds caused heat-associated behaviors including decreased foraging and feeding behavior and increased drinking behavior, these results in concurrent with [74] who stated that feeding and drinking behavior can be an adaptive mechanism in the face of thermal stress. Previous research has shown that birds exposed to HS reduce their feeding activities to control their metabolic energy production [75] and increase water intake to cool their bodies to fulfill the immediate demands of evaporative cooling from respiratory surfaces during HS [76]. Since dehydration generally prevents the evaporative reaction to heat exposure, therefore maintaining water balance aids in heat dissipation and consequently controls the body temperature [77].

Our findings demonstrated that feeding PHY feed additives can significantly minimize the deleterious effects of chronic HS on the physiological and behavioral alterations of broilers. Using dietary polyherbal compounds containing T. Bellirica and A. paniculata in the current study demonstrated a positive effect on foraging, feeding, and drinking behavior of broilers. These changes could be attributed to the improved body heat metabolism and appetite [32, 78], as T. Bellirica and A. paniculata contain numerous bioactive metabolites including alkaloids, flavonoids, tannins, and phenols [31, 37], that have anti-inflammatory, antibacterial and antipyretic effects [33, 38].

When the environmental temperature increases above the thermoneutral zone, it was found that, birds engage in more resting in conjugation with less time walking/standing as observed in previous research [79]. Lying down could encourage a decrease in the production of metabolic heat and aid the bird in achieving thermal balance [74]. thereby, coping with HS or reducing the negative consequences of HS [79]. Birds’ walking activities were significantly increased by feeding the dietary PHY additives while the resting activities were decreased. This could be attributed to the improvement of bone health of polyherbal-fed birds and therefore their locomotor activities [80, 81]. Because T. bellirica contains a lot of calcium (ca.) and magnesium (Mg), so it is one of the greatest herbs for bone healing [34]. Additionally, A. paniculata has been demonstrated to be a good source of potassium (K), Ca, Mg, ferrous (Fe), Aluminum (Al), and sodium (Na), all of which are important for health and bone integrity [82]. The comfort behavior patterns used as a stress indicator in broilers decreased under HS conditions [83]. These behavioral changes could be attributed to the oxidative stress caused by chronic HS [84, 85], and improvement of comfort behavior via PHY additives is related to their antioxidant properties [30, 37].

Effects of PHY on hematological parameters

Heat stress can affect the chicken’s hematological status and disrupt their immune system. Blood components in chickens are highly sensitive to environmental changes, making them a valuable indicator of physiological changes [86]. According to the study, the HS treatment had the highest RBCs count and the lowest MCV and MCH values. Additionally, their WBCs count increased, primarily due to an increase in heterophile percentage, while their lymphocyte percentage decreased. These changes led to a significant increase in the H/L ratio as reported by [87, 88]. Exposure of chicken to stressors such as temperature higher than thermal comfort zone led to activation of the hypothalamus-pituitary-adrenocortical (HPA) axis resulting in a rapid increase in circulatory corticosterone levels which in turn may increase H/L ratio, retarding erythrophagocytosis, and stimulating erythropoiesis [9, 89]. Thermal stress can cause a decrease in lymphocyte count, immunoglobulin, antibody response, and macrophage phagocytic activity in broiler chickens [90]. The main active ingredient of andrographis paniculata extract, andrographolide, has been shown to have strong anti-stress properties and helpful in the treatment of behavioral disturbances by modulating biological processes that control corticosterone and cytokine homeostasis [91]. The hypothalamic-pituitary-adrenal axis hyperactivity has been significantly regulated by the gallic acid extract from T. bellirica fruits by lowering serum corticosterone and acetylcholinesterase levels in chronic mild stress-induced depression-like activity in mice model [92].

Effects of PHY on metabolic parameters

Broiler health issues can be identified by analyzing blood biochemistry. The HS treatment showed increased levels of triglycerides, cholesterol, LDL, VLDL, and glucose, while total proteins and globulins were reduced. Generally, exposing birds to adverse environmental temperatures results in a decline in thyroid activity and protein contents while increasing protein catabolism, metabolic acidosis, and anaerobic glycolysis., which leads to an increase in muscular fat deposition [93]. Blood glucose levels increase due to corticosteroid-stimulated gluconeogenesis, also, changes in corticosterone concentration affect body composition, meat quality, and protein and lipid metabolism [94].

The PHY fortification can significantly reduce triglycerides, cholesterol, LDL, and VLDL levels compared to other treatments. It can also ameliorate the adverse effects of HS by improving lipid, glucose, and protein profiles. It can affect the sympathetic-adrenal axis, thereby reducing corticosterone synthesis and increasing cholesterol clearance endogenously, this leads to a decrease in triglycerides and cholesterol levels in the body [95, 96]. Wiono et al. [87] found that Phytocee™, a PHY feed additive, lowered lipid parameters and increased total protein levels in heat-stressed broilers, which is consistent with previous studies.

It has been reported that rats with hyperlipidemia caused by Porphyromonas gingivalis [97] and also those in high-fat emulsion (75% yolk)-diet [98] had lower total cholesterol, LDL-C, and triglyceride levels after receiving andrographolide. Gallic acid (20 mg/kg) from T. bellirica fruit restored serum total cholesterol, triglycerides, LDL cholesterol, urea, uric acid, creatinine, and increased plasma insulin, C-peptide, and glucose tolerance in STZ-induced diabetic rats after 28 days of oral administration [99]. In addition, gallic acid is known to increase the ratio of Bacteroidetes/Firmicutes and gut bacteria that produce SCFAs (short chain fatty acids) to maintain gut health and lower blood triglyceride and intestinal fat digestibility [100]. Another possible mechanisms for hypolipidemic effect of T. bellirica may be attributed to the gallic acid activation of AMPKα, which inactivates the ACC-PPARα axis signaling, and may be responsible for the liver lipid-lowering effects of T. bellirica [101]. Additionally, corilagin may be involved, as it has been shown to downregulate the expression of mRNA related to fatty acid synthesis (FASN, ACC1, SREBP-1c) and upregulate the expression of genes related to fatty acid oxidation (PPARα, CPT1α, ACOX1) [102]. Compared to simvastatin, T. bellirica appeared to elicit a larger biological response inferred from serum markers (ALT and AST) and hepatic inflammatory cytokines (IL-1β, IL-6, and TNF-α) [103]. Flees et al. [65] also reported that PHY additives can modulate avian lipid metabolism via reducing hepatic lipogensis and enhancing the ß-oxidation. Morever, ethanolic T. bellirica extract was reported to slow down the onset of NAFLD (Non-alcoholic fatty liver disease) by lowering the glycerol 3-phosphate (G3P) content since G3P is the synthetic substrate of triglycerides and fatty acids [104].

Recently, it has been shown that Andrographolide can regulate hepatic apelin expression levels in rats and the increment in apelin gene expression was associated with decreased serum glucose levels [105]. A. paniculata showed its potential to increase the expression of the glucose transporter type 4 (GLUT4), increase the number of pancreatic beta cells, which in turn increases insulin secretion, and promote the regeneration of pancreatic beta cells [106]. T. bellirica hypoglycemic activity could be attributed to the synergistic action between more than one compound, like the presence of polyphenolic compounds that suppress elevated plasma glucose levels. Tannins have been shown to have insulin-like glucose transport stimulatory properties. Furthermore, gallotannins like pentagalloyl glucose are more potent and effective at binding to the insulin receptor (IR), activating the IR, and inducing glucose transport [107]. In alloxan diabetic rats both aqueous and ethylacetate T. bellirica extracts showed a restorative effect on serum biomarkers like glucose, creatinine, total protein, total cholesterol, LDL, HDL, triglyceride, urea, and uric acid [108]. T. bellirica notably decreased blood glucose levels in HFD (high-fat diet)-STZ-induced diabetes in rats [109].

Effects of PHY on oxidative stress biomarkers

Heat stress is a well-known environmental issue that can increase oxidative stress levels in the body’s cells [9]. The HS in broiler chickens increases cellular reactive oxygen species (ROS) levels, which impairs the effectiveness of the antioxidant system. This, in turn, reduces enzymatic antioxidant activities like GPx, SOD, and CAT, as well as total antioxidant capacity. Meanwhile, the levels of malondialdehyde (MDA) rise [5, 110]. The current results demonstrated that HS negatively disturbed the redox balance with increasing MDA levels and decreasing GSH and total antioxidant concentration as reported by [111]. Our results showed that the PHY additive boosted the antioxidant activity, increasing TAC and GSH activity while decreasing MDA levels. High environmental temperatures were reported to induce oxidative stress, and hepatic as well as renal injury in animals [112]. Gupta et al. [30]; Owoade et al. [37] related the antioxidative effects of T. Bellirica and A. paniculata to its high content of polyphenols, which reduce the impact of HS on the physiological responses of broiler chickens [113]. Many possible mechanisms exist to account for andrographolide’s antioxidant activity. These mechanisms can be direct [114] or indirect [115]. Andrographolide can inhibit relevant ROS-producing enzymes or protect mitochondria to prevent the generation of free radicals [116]. It may also stimulate enzymatic (SOD, CAT, GST, GSH, and GPx) or non-enzymatic antioxidants, primarily through activating the Nrf2 signaling pathway. T.bellirica fruit contains a variety of polyphenols, including gallic acid and ellagic acid [117]. According to Middha et al. [118], gallic acid and ellagic acid have free radical scavenging activity and inhibit lipid peroxidation. Also, they have been demonstrated to inhibit lipoxygenase activity and lipoxygenase-mediated LDL lipid peroxidation [119]. These findings indicate that T.bellirica may have an antioxidant impact on LDL oxidation by inhibiting both the radical reaction by free radicals and the non-radical reaction by peroxidative enzymes [120]. In addition, T. bellirica’s bioactive compounds enhanced the antioxidant response by activating Nrf2 (nuclear factor erythroid-2 related factor 2), PI3K/Akt, and AMPK transcriptionally [121].

Effects of PHY on liver and kidney functions

To monitor the liver’s health, the levels of ALT and AST in the serum of the broiler are measured. Our study have shown that the levels of ALT and AST were higher in the treatment exposed to HS, while they remained unchanged in the treatments given PHY feed additives compared to the TN treatment. Furthermore, for kidney health evaluation, the uric acid and creatinine values in the HS treatment were observed to be higher than all other treatments. This increase in values could be due to a series of reactions in the nervous and endocrine systems, leading to the release of corticotropin hormone [122]. Fortunately, a study by [87] demonstrated that Phytocee™ effectively controlled HS and had no harmful effects on liver and kidney functions. Rats treated with T. bellirica fruit extract and its ellagic acid derivative showed hepatoprotective effects against liver damage induced by longterm use of diclofenac [123]. Also, pre-treatment with 100–200 mg/kg of T. bellirica leaf methanolic extract markedly and dose-dependently showed hepatoprotective potential against d-galactosamine (D-GalN)-induced liver injury in rats [70]. T. bellirica fruit ethyl acetate extract and ellagic acid had hepatoprotective effects in aceclofenac-induced hepatotoxicity in rats [124]. These hepatoprotective effects were represented in decreased levels of serum markers including ALT, AST, GGT, bilirubin, and ALP [70, 124]. A. paniculata has been reported to have an ameliorative effect for methotrexate (MTX) induced nephrotoxicity in rats and restored kidney markers including BUN, urea, creatinine, and uric acid [125]. T. bellirica showed a marked restorative effect on kidney function defined by significant improvement of serum urea, uric acid, and creatinine levels in either alloxan or STZ-induced diabetes in rats [99, 108]. Moreover, T. bellirica proved its nephroprotective effect by enhancing the kidney’s antioxidant status [121]. Also, T. bellirica was reported as a natural substitute for lowering serum uric acid due to its ability to inhibit xanthine oxidase, which has enhanced both the estimated glomerular filtration rate and serum creatinine [126].

Effects of PHY on gene expression

It’s well identified that HS results in the decrease of protein synthesis except for the highly conserved proteins known as heat shock proteins (HSPs) [127]. The HSPs are a group of molecular chaperones that direct the proper folding of newly synthesized proteins and refolding of the misfoldedones. As a surviving mechanism, The HSPs are found to be upregulated in response to exposure of cells to stressful conditions like; high temperatures or oxidative stress [128, 129]. In the present study, as expected, HSP70 was significantly upregulated in the liver, duodenum, and jejunum of the HS treatment in comparison to the other treatments as reported by [130, 131]. Meanwhile, the PHY fortification reduced the HSP70 expression in the HS treatment. Similarly, PHY feed additives (comfort ™) decreased HSP70 in the hypothalamus of chronic HS broilers [132]. Comparably, Dietary resveratrol significantly reduced HSP70, HSP90, and NF-κB expression in the gut of HS chickens after 2 weeks of supplementation [133]. The possible mechanism of action for A. paniculata can be attributed to Andrographolide which in response to elevated ROS, stimulates heat shock factor 1 (HSF1) which is the key regulator for HSR (Heat shock response) and upregulates the number of genes like inducible protein chaperons as HSP70 [134]. Meanwhile, among T. bellirica phytochemical constituents; ellagic acid was reported to mitigate the effects of different stressors via the downregulation of HSP70 [135, 136].

Heat stress is thought to primarily target the intestine [4]. Consequently, it is essential to preserve the gut barrier’s proper functioning for the body’s general health and balance as well as for preserving its ability to defend against environmental antigens. A collection of fatty acid transporters and binding proteins facilitates the intestine’s absorption of the majority of dietary fats [137]. FABP2; intestinal FABP; was found to be abundantly expressed in the enterocytes and had a crucial role in the gut barrier integrity [138].

To delineate the effect of PHY feed additives on gut health; FABP2 expression levels were investigated in the duodenum and jejunum. Our result showed that FABP2 was significantly downregulated in duodenum of the HS treatment while jejunum was not affected. Meanwhile its up regulated in both the duodenum and jejunum of the HS + PHY treatment in addition; the duodenum of the TN + PHY treatment. The HS alters the integrity of the intestine, which increases permeability in the gut and thus facilitates pathogen invasion, and impairment of nutrient absorption, resulting in a lowering of the animal performance. Numerous investigations have documented a reduction in the intestinal expression of the FABP gene in chickens, regardless of the duration and degree of stress exposure [139, 140]. The decrease in the levels of the FABP gene during HS could be attributed to structural damage and epithelium loss in the intestine [141]. I-FABP is thought to be a biomarker of intestinal barrier breakdown in various mammals, including humans [142]. Chen et al. [143] reported that broilers with compromised gut barriers had lower levels of FABP-2 expression. The possible restorative mechanism is due to maintaining the health and integrity of the intercellular structure of the enterocytes via the antioxidant effect of A.paniculata and T. bellirica through reducing ROS and activating the NRF2 pathway [121], also it has been reported that dietary andrographolide upregulated the occludin, ZO-1 (zonula occludens-1) and ZO-2 (zonula occludens-1) mRNA levels which stabilize intercellular structural integrity of the intestine in Monopterus albus [144], in addition, andrographolide has proven to have gut microbiome modulating effect which is critical for the intestinal health [144, 145]. Ethyl acetate extract from Terminalia bellirica (TBEA) preserved intestinal homeostasis by controlling the composition of the intestinal flora, lowering the concentration of inflammatory cytokines as well as ROS in mice with ulcerative colitis [146]. T. bellirica extract showed its ability to prevent S. Typhimurium infection in mice by enhancing the intestinal physical and immunological barriers and restoring the gut microbiota [147]. According to Li et al. [148], gallic acid may be able to mitigate the colitis caused by dextran sulfate sodium in rats by modifying the composition of the microbiome. Furthermore, by boosting the overall level of probiotics like Bifidobacterium, ellagic acid may mitigate the dysbiosis of the gut microbiota brought on by alcohol [149]. Similarly, Spirulina platensis supplementation to broilers’ diet was reported to improve the gut health barrier by increasing the expression of FABP2 in the jejunum and enhancing the gut microbiota [62].

Pro- and anti-inflammatory cytokines are secreted by distinct immune cells under varying stress conditions, and they are essential in determining an organism’s immune status [150]. Interleukin-10 (IL-10) is one of the most significant cytokines associated with numerous pathophysiological circumstances, where it constrains the production of pro-inflammatory mediators [5]. In the current study, IL-10 showed significant upregulation in the investigated tissues of all PHY-supplemented treatments either in TN or HS conditions. The HS-induced oxidative stress was reported to raise the levels of inflammatory mediators (TNF-α, IL-2, and IFN-γ) and lower the expression of anti-inflammatory mediators (IL-10, for example), which in turn leads to immunological dysfunction [21, 146].

The PHY feed additives successfully raised the IL-10 gene’s expression level, indicating that HS-induced inflammation in the broiler was being reduced. Since stress triggers inflammatory reactions, the upregulation of the anti-inflammatory cytokine IL-10 protects cells from the damaging effects of oxidative stress through the production of pro-inflammatory cytokines, innate immunity aids in the removal of pathogens and provides cellular protection; however, reduced levels of these cytokines may encourage bacterial colonization [151, 152]. Andrographolide was reported to increase the anti-inflammatory factor IL-10 levels in the peritoneal cavity fluid of mice with cecal ligation and puncture (CLP)-induced sepsis [153]. Also, the aqueous leaf extract of A. paniculata showed a pronounced effect in the restoration of IL-10 levels in the intestine and kidney of MTX(Methotrexate) induced toxicity rat model [125]. Gallic acid, as one of the main constituents in T. Bellirica, was reported to attenuate the symptoms of collagen-induced arthritis (CIA) via upregulating the anti-inflammatory cytokines including IL-10 in mouse models [154]. Moreover, gallic acid increased the expression levels of IL-10 in mice models with atopic dermatitis-like skin inflammation [155].

TLR4 is identified as the primary lipopolysaccharide (LPS) recognition receptor. TLR4 is essential for starting the body’s early defense against invasive pathogens and the inflammatory reaction [156, 157]. In the present study, our results revealed that TLR4 was significantly up-regulated in the duodenum of HS, and HS + PHY; jejunum of HS + PHY treatment, and liver of the TN + PHY treatment. It was reported that heat-stressed broilers either had increased levels of TLR4 in the duodenum [158] or the jejunum and ileum [130]. According to [159], Andrographolide controls TLR4 activity and modulates the adaptive immune response. Extract from Terminalia bellirica was reported to diminish LPS-induced inflammatory process and oxidative stress in mice [121]. Many studies have reported the inhibitory effects of T. bellirica and A. paniculata for the TLR4 signaling pathways [103, 160], however, TLR4 expression-associated diseases are associated with prolonged stimulation for TLR4 as well as disrupted trafficking via the endo-lysosomal compartment [161]. Meanwhile, our findings can be explained on the basis that PHY feed additives have ameliorated the effect of TLR4 activation via increasing the anti-inflammatory cytokine (IL10) as well as reduced oxidative stress in supplemented treatments.

Serine/threonine kinase mTOR regulates many cellular processes in response to growth factors, nutrients, intracellular ATP, and stressors [162–164]. In poultry, mTOR promotes protein synthesis and encourages muscle fiber growth and hypertrophy [165]. Our experimental conditions showed that HS downregulated the mTOR expression in different organs, while phytonutrient-supplemented treatments showed a significant increase in the expression except for the liver in HS supplemented treatment. In vitro, Andrographolide ameliorated the protein aggregation-induced cellular toxicity via upregulation of mTORC1 which in turn activated HSF1 and Nrf2 [134]. Under TN conditions, using Superliv concentrate premix which contains Andrographis paniculata as one of its ingredients resulted in the upregulation of mTOR expression, and total protein in broiler muscles [65]. He et al. [21] revealed that heat exposure inhibited mTOR activity in chickens. Likewise, it was noted that heat-stressed broilers fed diets nourished with noni, a plant source that contains a range of phytochemicals and antioxidants, had a decrease in mTOR mRNA levels in the liver [166]. By lessening the load of protein synthesis during HS, mTOR reduction in the liver may serve as a protective mechanism [167]. This could explain our findings that combined phytonutrients (T. Bellirica and A. paniculata) have decreased the expression levels of mTOR in the liver to alleviate the HS–induced oxidative stress and reduce the synthesis of inflammatory cytokines.

There are certain limitations even though our study demonstrated that giving broilers PHY feed additives supplementation has mitigated the negative effects of HS referring to that; little data are available about the effects of Terminalia bellirica and Andrographis paniculata in poultry. The limitations can be concluded as the following: the phytochemical analysis for the “Herb-ALL™ COOL” is not performed in this study, however, many studies have previously described the phytochemical composition of Terminalia bellirica and Andrographis paniculata [66–68]. In this study, the recommended inclusion rate by manufacturer for “Herb-ALL™ COOL” has been used, and further studies are needed to test the effects of different doses on the broiler performance. To better understand the effects of Terminalia bellirica and Andrographis paniculata on the gut microbiota, meat quality, in laying hens, and in other stressful situations; more research should be conducted. Comparative analysis for changes of different biological biomarkers between blood and different tissue should be conducted. Molecular-based studies are required to confirm the mechanism of action of these plants in the avian species.

Conclusion

It is concluded that the global poultry industry faces a considerable socioeconomic challenge in the form of HS. This is because HS negatively impacts bird behavior, as well as various physiological and biochemical parameters. These effects result in oxidative stress and a decline in bird productivity. Terminalia bellirica and Andrographis paniculata supplements have the potential to alleviate the HS in birds. The positive outcomes observed may be attributed to the enrichment of antioxidants in the birds through the addition of PHY feed additives. This fortification seemed to alleviate HS in the animals, resulting in enhancements in their behavior, hematological and biochemical parameters, oxidative stress levels, immune response, and intestinal health. These improvements were evidenced by the regulation of genes associated with heat response, nutrient sensing, and immune function. Furthermore, there was a significant improvement observed in the marker of intestinal health, specifically I-FABP2.

Acknowledgements

Not applicable.

Author contributions

RHF and BMB; Implemented the study design and diet formulations. RHF, BMB, AMY, SEA, and KM methodology, investigation, and resources. BMB; Behavioral parameters, SEA; Biochemical and haematological parameters, and oxidative stress biomarkers and AMY; Gene expression. BMB, AMY, and SEA; Formal analysis, data curation, writing, and original draft preparation., BMB, AMY; writing, reviewing, and final editing. RHF; supervision. All authors have read and approved the final version of the manuscript.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB).

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

This study was carried out in accordance with the guidelines and approval of the Institutional Animal Care and Use Committee, Faculty of Veterinary Medicine, Cairo University, Egypt (Vet CU 09092023779) with relevance to ARRIVE guidelines.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. -Calik A Emami NK Schyns G White MB Walsh MC Romero LF Dalloul RA Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, part II: oxidative stress, immune response, gut integrity, and intestinal microbiota Poult Sci 2022 101 6 101858 10.1016/j.psj.2022.101858 35468426
Calik A, Emami NK, Schyns G, White MB, Walsh MC, Romero LF, Dalloul RA. Influence of dietary vitamin E and selenium supplementation on broilers subjected to heat stress, part II: oxidative stress, immune response, gut integrity, and intestinal microbiota. Poult Sci. 2022;101(6):101858. 10.1016/j.psj.2022.101858.35468426 10.1016/j.psj.2022.101858
2. -Abo Ghanima MM Bin-Jumah M Abdel-Moneim AME Khafaga AF El-Hack A Allam ME El-Kasrawy NI Impacts of strain variation on response to heat stress and boldo extract supplementation to broiler chickens Animals 2019 10 1 24 10.3390/ani10010024 31877662
Abo Ghanima MM, Bin-Jumah M, Abdel-Moneim AME, Khafaga AF, El-Hack A, Allam ME, A. A., El-Kasrawy NI. Impacts of strain variation on response to heat stress and boldo extract supplementation to broiler chickens. Animals. 2019;10(1):24.31877662 10.3390/ani10010024
3. Abdel-Moneim AME, Shehata AM, Mohamed NG, Elbaz AM, Ibrahim NS. Synergistic effect of Spirulina platensis and selenium nanoparticles on growth performance, serum metabolites, immune responses, and antioxidant capacity of heat-stressed broiler chickens. Biol Trace Elem Res. 2022:1–12.
4. -Brugaletta G Teyssier JR Rochell SJ Dridi S Sirri F A review of heat stress in chickens. Part I: insights into physiology and gut health Front Physiol 2022 13 934381 10.3389/fphys.2022.934381 35991182
Brugaletta G, Teyssier JR, Rochell SJ, Dridi S, Sirri F. A review of heat stress in chickens. Part I: insights into physiology and gut health. Front Physiol. 2022;13:934381.35991182 10.3389/fphys.2022.934381
5. Hidayat DF, Mahendra MY, Kamaludeen J, Pertiwi H. Lycopene in feed as antioxidant and immuno-modulator improves broiler chicken’s performance under heat-stress conditions. Veterinary medicine international. 2023;2023.
6. Khan RU, Naz S, Ullah H, Ullah Q, Laudadio V, Qudratullah, Bozzo G, Tufarelli V. Physiological dynamics in broiler chickens under heat stress and possible mitigation strategies. Anim. Biotechnol. 2023;34(2):438–47.
7. -Oke OE Uyanga VA Iyasere OS Oke FO Majekodunmi BC Logunleko MO Abiona JA Nwosu EU Abioja MO Daramola JO Onagbesan OM Environmental stress and livestock productivity in hot-humid tropics: alleviation and future perspectives J Therm Biol 2021 100 103077 10.1016/j.jtherbio.2021.103077 34503814
Oke OE, Uyanga VA, Iyasere OS, Oke FO, Majekodunmi BC, Logunleko MO, Abiona JA, Nwosu EU, Abioja MO, Daramola JO, Onagbesan OM. Environmental stress and livestock productivity in hot-humid tropics: alleviation and future perspectives. J Therm Biol. 2021;100:103077.34503814 10.1016/j.jtherbio.2021.103077
8. -Lara LJ Rostagno MH Impact of heat stress on poultry production Animals 2013 3 2 356 69 10.3390/ani3020356 26487407
Lara LJ, Rostagno MH. Impact of heat stress on poultry production. Animals. 2013;3(2):356–69.26487407 10.3390/ani3020356
9. -Nanto-Hara F Ohtsu H Yamazaki M Hirakawa T Sato K Murakami H Effects of dietary brown rice on the growth performance, systemic oxidative status, and splenic inflammatory responses of broiler chickens under chronic heat stress J Poult Sci 2021 58 3 154 62 10.2141/jpsa.0200063 34447279
Nanto-Hara F, Ohtsu H, Yamazaki M, Hirakawa T, Sato K, Murakami H. Effects of dietary brown rice on the growth performance, systemic oxidative status, and splenic inflammatory responses of broiler chickens under chronic heat stress. J Poult Sci. 2021;58(3):154–62.34447279 10.2141/jpsa.0200063
10. -Lan R Li Y Chang Q Zhao Z Dietary chitosan oligosaccharides alleviate heat stress–induced intestinal oxidative stress and inflammatory response in yellow-feather broilers Poult Sci 2020 99 12 6745 52 10.1016/j.psj.2020.09.050 33248590
Lan R, Li Y, Chang Q, Zhao Z. Dietary chitosan oligosaccharides alleviate heat stress–induced intestinal oxidative stress and inflammatory response in yellow-feather broilers. Poult Sci. 2020;99(12):6745–52.33248590 10.1016/j.psj.2020.09.050
11. -Ghanima MMA El-Hack A Othman ME Taha SI Allam AE Abdel-Moneim AME Impact of different rearing systems on growth, carcass traits, oxidative stress biomarkers, and humoral immunity of broilers exposed to heat stress Poult Sci 2020 99 6 3070 8 10.1016/j.psj.2020.03.011 32475443
Ghanima MMA, El-Hack A, Othman ME, Taha SI, Allam AE, A. A., Abdel-Moneim AME. Impact of different rearing systems on growth, carcass traits, oxidative stress biomarkers, and humoral immunity of broilers exposed to heat stress. Poult Sci. 2020;99(6):3070–8.32475443 10.1016/j.psj.2020.03.011
12. -Emami NK Jung U Voy B Dridi S Radical response: effects of heat stress-induced oxidative stress on lipid metabolism in the avian liver Antioxidants 2020 10 1 35 10.3390/antiox10010035 33396952
Emami NK, Jung U, Voy B, Dridi S. Radical response: effects of heat stress-induced oxidative stress on lipid metabolism in the avian liver. Antioxidants. 2020;10(1):35.33396952 10.3390/antiox10010035
13. -Chen Y Cheng Y Du M Zhou Y Protective effects of dietary synbiotic supplementation on meat quality and oxidative status in broilers under heat stress Environ Sci Pollut Res 2021 28 30197 206 10.1007/s11356-021-12535-3
Chen Y, Cheng Y, Du M, Zhou Y. Protective effects of dietary synbiotic supplementation on meat quality and oxidative status in broilers under heat stress. Environ Sci Pollut Res. 2021;28:30197–206.10.1007/s11356-021-12535-3
14. -Ma D Liu Q Zhang M Feng J Li X Zhou Y Wang X iTRAQ-based quantitative proteomics analysis of the spleen reveals innate immunity and cell death pathways associated with heat stress in broilers (Gallus gallus) J Proteom 2019 196 11 21 10.1016/j.jprot.2019.01.012
Ma D, Liu Q, Zhang M, Feng J, Li X, Zhou Y, Wang X. iTRAQ-based quantitative proteomics analysis of the spleen reveals innate immunity and cell death pathways associated with heat stress in broilers (Gallus gallus). J Proteom. 2019;196:11–21.10.1016/j.jprot.2019.01.012
15. -Li Q Zhou H Ouyang J Guo S Zheng J Li G Effects of dietary tryptophan supplementation on body temperature, hormone, and cytokine levels in broilers exposed to acute heat stress Trop Anim Health Prod 2022 54 3 164 10.1007/s11250-022-03161-3 35435494
Li Q, Zhou H, Ouyang J, Guo S, Zheng J, Li G. Effects of dietary tryptophan supplementation on body temperature, hormone, and cytokine levels in broilers exposed to acute heat stress. Trop Anim Health Prod. 2022;54(3):164.35435494 10.1007/s11250-022-03161-3
16. -Mirsaiidi Farahani M Hosseinian SA Effects of dietary stinging nettle (Urtica dioica) on hormone stress and selected serum biochemical parameters of broilers subjected to chronic heat stress Veterinary Med Sci 2022 8 2 660 7 10.1002/vms3.721
Mirsaiidi Farahani M, Hosseinian SA. Effects of dietary stinging nettle (Urtica dioica) on hormone stress and selected serum biochemical parameters of broilers subjected to chronic heat stress. Veterinary Med Sci. 2022;8(2):660–7.10.1002/vms3.721
17. -Oluwagbenga EM Tetel V Schober J Fraley GS Chronic heat stress part 1: decrease in egg quality, increase in cortisol levels in egg albumen, and reduction in fertility of breeder pekin ducks Front Physiol 2022 13 2392 10.3389/fphys.2022.1019741
Oluwagbenga EM, Tetel V, Schober J, Fraley GS. Chronic heat stress part 1: decrease in egg quality, increase in cortisol levels in egg albumen, and reduction in fertility of breeder pekin ducks. Front Physiol. 2022;13:2392.10.3389/fphys.2022.1019741
18. -Nawaz AH Amoah K Leng QY Zheng JH Zhang WL Zhang L Poultry response to heat stress: its physiological, metabolic, and genetic implications on meat production and quality including strategies to improve broiler production in a warming world Front Vet Sci 2021 23 699081 10.3389/fvets.2021.699081
Nawaz AH, Amoah K, Leng QY, Zheng JH, Zhang WL, Zhang L. Poultry response to heat stress: its physiological, metabolic, and genetic implications on meat production and quality including strategies to improve broiler production in a warming world. Front Vet Sci. 2021;23:699081.10.3389/fvets.2021.699081
19. -Yang C Luo P Chen SJ Deng ZC Fu XL Xu DN Tian YB Huang YM Liu WJ Resveratrol sustains intestinal barrier integrity, improves antioxidant capacity, and alleviates inflammation in the jejunum of ducks exposed to acute heat stress Poult Sci 2021 100 11 101459 10.1016/j.psj.2021.101459 34614430
Yang C, Luo P, Chen SJ, Deng ZC, Fu XL, Xu DN, Tian YB, Huang YM, Liu WJ. Resveratrol sustains intestinal barrier integrity, improves antioxidant capacity, and alleviates inflammation in the jejunum of ducks exposed to acute heat stress. Poult Sci. 2021;100(11):101459.34614430 10.1016/j.psj.2021.101459
20. -Agah S Akbari A Sadeghi E Morvaridzadeh M Basharat Z Palmowski A Heshmati J Resveratrol supplementation and acute pancreatitis: a comprehensive review Biomed Pharmacother 2021 137 111268 10.1016/j.biopha.2021.111268 33493966
Agah S, Akbari A, Sadeghi E, Morvaridzadeh M, Basharat Z, Palmowski A, Heshmati J. Resveratrol supplementation and acute pancreatitis: a comprehensive review. Biomed Pharmacother. 2021;137:111268.33493966 10.1016/j.biopha.2021.111268
21. -He S Yu Q He Y Hu R Xia S He J Dietary resveratrol supplementation inhibits heat stress-induced high-activated innate immunity and inflammatory response in spleen of yellow-feather broilers Poult Sci 2019 98 12 6378 87 10.3382/ps/pez471 31406997
He S, Yu Q, He Y, Hu R, Xia S, He J. Dietary resveratrol supplementation inhibits heat stress-induced high-activated innate immunity and inflammatory response in spleen of yellow-feather broilers. Poult Sci. 2019;98(12):6378–87.31406997 10.3382/ps/pez471
22. -Goel A Ncho CM Choi YH Regulation of gene expression in chickens by heat stress J Anim Sci Biotechnol 2021 12 1 3 10.1186/s40104-020-00523-5 33397465
Goel A, Ncho CM, Choi YH. Regulation of gene expression in chickens by heat stress. J Anim Sci Biotechnol. 2021;12:1–3.33397465 10.1186/s40104-020-00523-5
23. -Mohamed AS Abd El Latif MA Hussein EA Toson EM Saleh M Kokoszynski D Elnesr SS Mohany M Al-Rejaie SS Elwan H Efficacy of Dietary supplementation with zinc-chromium mixture, Organic Selenium, or their combinations on growth performance, carcass traits, and blood profiles of broilers under heat stress conditions Animals 2023 13 15 2539 10.3390/ani13152539 37570347
Mohamed AS, Abd El Latif MA, Hussein EA, Toson EM, Saleh M, Kokoszynski D, Elnesr SS, Mohany M, Al-Rejaie SS, Elwan H. Efficacy of Dietary supplementation with zinc-chromium mixture, Organic Selenium, or their combinations on growth performance, carcass traits, and blood profiles of broilers under heat stress conditions. Animals. 2023;13(15):2539.37570347 10.3390/ani13152539
24. Barrio -Del Mansilla AS Navarro-Villa WD Mica A Smeets JH Hartog JHD García-Ruiz AI Effect of mineral and vitamin C mix on growth performance and blood corticosterone concentrations in heat-stressed broilers J Appl Poult Res 2020 29 1 23 33 10.1016/j.japr.2019.11.001
Barrio -Del, Mansilla AS, Navarro-Villa WD, Mica A, Smeets JH, Hartog JHD, L. A., García-Ruiz AI. Effect of mineral and vitamin C mix on growth performance and blood corticosterone concentrations in heat-stressed broilers. J Appl Poult Res. 2020;29(1):23–33.10.1016/j.japr.2019.11.001
25. -Pečjak M Leskovec J Levart A Salobir J Rezar V Effects of dietary vitamin E, vitamin C, selenium and their combination on carcass characteristics, oxidative stability and breast meat quality of broiler chickens exposed to cyclic heat stress Animals 2022 12 14 1789 10.3390/ani12141789 35883336
Pečjak M, Leskovec J, Levart A, Salobir J, Rezar V. Effects of dietary vitamin E, vitamin C, selenium and their combination on carcass characteristics, oxidative stability and breast meat quality of broiler chickens exposed to cyclic heat stress. Animals. 2022;12(14):1789.35883336 10.3390/ani12141789
26. -Ahmad R Yu YH Hsiao FSH Su CH Liu HC Tobin I Zhang G Cheng Y Influence of heat stress on poultry growth performance, intestinal inflammation, and immune function and potential mitigation by probiotics Animals 2022 12 17 2297 10.3390/ani12172297 36078017
Ahmad R, Yu YH, Hsiao FSH, Su CH, Liu HC, Tobin I, Zhang G, Cheng Y. Influence of heat stress on poultry growth performance, intestinal inflammation, and immune function and potential mitigation by probiotics. Animals. 2022;12(17):2297.36078017 10.3390/ani12172297
27. -Kaplan C Koksal BH Effect of dietary supplementation with a herbal extract on growth performance and meat quality in quails raised under thermal-neutral and heat stress conditions Poult Sci J 2021 9 1 73 84
Kaplan C, Koksal BH. Effect of dietary supplementation with a herbal extract on growth performance and meat quality in quails raised under thermal-neutral and heat stress conditions. Poult Sci J. 2021;9(1):73–84.
28. -Wen C Liu Y Ye Y Tao Z Cheng Z Wang T Zhou Y Effects of gingerols-rich extract of ginger on growth performance, serum metabolites, meat quality and antioxidant activity of heat-stressed broilers J Therm Biol 2020 89 102544 10.1016/j.jtherbio.2020.102544 32364987
Wen C, Liu Y, Ye Y, Tao Z, Cheng Z, Wang T, Zhou Y. Effects of gingerols-rich extract of ginger on growth performance, serum metabolites, meat quality and antioxidant activity of heat-stressed broilers. J Therm Biol. 2020;89:102544.32364987 10.1016/j.jtherbio.2020.102544
29. -,Basiouni S Tellez-Isaias G Latorre JD Graham BD Petrone-Garcia VM El-Seedi HR Yalçın S El-Wahab AA Visscher C May-Simera HL Huber C Anti-inflammatory and antioxidative phytogenic substances against secret killers in poultry: current status and prospects Veterinary Sci 2023 10 1 55
,Basiouni S, Tellez-Isaias G, Latorre JD, Graham BD, Petrone-Garcia VM, El-Seedi HR, Yalçın S, El-Wahab AA, Visscher C, May-Simera HL, Huber C. Anti-inflammatory and antioxidative phytogenic substances against secret killers in poultry: current status and prospects. Veterinary Sci. 2023;10(1):55.
30. -Gupta A Kumar R Bhattacharyya P Bishayee A Pandey AK Terminalia bellirica (Gaertn.) Roxb.(Bahera) in health and disease: a systematic and comprehensive review Phytomedicine 2020 77 153278 10.1016/j.phymed.2020.153278 32781393
Gupta A, Kumar R, Bhattacharyya P, Bishayee A, Pandey AK. Terminalia bellirica (Gaertn.) Roxb.(Bahera) in health and disease: a systematic and comprehensive review. Phytomedicine. 2020;77:153278.32781393 10.1016/j.phymed.2020.153278
31. -Akter S Begum T Begum R Tonny TS Yasmin M Shifa S Afroze F Phytochemical analysis and investigation of anti-inflammatory and anti-ulcer activity of Terminalia bellirica leaves extract Int J Pharmacogn 2019 6 54 65
Akter S, Begum T, Begum R, Tonny TS, Yasmin M, Shifa S, Afroze F. Phytochemical analysis and investigation of anti-inflammatory and anti-ulcer activity of Terminalia bellirica leaves extract. Int J Pharmacogn. 2019;6:54–65.
32. Al-Harrasi A, Bhatia S, Aldawsari MF, Behl T. Plant profile, phytochemistry, and ethnopharmacological uses of Terminalia bellirica, Terminalia chebula, and Terminalia arjuna. InRecent Advances in Natural Products Science 2022 Jul 21 (pp. 143–172). CRC Press.).
33. -Sharma P Verma KK Raj H Thakur N A review on ethnobotany, phytochemistry and pharmacology on Terminalia Belerica (Bibhitaki) J Drug Delivery Ther 2021 11 1–s 173 81 10.22270/jddt.v11i1-s.4739
Sharma P, Verma KK, Raj H, Thakur N. A review on ethnobotany, phytochemistry and pharmacology on Terminalia Belerica (Bibhitaki). J Drug Delivery Ther. 2021;11(1–s):173–81.10.22270/jddt.v11i1-s.4739
34. -Gunasekar CJ Abu-Yousef IA Narasimhan S Majdalawieh AF Analysis of macro and micro elemental composition of different extracts and finished products of the medicinal Herb–Terminalia bellirica Mediterranean J Chem 2019 9 5 371 81 10.13171/mjc01912031128afm
Gunasekar CJ, Abu-Yousef IA, Narasimhan S, Majdalawieh AF. Analysis of macro and micro elemental composition of different extracts and finished products of the medicinal Herb–Terminalia bellirica. Mediterranean J Chem. 2019;9(5):371–81.10.13171/mjc01912031128afm
35. -Jiang M Sheng F Zhang Z Ma X Gao T Fu C Li P Andrographis paniculata (burm. f.) Nees and its major constituent andrographolide as potential antiviral agents J Ethnopharmacol 2021 272 113954 10.1016/j.jep.2021.113954 33610706
Jiang M, Sheng F, Zhang Z, Ma X, Gao T, Fu C, Li P. Andrographis paniculata (burm. f.) Nees and its major constituent andrographolide as potential antiviral agents. J Ethnopharmacol. 2021;272:113954.33610706 10.1016/j.jep.2021.113954
36. -Liu Z Lei X Li J Zhong Y Tan D Zhang Q Kong Z Effects of fermented Andrographis paniculata on growth performance, carcass traits, immune function, and intestinal health in Muscovy ducks Poult Sci 2023 102 3 102461 10.1016/j.psj.2022.102461 36709554
Liu Z, Lei X, Li J, Zhong Y, Tan D, Zhang Q, Kong Z. Effects of fermented Andrographis paniculata on growth performance, carcass traits, immune function, and intestinal health in Muscovy ducks. Poult Sci. 2023;102(3):102461.36709554 10.1016/j.psj.2022.102461
37. -Owoade AO Alausa AO Adetutu A Olorunnisola OS Owoade AW Phytochemical characterization and antioxidant bioactivity of Andrographis paniculata (Nees) PAJOLS 2021 5 2 246 56 10.36108/pajols/1202.50.0220
Owoade AO, Alausa AO, Adetutu A, Olorunnisola OS, Owoade AW. Phytochemical characterization and antioxidant bioactivity of Andrographis paniculata (Nees). PAJOLS. 2021;5(2):246–56.10.36108/pajols/1202.50.0220
38. -Julaton T Taclendo A Oyong G Rempillo O Galvez MC Vallar E In silico insights on the pro-inflammatory potential of polycyclic aromatic hydrocarbons and the prospective anti-inflammatory capacity of andrographis paniculata phytocompounds Int J Environ Res Public Health 2022 19 14 8588 10.3390/ijerph19148588 35886440
Julaton T, Taclendo A, Oyong G, Rempillo O, Galvez MC, Vallar E. In silico insights on the pro-inflammatory potential of polycyclic aromatic hydrocarbons and the prospective anti-inflammatory capacity of andrographis paniculata phytocompounds. Int J Environ Res Public Health. 2022;19(14):8588.35886440 10.3390/ijerph19148588
39. -Arify T Valavan SE Varun A Sundaresan A Manimaran K Effect of garlic (Allium sativum) and nilavembu (Andrographis paniculata) on growth performance and cost effectiveness of broiler chicken Indian J Anim Sci 2019 89 11 1242 5 10.56093/ijans.v89i11.95880
Arify T, Valavan SE, Varun A, Sundaresan A, Manimaran K. Effect of garlic (Allium sativum) and nilavembu (Andrographis paniculata) on growth performance and cost effectiveness of broiler chicken. Indian J Anim Sci. 2019;89(11):1242–5.10.56093/ijans.v89i11.95880
40. -Aneesh A George AJ Krishna BD Abraham MJ Kariyil BJ Hepatoprotective and nephroprotective effect of Aegle marmelos and Andrographis paniculata in aflatoxicosis of broiler chicken Indian J Anim Res 2021 55 3 347 52
Aneesh A, George AJ, Krishna BD, Abraham MJ, Kariyil BJ. Hepatoprotective and nephroprotective effect of Aegle marmelos and Andrographis paniculata in aflatoxicosis of broiler chicken. Indian J Anim Res. 2021;55(3):347–52.
41. -Gao J Wang R Liu J Wang W Chen Y Cai W Effects of novel microecologics combined with traditional Chinese medicine and probiotics on growth performance and health of broilers Poult Sci 2022 101 101412 10.1016/j.psj.2021.101412 34920387
Gao J, Wang R, Liu J, Wang W, Chen Y, Cai W. Effects of novel microecologics combined with traditional Chinese medicine and probiotics on growth performance and health of broilers. Poult Sci. 2022;101:101412.34920387 10.1016/j.psj.2021.101412
42. Aviagen. Ross broiler management manual. 2009. ROSS: Richmond, VA, USA, 2014; 9, 350–364.
43. -Cramer TA Kim HW Chao Y Wang W Cheng HW Kim YHB Effects of probiotic (Bacillus subtilis) supplementation on meat quality characteristics of breast muscle from broilers exposed to chronic heat stress Poult Sci 2018 97 3358 68 10.3382/ps/pey176 30137545
Cramer TA, Kim HW, Chao Y, Wang W, Cheng HW, Kim YHB. Effects of probiotic (Bacillus subtilis) supplementation on meat quality characteristics of breast muscle from broilers exposed to chronic heat stress. Poult Sci. 2018;97:3358–68.30137545 10.3382/ps/pey176
44. Fraser AF, Broom DM. 1990. Farm Animal Behavior and welfare. 3rd edition Thomson Litho. Ltd.
45. -Alaa M Abdel Razek H Tony A Bawish MA The effect of Guanidinoacetic Acid Supplementation on Behavior and Welfare of broiler chickens reared at two stocking densities J Appl Veterinary Sci 2022 7 3 41 9
Alaa M, Abdel Razek H, Tony A, Bawish MA. The effect of Guanidinoacetic Acid Supplementation on Behavior and Welfare of broiler chickens reared at two stocking densities. J Appl Veterinary Sci. 2022;7(3):41–9.
46. Dacie. S., I. V. and S. M. lewis (1991): Practical haematology (VII Edn).
47. -Stoskopf MK Fish medicine 1993 London W.B. Sainders Company
Stoskopf MK. Fish medicine. London: W.B. Sainders Company; 1993.
48. -Shaw AF A direct method for counting the leucocytes, thrombocytes and erythrocytes of birds blood J Pathol Bacteriol 1930 33 833 5 10.1002/path.1700330326
Shaw AF. A direct method for counting the leucocytes, thrombocytes and erythrocytes of birds blood. J Pathol Bacteriol. 1930;33:833–5.10.1002/path.1700330326
49. -Campbell TW Avian hematology and cytology 1988 Ames, IA Iowa State University
Campbell TW. Avian hematology and cytology. Ames, IA: Iowa State University; 1988.
50. -Gross WB Siegel HS Evaluation of the heterophil/lymphocyte ratio as a measure of stress in chickens Avian Dis 1983 27 972 9 10.2307/1590198 6360120
Gross WB, Siegel HS. Evaluation of the heterophil/lymphocyte ratio as a measure of stress in chickens. Avian Dis. 1983;27:972–9.6360120 10.2307/1590198
51. -Hussien A Ismael E Bawish BM Kamel S Ismail EY El Bendari EK Fahmy KNED Response of Broiler Chickens to the Dietary fortification of bile acid J Adv Veterinary Res 2022 12 5 582 7
Hussien A, Ismael E, Bawish BM, Kamel S, Ismail EY, El Bendari EK, Fahmy KNED. Response of Broiler Chickens to the Dietary fortification of bile acid. J Adv Veterinary Res. 2022;12(5):582–7.
52. -Lopez- virella MF Clin Chem 1977 23 882 10.1093/clinchem/23.5.882 192488
Lopez- virella MF, et al. Clin Chem. 1977;23:882.192488 10.1093/clinchem/23.5.882
53. -Richmond W Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic assay of total cholesterol in serum Clin Chem 1973 19 12 1350 6 10.1093/clinchem/19.12.1350 4757363
Richmond W. Preparation and properties of a cholesterol oxidase from Nocardia sp. and its application to the enzymatic assay of total cholesterol in serum. Clin Chem. 1973;19(12):1350–6.4757363 10.1093/clinchem/19.12.1350
54. -Tietz NW Clinical guide to Laboratory tests 1995 third Co., Philadelphia W.B. Saunders
Tietz NW. Clinical guide to Laboratory tests. third ed. Co., Philadelphia: W.B. Saunders; 1995.
55. -Friedewald WT Levy RI Fredrickson DS Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge Clin Chem 1972 18 6 499 502 10.1093/clinchem/18.6.499 4337382
Friedewald WT, Levy RI, Fredrickson DS. Estimation of the concentration of low-density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem. 1972;18(6):499–502.4337382 10.1093/clinchem/18.6.499
56. Tietz NW. Clinical Guide to laboratory Tests. 2nd ed. Philadelphia: WB. Saunders. 1990. p. 566.
57. Tietz NW. Fundamentals of Clinical Chemistry. 2nd ed. 1994; 692p.
58. Coles EH. Veterinary clinical pathology (no. Ed. 2). WB Saunders; 1974.
59. -Beutler E Duron O Kelly MB J. Lab clin Med 1963 61 882
Beutler E, Duron O, Kelly MB. J. Lab clin. Med. 1963;61:882.
60. -Koracevic D Koracevic G J Clin Pathol 2001 54 356 61 10.1136/jcp.54.5.356 11328833
Koracevic D, Koracevic G, et al. J Clin Pathol. 2001;54:356–61.11328833 10.1136/jcp.54.5.356
61. -Ohkawa H Ohishi W Yagi K Anal Biochem 1979 95 351 10.1016/0003-2697(79)90738-3 36810
Ohkawa H, Ohishi W, Yagi K. Anal Biochem. 1979;95:351.36810 10.1016/0003-2697(79)90738-3
62. -Abdelfatah SH Yassin AM Khattab MS Abdel-Razek AS Saad AH Spirulina platensis as a growth booster for broiler; insights into their nutritional, molecular, immunohistopathological, and microbiota modulating effects BMC Vet Res 2024 20 1 11 10.1186/s12917-023-03858-z 38183085
Abdelfatah SH, Yassin AM, Khattab MS, Abdel-Razek AS, Saad AH. Spirulina platensis as a growth booster for broiler; insights into their nutritional, molecular, immunohistopathological, and microbiota modulating effects. BMC Vet Res. 2024;20(1):11.38183085 10.1186/s12917-023-03858-z
63. -Schmittgen TD Livak KJ Analyzing real-time PCR data by the comparative CT method Nat Protoc 2008 3 6 1101 8 10.1038/nprot.2008.73 18546601
Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative CT method. Nat Protoc. 2008;3(6):1101–8.18546601 10.1038/nprot.2008.73
64. -Guo FC Kwakkel RP Soede J Williams BA Verstegen MW Effect of a Chinese herb medicine formulation, as an alternative for antibiotics, on performance of broilers Br Poult Sci 2004 45 6 793 7 10.1080/00071660400012741 15697019
Guo FC, Kwakkel RP, Soede J, Williams BA, Verstegen MW. Effect of a Chinese herb medicine formulation, as an alternative for antibiotics, on performance of broilers. Br Poult Sci. 2004;45(6):793–7.15697019 10.1080/00071660400012741
65. -Flees JJ Ganguly B Dridi S Phytogenic feed additives improve broiler feed efficiency via modulation of intermediary lipid and protein metabolism–related signaling pathways Poult Sci 2021 100 3 100963 10.1016/j.psj.2020.12.060 33652544
Flees JJ, Ganguly B, Dridi S. Phytogenic feed additives improve broiler feed efficiency via modulation of intermediary lipid and protein metabolism–related signaling pathways. Poult Sci. 2021;100(3):100963.33652544 10.1016/j.psj.2020.12.060
66. -Kumar S Singh B Bajpai V Andrographis paniculata (burm. f.) nees: traditional uses, phytochemistry, pharmacological properties and quality control/quality assurance J Ethnopharmacol 2021 275 114054 10.1016/j.jep.2021.114054 33831465
Kumar S, Singh B, Bajpai V. Andrographis paniculata (burm. f.) nees: traditional uses, phytochemistry, pharmacological properties and quality control/quality assurance. J Ethnopharmacol. 2021;275:114054.33831465 10.1016/j.jep.2021.114054
67. -Loureiro Damasceno JP Silva da Rosa H Silva de Araújo L Jacometti Cardoso Furtado NA Andrographis paniculata formulations: impact on diterpene lactone oral bioavailability Eur J Drug Metab Pharmacokinet 2022 47 1 19 30 10.1007/s13318-021-00736-7 34816382
Loureiro Damasceno JP, Silva da Rosa H, Silva de Araújo L, Jacometti Cardoso Furtado NA. Andrographis paniculata formulations: impact on diterpene lactone oral bioavailability. Eur J Drug Metab Pharmacokinet. 2022;47(1):19–30.34816382 10.1007/s13318-021-00736-7
68. -Intharuksa A Arunotayanun W Yooin W Sirisa-Ard P A comprehensive review of Andrographis paniculata (burm. f.) Nees and its constituents as potential lead compounds for COVID-19 drug discovery Molecules 2022 27 14 4479 10.3390/molecules27144479 35889352
Intharuksa A, Arunotayanun W, Yooin W, Sirisa-Ard P. A comprehensive review of Andrographis paniculata (burm. f.) Nees and its constituents as potential lead compounds for COVID-19 drug discovery. Molecules. 2022;27(14):4479.35889352 10.3390/molecules27144479
69. -Chau TP Devanesan S Ayub R Perumal K Identification and characterization of major bioactive compounds from Andrographis paniculata (burm. f.) extracts showed multi-biomedical applications Environ Res 2024 242 117763 10.1016/j.envres.2023.117763 38029828
Chau TP, Devanesan S, Ayub R, Perumal K. Identification and characterization of major bioactive compounds from Andrographis paniculata (burm. f.) extracts showed multi-biomedical applications. Environ Res. 2024;242:117763.38029828 10.1016/j.envres.2023.117763
70. -Sobeh M Mahmoud MF Hasan RA Abdelfattah MA Osman S Rashid HO El-Shazly AM Wink M Chemical composition, antioxidant and hepatoprotective activities of methanol extracts from leaves of Terminalia bellirica and Terminalia sericea (Combretaceae) PeerJ 2019 7 e6322 10.7717/peerj.6322 30834179
Sobeh M, Mahmoud MF, Hasan RA, Abdelfattah MA, Osman S, Rashid HO, El-Shazly AM, Wink M. Chemical composition, antioxidant and hepatoprotective activities of methanol extracts from leaves of Terminalia bellirica and Terminalia sericea (Combretaceae). PeerJ. 2019;7:e6322.30834179 10.7717/peerj.6322
71. -Chatterjee J Hoda MU Das S In vitro screening of Triphala, its compositions and identification of a few phenolic compounds to determine their antioxidant, anti-malarial and hepatoprotective properties: a GC/MS-assisted metabolomics study Chem Pap 2024 78 409 33 10.1007/s11696-023-03098-3
Chatterjee J, Hoda MU, Das S. In vitro screening of Triphala, its compositions and identification of a few phenolic compounds to determine their antioxidant, anti-malarial and hepatoprotective properties: a GC/MS-assisted metabolomics study. Chem Pap. 2024;78:409–33. 10.1007/s11696-023-03098-3.10.1007/s11696-023-03098-3
72. Mancinelli AC, Baldi G, Soglia F, Mattioli S, Sirri F, Petracci M, Castellini C, Zampiga M. Impact of chronic heat stress on behavior, oxidative status and meat quality traits of fast-growing broiler chickens. Front Physiol. 2023;14:1242094.
73. -Nielsen BL Effects of ambient temperature and early open-field response on the behavior, feed intake and growth of fast- and slow- growing broiler strains Animal 2012 6 1460 8 10.1017/S1751731112000353 23031519
Nielsen BL. Effects of ambient temperature and early open-field response on the behavior, feed intake and growth of fast- and slow- growing broiler strains. Animal. 2012;6:1460–8.23031519 10.1017/S1751731112000353
74. -Vandana GD Sejian V Lees AM Pragna P Silpa MV Maloney SK Heat stress and poultry production: impact and amelioration Int J Biometeorol 2021 65 163 79 10.1007/s00484-020-02023-7 33025116
Vandana GD, Sejian V, Lees AM, Pragna P, Silpa MV, Maloney SK. Heat stress and poultry production: impact and amelioration. Int J Biometeorol. 2021;65:163–79.33025116 10.1007/s00484-020-02023-7
75. -Syafwan S Wermink GJD Kwakkel RP Verstegen MWA Dietary self-selection by broilers at normal and high temperature changes feed intake behavior, nutrient intake, and performance Poult Sci 2012 91 537 49 10.3382/ps.2011-01559 22334728
Syafwan S, Wermink GJD, Kwakkel RP, Verstegen MWA. Dietary self-selection by broilers at normal and high temperature changes feed intake behavior, nutrient intake, and performance. Poult Sci. 2012;91:537–49.22334728 10.3382/ps.2011-01559
76. Mahmoud UT. (Master thesis). Studies on some behavioral patterns of quails with special reference to the effect of heat stress on behaviors, performance and some blood parameters. Faculty of Veterinary Medicine, Assiut University, Egypt. J Adv Vet Res. 2010;2:303–6.
77. -Mahmoud UT Abdel-Rahman MAM Darwish MHA Applegate TJ Cheng H-w Behavioral changes and feathering score in heat stressed broiler chickens fed diets containing different levels of propolis Appl Anim Behav Sci 2015 166 98 105 10.1016/j.applanim.2015.03.003
Mahmoud UT, Abdel-Rahman MAM, Darwish MHA, Applegate TJ, Cheng H-w. Behavioral changes and feathering score in heat stressed broiler chickens fed diets containing different levels of propolis. Appl Anim Behav Sci. 2015;166:98–105. 10.1016/j.applanim.2015.03.003.10.1016/j.applanim.2015.03.003
78. -Margret IUJ Nnaemeka US Identification, Quantification of Phytochemicals and Elemental Analysis from Ethanolic Leaf Extract of Andrographis paniculata South Asian Res J Nat Prod 2023 6 3 144 56
Margret IUJ, Nnaemeka US. Identification, Quantification of Phytochemicals and Elemental Analysis from Ethanolic Leaf Extract of Andrographis paniculata. South Asian Res J Nat Prod. 2023;6(3):144–56.
79. -Mack LA Felver-Gant JN Dennis RL Cheng HW Genetic var- iations alter production and behavioral responses following heat stress in 2 strains of laying hens Poult Sci 2013 92 2 285 94 10.3382/ps.2012-02589 23300291
Mack LA, Felver-Gant JN, Dennis RL, Cheng HW. Genetic var- iations alter production and behavioral responses following heat stress in 2 strains of laying hens. Poult Sci. 2013;92(2):285–94. 10.3382/ps.2012-02589.23300291 10.3382/ps.2012-02589
80. -Singh V Medicinal plants and bone healing Natl J Maxillofac Surg 2017 8 1 4 11 10.4103/0975-5950.208972 28761270
Singh V. Medicinal plants and bone healing. Natl J Maxillofac Surg. 2017;8(1):4–11.28761270 10.4103/0975-5950.208972
81. Song Q, Zhou D, Du J, Li T, He X, Wang J, Chao A, Yu B, Shan C. Andrographis paniculata ameliorates estrogen deficiency-related osteoporosis by directing bone marrow mesenchymal stem cell fate. Ann Transl Med. 2023;11(2).
82. -Aggarwal S Sharma NG Anil KJ Studies on variation in elemental composition in wild and cultivated forms of Andrographis paniculata Int J Chem Pharm Sci 2014 5 75 8
Aggarwal S, Sharma NG, Anil KJ. Studies on variation in elemental composition in wild and cultivated forms of Andrographis paniculata. Int J Chem Pharm Sci. 2014;5:75–8.
83. Iraqi -El Abdelgawad KG Ibrahim EM Sawe E Effect of Gingko Biloba, dry peppermint and vitamin C as anti-stress on broiler welfare during summer heat stress Glob Vet 2013 10 7 770 8
Iraqi -El, Abdelgawad KG, Ibrahim EM, H. M., Sawe E, A. E. Effect of Gingko Biloba, dry peppermint and vitamin C as anti-stress on broiler welfare during summer heat stress. Glob Vet. 2013;10(7):770–8.
84. Liu GH, Zhu HB, Ma TH, Yan ZY, Zhang YY, Geng YY, Zhu Y, Shi YX. Effect of chronic cyclic heat stress on the intestinal morphology, oxidative status and cecal bacterial communities in broilers. J Therm Biol 2020, 91.
85. -Liu L Ren M Ren K Jin Y Yan M Heat stress impacts on broiler performance: a systematic review and meta-analysis Poult Sci 2020 99 11 6205 11 10.1016/j.psj.2020.08.019 33142538
Liu L, Ren M, Ren K, Jin Y, Yan M. Heat stress impacts on broiler performance: a systematic review and meta-analysis. Poult Sci. 2020;99(11):6205–11.33142538 10.1016/j.psj.2020.08.019
86. -Kathirvelan C Purushotaman MR Janani SR Banupriya S Efficacy of herbal lysine supplementation on broiler performance Indian J Anim 2016 33 481 517 10.5958/2231-6744.2016.00078.5
Kathirvelan C, Purushotaman MR, Janani SR, Banupriya S. Efficacy of herbal lysine supplementation on broiler performance. Indian J Anim. 2016;33:481–517. 10.5958/2231-6744.2016.00078.5.10.5958/2231-6744.2016.00078.5
87. -Wiono AA Wijayanti MEN Primacitra DY Purnawarman T Andriyanto, Mustika AA Fadholly A Impact of phytoceetm supplementation on heat stress condition in broiler chicken Adv Anim Vet Sci 2023 11 7 1152 8 10.17582/journal.aavs/2023/11.7.1152.115
Wiono AA, Wijayanti MEN, Primacitra DY, Purnawarman T, Andriyanto, Mustika AA, Fadholly A. Impact of phytoceetm supplementation on heat stress condition in broiler chicken. Adv Anim Vet Sci. 2023;11(7):1152–8. 10.17582/journal.aavs/2023/11.7.1152.115.10.17582/journal.aavs/2023/11.7.1152.115
88. -Fayed RH Razek AH Baghwish BM Welfare Assessment of broiler chickens subjected to feed restriction and Fed enzyme supplemented Diet J Am Sci 2012 8 12 36 42
Fayed RH, Razek AH, Baghwish BM. Welfare Assessment of broiler chickens subjected to feed restriction and Fed enzyme supplemented Diet. J Am Sci. 2012;8(12):36–42.
89. -Varricchio L Geer EB Martelli F Mazzarini M Funnell A Bieker JJ Papayannopoulou T Migliaccio AR Hypercortisolemic Cushing’s patients possess a distinct class of hematopoietic progenitor cells leading to erythrocytosis Haematologica 2022 108 1053 67 10.3324/haematol.2021.280542
Varricchio L, Geer EB, Martelli F, Mazzarini M, Funnell A, Bieker JJ, Papayannopoulou T, Migliaccio AR. Hypercortisolemic Cushing’s patients possess a distinct class of hematopoietic progenitor cells leading to erythrocytosis. Haematologica. 2022;108:1053–67.10.3324/haematol.2021.280542
90. -Honda Y Kondo M McGregor G Kim H Guo YL Hijioka Y Yoshikawa M Oka K Takano S Hales S Kovats RS Heat-related mortality risk model for climate change impact projection Environ Health Prev Med 2014 19 1 56 63 10.1007/s12199-013-0354-6 23928946
Honda Y, Kondo M, McGregor G, Kim H, Guo YL, Hijioka Y, Yoshikawa M, Oka K, Takano S, Hales S, Kovats RS. Heat-related mortality risk model for climate change impact projection. Environ Health Prev Med. 2014;19(1):56–63. 10.1007/s12199-013-0354-6.23928946 10.1007/s12199-013-0354-6
91. -Thakur AK Soni UK Rai G Protective effects of Andrographis paniculata extract and pure andrographolide against chronic stress-triggered pathologies in rats Cell Mol Neurobiol 2014 34 1111 21 10.1007/s10571-014-0086-1 25035059
Thakur AK, Soni UK, Rai G, et al. Protective effects of Andrographis paniculata extract and pure andrographolide against chronic stress-triggered pathologies in rats. Cell Mol Neurobiol. 2014;34:1111–21. 10.1007/s10571-014-0086-1.25035059 10.1007/s10571-014-0086-1
92. -Yadavalli C Garlapati PK Raghavan AK Gallic acid from Terminalia Bellirica Fruit exerts antidepressant-like activity Rev Bras Farmacogn 2020 30 357 66 10.1007/s43450-020-00020-w
Yadavalli C, Garlapati PK, Raghavan AK. Gallic acid from Terminalia Bellirica Fruit exerts antidepressant-like activity. Rev Bras Farmacogn. 2020;30:357–66. 10.1007/s43450-020-00020-w.10.1007/s43450-020-00020-w
93. -Quinteiro-Filho WM Ribeiro A Ferraz-de-Paula V Pinheiro ML Sakai M Sá LRMD Ferreira AJP Palermo-Neto J Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens Poult Sci 2010 89 9 1905 14 10.3382/ps.2010-00812 20709975
Quinteiro-Filho WM, Ribeiro A, Ferraz-de-Paula V, Pinheiro ML, Sakai M, Sá LRMD, Ferreira AJP, Palermo-Neto J. Heat stress impairs performance parameters, induces intestinal injury, and decreases macrophage activity in broiler chickens. Poult Sci. 2010;89(9):1905–14.20709975 10.3382/ps.2010-00812
94. -Zaboli G Huang X Feng X Ahn DU How can heat stress affect chicken meat quality? A review Poult Sci 2019 98 1551 6 10.3382/ps/pey399 30169735
Zaboli G, Huang X, Feng X, Ahn DU. How can heat stress affect chicken meat quality? A review. Poult Sci. 2019;98:1551–6. 10.3382/ps/pey399.30169735 10.3382/ps/pey399
95. -Scanes CG Biology of stress in poultry with emphasis on glucocorticoids and the heterophil to lymphocyte ratio Poult Sci 2016 95 2208 15 10.3382/ps/pew137 27252367
Scanes CG. Biology of stress in poultry with emphasis on glucocorticoids and the heterophil to lymphocyte ratio. Poult Sci. 2016;95:2208–15.27252367 10.3382/ps/pew137
96. -Salami SA Majoka MA Saha S Garber A Gabarrou JF Efficacy of dietary antioxidants on broiler oxidative stress, performance and meat quality: Science and market Avian Biol Res 2015 8 65 78 10.3184/175815515X14291701859483
Salami SA, Majoka MA, Saha S, Garber A, Gabarrou JF. Efficacy of dietary antioxidants on broiler oxidative stress, performance and meat quality: Science and market. Avian Biol Res. 2015;8:65–78. 10.3184/175815515X14291701859483.10.3184/175815515X14291701859483
97. -Al Batran R Al-Bayaty F Al-Obaidi MM Abdulla MA Acute toxicity and the effect of andrographolide on porphyromonas gingivalis-induced hyperlipidemia in rats Biomed Res Int 2013 2013 1 594012 23844365
Al Batran R, Al-Bayaty F, Al-Obaidi MM, Abdulla MA. Acute toxicity and the effect of andrographolide on porphyromonas gingivalis-induced hyperlipidemia in rats. Biomed Res Int. 2013;2013(1):594012.23844365
98. -Yang T Shi HX Wang ZT Wang CH Hypolipidemic effects of andrographolide and neoandrographolide in mice and rats Phytother Res 2013 27 4 618 23 10.1002/ptr.4771 22744979
Yang T, Shi HX, Wang ZT, Wang CH. Hypolipidemic effects of andrographolide and neoandrographolide in mice and rats. Phytother Res. 2013;27(4):618–23.22744979 10.1002/ptr.4771
99. -Latha RC Daisy P Insulin-secretagogue, antihyperlipidemic and other protective effects of gallic acid isolated from Terminalia Bellerica Roxb. In streptozotocin-induced diabetic rats Chemico-Biol Interact 2011 189 1–2 112 8 10.1016/j.cbi.2010.11.005
Latha RC, Daisy P. Insulin-secretagogue, antihyperlipidemic and other protective effects of gallic acid isolated from Terminalia Bellerica Roxb. In streptozotocin-induced diabetic rats. Chemico-Biol Interact. 2011;189(1–2):112–8.10.1016/j.cbi.2010.11.005
100. -Yang K Jian S Guo D Wen C Xin Z Zhang L Kuang T Wen J Yin Y Deng B Fecal microbiota and metabolomics revealed the effect of long-term consumption of gallic acid on canine lipid metabolism and gut health Food Chemistry: X 2022 15 100377 36211749
Yang K, Jian S, Guo D, Wen C, Xin Z, Zhang L, Kuang T, Wen J, Yin Y, Deng B. Fecal microbiota and metabolomics revealed the effect of long-term consumption of gallic acid on canine lipid metabolism and gut health. Food Chemistry: X. 2022;15:100377.36211749
101. -Zhang J Zhang W Yang L Zhao W Liu Z Wang E Wang J Phytochemical gallic acid alleviates nonalcoholic fatty liver disease via AMPK-ACC-PPARa axis through dual regulation of lipid metabolism and mitochondrial function Phytomedicine 2023 109 154589 10.1016/j.phymed.2022.154589 36610145
Zhang J, Zhang W, Yang L, Zhao W, Liu Z, Wang E, Wang J. Phytochemical gallic acid alleviates nonalcoholic fatty liver disease via AMPK-ACC-PPARa axis through dual regulation of lipid metabolism and mitochondrial function. Phytomedicine. 2023;109:154589.36610145 10.1016/j.phymed.2022.154589
102. -Zhang R Chu K Zhao N Wu J Ma L Zhu C Chen X Wei G Liao M Corilagin alleviates nonalcoholic fatty liver disease in high-fat diet-induced C57BL/6 mice by ameliorating oxidative stress and restoring autophagic flux Front Pharmacol 2020 10 1693 10.3389/fphar.2019.01693 32116684
Zhang R, Chu K, Zhao N, Wu J, Ma L, Zhu C, Chen X, Wei G, Liao M. Corilagin alleviates nonalcoholic fatty liver disease in high-fat diet-induced C57BL/6 mice by ameliorating oxidative stress and restoring autophagic flux. Front Pharmacol. 2020;10:1693.32116684 10.3389/fphar.2019.01693
103. -Jiang Y Zhao L Ma J Yang Y Zhang B Xu J Dhondrup R Wong TW Zhang D Preventive mechanisms of Chinese tibetan medicine triphala against nonalcoholic fatty liver disease Phytomedicine 2024 123 155229 10.1016/j.phymed.2023.155229 38006804
Jiang Y, Zhao L, Ma J, Yang Y, Zhang B, Xu J, Dhondrup R, Wong TW, Zhang D. Preventive mechanisms of Chinese tibetan medicine triphala against nonalcoholic fatty liver disease. Phytomedicine. 2024;123:155229.38006804 10.1016/j.phymed.2023.155229
104. -Zhang B Luo X Han C Liu J Zhang L Qi J Gu J Tan R Gong P Terminalia bellirica ethanol extract ameliorates nonalcoholic fatty liver disease in mice by amending the intestinal microbiota and faecal metabolites J Ethnopharmacol 2023 305 116082 10.1016/j.jep.2022.116082 36581163
Zhang B, Luo X, Han C, Liu J, Zhang L, Qi J, Gu J, Tan R, Gong P. Terminalia bellirica ethanol extract ameliorates nonalcoholic fatty liver disease in mice by amending the intestinal microbiota and faecal metabolites. J Ethnopharmacol. 2023;305:116082.36581163 10.1016/j.jep.2022.116082
105. -Alipanah-Moghadam R Mehri A Manafi F Malekzadeh V Nemati A Aghamohammadi V Mazani M Cain CC Mohammadzadeh-Vardin M Andrographolide, a novel inducer of apelin gene expression J Ethnopharmacol 2021 280 114487 10.1016/j.jep.2021.114487 34352330
Alipanah-Moghadam R, Mehri A, Manafi F, Malekzadeh V, Nemati A, Aghamohammadi V, Mazani M, Cain CC, Mohammadzadeh-Vardin M. Andrographolide, a novel inducer of apelin gene expression. J Ethnopharmacol. 2021;280:114487.34352330 10.1016/j.jep.2021.114487
106. -Liao J Yang Z Yao Y Yang X Shen J Zhao P Andrographolide promotes uptake of glucose and GLUT4 transport through the PKC pathway in L6 cells Pharmaceuticals 2022 15 11 1346 10.3390/ph15111346 36355518
Liao J, Yang Z, Yao Y, Yang X, Shen J, Zhao P. Andrographolide promotes uptake of glucose and GLUT4 transport through the PKC pathway in L6 cells. Pharmaceuticals. 2022;15(11):1346.36355518 10.3390/ph15111346
107. -Singh A Bajpai V Kumar S Kumar B Srivastava M Rameshkumar KB Comparative profiling of phenolic compounds from different plant parts of six Terminalia species by liquid chromatography–tandem mass spectrometry with chemometric analysis Ind Crops Prod 2016 87 236 46 10.1016/j.indcrop.2016.04.048
Singh A, Bajpai V, Kumar S, Kumar B, Srivastava M, Rameshkumar KB. Comparative profiling of phenolic compounds from different plant parts of six Terminalia species by liquid chromatography–tandem mass spectrometry with chemometric analysis. Ind Crops Prod. 2016;87:236–46.10.1016/j.indcrop.2016.04.048
108. -Gupta A Kumar R Pandey AK Antioxidant and antidiabetic activities of Terminalia bellirica fruit in alloxan induced diabetic rats South Afr J Bot 2020 130 308 15 10.1016/j.sajb.2019.12.010
Gupta A, Kumar R, Pandey AK. Antioxidant and antidiabetic activities of Terminalia bellirica fruit in alloxan induced diabetic rats. South Afr J Bot. 2020;130:308–15.10.1016/j.sajb.2019.12.010
109. Agrawal OD, Kulkarni YA. Aqueous extract of Terminalia bellirica Fruits improves insulin sensitivity, controls hyperglycaemia and improves SIRT1 expression in high-fat Diet and Streptozotocin-induced type 2 diabetes in rats. Pharmacognosy Magazine. 2024 Apr;29:09731296241238852.
110. Algothmi KM Mahasneh ZM Abdelnour SA Khalaf QA Noreldin AE Barkat RA Khalifa NE Khafaga AF Tellez-Isaias G Alqhtani AH Swelum AA Protective impacts of mitochondria enhancers against thermal stress in poultry Poult Sci 2024 103 1 103218 10.1016/j.psj.2023.103218 37980733
Algothmi KM, Mahasneh ZM, Abdelnour SA, Khalaf QA, Noreldin AE, Barkat RA, Khalifa NE, Khafaga AF, Tellez-Isaias G, Alqhtani AH, Swelum AA. Protective impacts of mitochondria enhancers against thermal stress in poultry. Poult Sci. 2024;103(1):103218.37980733 10.1016/j.psj.2023.103218
111. -Moustafa ES Alsanie WF Gaber A Kamel NN Alaqil AA Abbas AO Blue-green algae (Spirulina platensis) alleviates the negative impact of heat stress on broiler production performance and redox status Animals 2021 11 5 1243 10.3390/ani11051243 33926055
Moustafa ES, Alsanie WF, Gaber A, Kamel NN, Alaqil AA, Abbas AO. Blue-green algae (Spirulina platensis) alleviates the negative impact of heat stress on broiler production performance and redox status. Animals. 2021;11(5):1243.33926055 10.3390/ani11051243
112. -Omotosho OO Fowowe O Abiola JO Oyagbemi AA Omobowale TO High environmental temperature induces oxidative stress, reduced Sow Productivity and increased piglet mortality J Appl Veterinary Sci 2024 9 2 42 54
Omotosho OO, Fowowe O, Abiola JO, Oyagbemi AA, Omobowale TO. High environmental temperature induces oxidative stress, reduced Sow Productivity and increased piglet mortality. J Appl Veterinary Sci. 2024;9(2):42–54.
113. Saracila M Panaite TD Papuc CP Criste RD Heat stress in broiler chickens and the effect of dietary polyphenols, with special reference to willow (Salix spp.) bark supplements—A review Antioxidants 2021 10 5 686 10.3390/antiox10050686 33925609
Saracila M, Panaite TD, Papuc CP, Criste RD. Heat stress in broiler chickens and the effect of dietary polyphenols, with special reference to willow (Salix spp.) bark supplements—A review. Antioxidants. 2021;10(5):686.33925609 10.3390/antiox10050686
114. -Krithika R Verma RJ Shrivastav PS Antioxidative and cytoprotective effects of andrographolide against CCl4-induced hepatotoxicity in HepG2 cells Hum Exp Toxicol 2013 32 5 530 43 10.1177/0960327112459530 23023025
Krithika R, Verma RJ, Shrivastav PS. Antioxidative and cytoprotective effects of andrographolide against CCl4-induced hepatotoxicity in HepG2 cells. Hum Exp Toxicol. 2013;32(5):530–43.23023025 10.1177/0960327112459530
115. -Sulaiman I Tan K Mohtarrudin N Lim JC Stanslas J Andrographolide prevented toluene diisocyanate-induced occupational asthma and aberrant airway E-cadherin distribution via p38 MAPK-dependent Nrf2 induction Pulm Pharmacol Ther 2018 53 39 51 10.1016/j.pupt.2018.09.008 30244166
Sulaiman I, Tan K, Mohtarrudin N, Lim JC, Stanslas J. Andrographolide prevented toluene diisocyanate-induced occupational asthma and aberrant airway E-cadherin distribution via p38 MAPK-dependent Nrf2 induction. Pulm Pharmacol Ther. 2018;53:39–51.30244166 10.1016/j.pupt.2018.09.008
116. -Geng J Liu W Xiong Y Ding H Jiang C Yang X Li X Elgehama A Sun Y Xu Q Guo W Andrographolide sulfonate improves Alzheimer-associated phenotypes and mitochondrial dysfunction in APP/PS1 transgenic mice Biomed Pharmacother 2018 97 1032 9 10.1016/j.biopha.2017.11.039 29136781
Geng J, Liu W, Xiong Y, Ding H, Jiang C, Yang X, Li X, Elgehama A, Sun Y, Xu Q, Guo W. Andrographolide sulfonate improves Alzheimer-associated phenotypes and mitochondrial dysfunction in APP/PS1 transgenic mice. Biomed Pharmacother. 2018;97:1032–9.29136781 10.1016/j.biopha.2017.11.039
117. -Dharmaratne MP Manoraj A Thevanesam V Ekanayake A Kumar NS Liyanapathirana V Abeyratne E Bandara BR Terminalia bellirica fruit extracts: in-vitro antibacterial activity against selected multidrug-resistant bacteria, radical scavenging activity and cytotoxicity study on BHK-21 cells BMC Complement Altern Med 2018 18 1 2 10.1186/s12906-018-2382-7 29295712
Dharmaratne MP, Manoraj A, Thevanesam V, Ekanayake A, Kumar NS, Liyanapathirana V, Abeyratne E, Bandara BR. Terminalia bellirica fruit extracts: in-vitro antibacterial activity against selected multidrug-resistant bacteria, radical scavenging activity and cytotoxicity study on BHK-21 cells. BMC Complement Altern Med. 2018;18:1–2.29295712 10.1186/s12906-018-2382-7
118. -Middha SK Goyal AK Lokesh P Yardi V Mojamdar L Keni DS Babu D Usha T Toxicological evaluation of Emblica officinalis fruit extract and its anti-inflammatory and free radical scavenging properties Pharmacognosy Magazine 2015 11 Suppl 3 S427 26929577
Middha SK, Goyal AK, Lokesh P, Yardi V, Mojamdar L, Keni DS, Babu D, Usha T. Toxicological evaluation of Emblica officinalis fruit extract and its anti-inflammatory and free radical scavenging properties. Pharmacognosy Magazine. 2015;11(Suppl 3):S427.26929577
119. -Eshwarappa RS Ramachandra YL Subaramaihha SR Subbaiah SG Austin RS Dhananjaya BL In vivo toxicity studies on gall extracts of Terminalia chebula (Gaertn.) Retz.(combretaceae) Pharmacognosy Res 2016 8 3 199 10.4103/0974-8490.182914 27365989
Eshwarappa RS, Ramachandra YL, Subaramaihha SR, Subbaiah SG, Austin RS, Dhananjaya BL. In vivo toxicity studies on gall extracts of Terminalia chebula (Gaertn.) Retz.(combretaceae). Pharmacognosy Res. 2016;8(3):199.27365989 10.4103/0974-8490.182914
120. -Tanaka M Kishimoto Y Saita E Suzuki-Sugihara N Kamiya T Taguchi C Iida K Kondo K Terminalia bellirica extract inhibits low-density lipoprotein oxidation and macrophage inflammatory response in vitro Antioxidants 2016 5 2 20 10.3390/antiox5020020 27314393
Tanaka M, Kishimoto Y, Saita E, Suzuki-Sugihara N, Kamiya T, Taguchi C, Iida K, Kondo K. Terminalia bellirica extract inhibits low-density lipoprotein oxidation and macrophage inflammatory response in vitro. Antioxidants. 2016;5(2):20.27314393 10.3390/antiox5020020
121. -Tanaka M Kishimoto Y Sasaki M Sato A Kamiya T Kondo K Iida K Terminalia bellirica (Gaertn.) Roxb. Extract and gallic acid attenuate LPS-induced inflammation and oxidative stress via MAPK/NF‐κB and Akt/AMPK/Nrf2 pathways Oxidative Med Cell Longev 2018 2018 1 9364364 10.1155/2018/9364364
Tanaka M, Kishimoto Y, Sasaki M, Sato A, Kamiya T, Kondo K, Iida K. Terminalia bellirica (Gaertn.) Roxb. Extract and gallic acid attenuate LPS-induced inflammation and oxidative stress via MAPK/NF‐κB and Akt/AMPK/Nrf2 pathways. Oxidative Med Cell Longev. 2018;2018(1):9364364.10.1155/2018/9364364
122. -Long LN Kang BJ Jiang Q Chen JS Effects of dietary Lycium barbarum polysaccharides on growth performance, digestive enzyme activities, antioxidant status, and immunity of broiler chickens Poult Sci 2020 99 744 51 10.1016/j.psj.2019.10.043 32029159
Long LN, Kang BJ, Jiang Q, Chen JS. Effects of dietary Lycium barbarum polysaccharides on growth performance, digestive enzyme activities, antioxidant status, and immunity of broiler chickens. Poult Sci. 2020;99:744–51. 10.1016/j.psj.2019.10.043.32029159 10.1016/j.psj.2019.10.043
123. -Gupta A Kumar R Ganguly R Singh AK Rana HK Pandey AK Antioxidant, anti-inflammatory and hepatoprotective activities of Terminalia bellirica and its bioactive component ellagic acid against diclofenac induced oxidative stress and hepatotoxicity Toxicol Rep 2021 8 44 52 10.1016/j.toxrep.2020.12.010 33391996
Gupta A, Kumar R, Ganguly R, Singh AK, Rana HK, Pandey AK. Antioxidant, anti-inflammatory and hepatoprotective activities of Terminalia bellirica and its bioactive component ellagic acid against diclofenac induced oxidative stress and hepatotoxicity. Toxicol Rep. 2021;8:44–52.33391996 10.1016/j.toxrep.2020.12.010
124. -Gupta A Pandey AK Aceclofenac-induced hepatotoxicity: an ameliorative effect of Terminalia bellirica fruit and ellagic acid World J Hepatol 2020 12 11 949 10.4254/wjh.v12.i11.949 33312421
Gupta A, Pandey AK. Aceclofenac-induced hepatotoxicity: an ameliorative effect of Terminalia bellirica fruit and ellagic acid. World J Hepatol. 2020;12(11):949.33312421 10.4254/wjh.v12.i11.949
125. -Parthasarathy M Prince SE Methotrexate-induced intestine and nephrotoxicity attenuated by Andrographis paniculata via ameliorating oxidative stress, inflammation and apoptosis Adv Traditional Med 2024 24 2 553 67 10.1007/s13596-023-00720-3
Parthasarathy M, Prince SE. Methotrexate-induced intestine and nephrotoxicity attenuated by Andrographis paniculata via ameliorating oxidative stress, inflammation and apoptosis. Adv Traditional Med. 2024;24(2):553–67.10.1007/s13596-023-00720-3
126. -Pingali U Nutalapati C Koilagundla N Taduri G A randomized, double-blind, positive-controlled, prospective, dose-response clinical study to evaluate the efficacy and tolerability of an aqueous extract of Terminalia Bellerica in lowering uric acid and creatinine levels in chronic kidney disease subjects with hyperuricemia BMC Complement Med Ther 2020 20 1 5 10.1186/s12906-020-03071-7 32020859
Pingali U, Nutalapati C, Koilagundla N, Taduri G. A randomized, double-blind, positive-controlled, prospective, dose-response clinical study to evaluate the efficacy and tolerability of an aqueous extract of Terminalia Bellerica in lowering uric acid and creatinine levels in chronic kidney disease subjects with hyperuricemia. BMC Complement Med Ther. 2020;20:1–5.32020859 10.1186/s12906-020-03071-7
127. -Gu XH Hao Y Wang XL Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress Poult Sci 2012 91 4 790 9 10.3382/ps.2011-01628 22399716
Gu XH, Hao Y, Wang XL. Overexpression of heat shock protein 70 and its relationship to intestine under acute heat stress in broilers: 2. Intestinal oxidative stress. Poult Sci. 2012;91(4):790–9.22399716 10.3382/ps.2011-01628
128. -Siddiqui SH Kang D Park J Khan M Shim K Chronic heat stress regulates the relation between heat shock protein and immunity in broiler small intestine Sci Rep 2020 10 1 18872 10.1038/s41598-020-75885-x 33139769
Siddiqui SH, Kang D, Park J, Khan M, Shim K. Chronic heat stress regulates the relation between heat shock protein and immunity in broiler small intestine. Sci Rep. 2020;10(1):18872.33139769 10.1038/s41598-020-75885-x
129. -Roushdy EM Zaglool AW El-Tarabany MS Effects of chronic thermal stress on growth performance, carcass traits, antioxidant indices and the expression of HSP70, growth hormone and superoxide dismutase genes in two broiler strains J Therm Biol 2018 74 337 43 10.1016/j.jtherbio.2018.04.009 29801647
Roushdy EM, Zaglool AW, El-Tarabany MS. Effects of chronic thermal stress on growth performance, carcass traits, antioxidant indices and the expression of HSP70, growth hormone and superoxide dismutase genes in two broiler strains. J Therm Biol. 2018;74:337–43.29801647 10.1016/j.jtherbio.2018.04.009
130. -Varasteh S Braber S Akbari P Garssen J Fink-Gremmels J Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides PLoS ONE 2015 10 9 e0138975 10.1371/journal.pone.0138975 26402906
Varasteh S, Braber S, Akbari P, Garssen J, Fink-Gremmels J. Differences in susceptibility to heat stress along the chicken intestine and the protective effects of galacto-oligosaccharides. PLoS ONE. 2015;10(9):e0138975.26402906 10.1371/journal.pone.0138975
131. -Kang D Shim K Early heat exposure effect on the heat shock proteins in broilers under acute heat stress Poult Sci 2021 100 3 100964 10.1016/j.psj.2020.12.061 33652533
Kang D, Shim K. Early heat exposure effect on the heat shock proteins in broilers under acute heat stress. Poult Sci. 2021;100(3):100964.33652533 10.1016/j.psj.2020.12.061
132. -Greene ES Cauble R Kadhim H de Almeida Mallmann B Gu I Lee SO Orlowski S Dridi S Protective effects of the phytogenic feed additive comfort on growth performance via modulation of hypothalamic feeding-and drinking-related neuropeptides in cyclic heat-stressed broilers Domest Anim Endocrinol 2021 74 106487 10.1016/j.domaniend.2020.106487 32861191
Greene ES, Cauble R, Kadhim H, de Almeida Mallmann B, Gu I, Lee SO, Orlowski S, Dridi S. Protective effects of the phytogenic feed additive comfort on growth performance via modulation of hypothalamic feeding-and drinking-related neuropeptides in cyclic heat-stressed broilers. Domest Anim Endocrinol. 2021;74:106487.32861191 10.1016/j.domaniend.2020.106487
133. -Liu L Fu C Yan M Xie H Li S Yu Q He S He J Resveratrol modulates intestinal morphology and HSP70/90, NF-κB and EGF expression in the jejunal mucosa of black-boned chickens on exposure to circular heat stress Food Funct 2016 7 3 1329 38 10.1039/C5FO01338K 26843443
Liu L, Fu C, Yan M, Xie H, Li S, Yu Q, He S, He J. Resveratrol modulates intestinal morphology and HSP70/90, NF-κB and EGF expression in the jejunal mucosa of black-boned chickens on exposure to circular heat stress. Food Funct. 2016;7(3):1329–38.26843443 10.1039/C5FO01338K
134. Dutta N Ghosh S Nelson VK Sareng HR Majumder C Mandal SC Pal M Andrographolide upregulates protein quality control mechanisms in cell and mouse through upregulation of mTORC1 function Biochim et Biophys Acta (BBA)-General Subj 2021 1865 6 129885 10.1016/j.bbagen.2021.129885
Dutta N, Ghosh S, Nelson VK, Sareng HR, Majumder C, Mandal SC, Pal M. Andrographolide upregulates protein quality control mechanisms in cell and mouse through upregulation of mTORC1 function. Biochim et Biophys Acta (BBA)-General Subj. 2021;1865(6):129885.10.1016/j.bbagen.2021.129885
135. -Song Z Deng C Chen Q Zhao S Li P Wu T Hou Y Yi D Protective effects and mechanisms of ellagic acid on intestinal injury in piglets infected with porcine epidemic diarrhea virus Front Immunol 2024 15 1323866 10.3389/fimmu.2024.1323866 38322259
Song Z, Deng C, Chen Q, Zhao S, Li P, Wu T, Hou Y, Yi D. Protective effects and mechanisms of ellagic acid on intestinal injury in piglets infected with porcine epidemic diarrhea virus. Front Immunol. 2024;15:1323866.38322259 10.3389/fimmu.2024.1323866
136. -Bidanchi RM Lalrindika L Khushboo M Bhanushree B Dinata R Das M Nisa N Lalrinzuali S Manikandan B Saeed-Ahmed L Sanjeev S Antioxidative, anti-inflammatory and anti-apoptotic action of ellagic acid against lead acetate induced testicular and hepato-renal oxidative damages and pathophysiological changes in male long Evans rats Environ Pollut 2022 302 119048 10.1016/j.envpol.2022.119048 35219795
Bidanchi RM, Lalrindika L, Khushboo M, Bhanushree B, Dinata R, Das M, Nisa N, Lalrinzuali S, Manikandan B, Saeed-Ahmed L, Sanjeev S. Antioxidative, anti-inflammatory and anti-apoptotic action of ellagic acid against lead acetate induced testicular and hepato-renal oxidative damages and pathophysiological changes in male long Evans rats. Environ Pollut. 2022;302:119048.35219795 10.1016/j.envpol.2022.119048
137. -Caspary WF Physiology and pathophysiology of intestinal absorption Am J Clin Nutr 1992 55 1 S299 308 10.1093/ajcn/55.1.299s
Caspary WF. Physiology and pathophysiology of intestinal absorption. Am J Clin Nutr. 1992;55(1):S299–308.10.1093/ajcn/55.1.299s
138. -Storch J Corsico B The emerging functions and mechanisms of mammalian fatty acid–binding proteins Annu Rev Nutr 2008 28 73 95 10.1146/annurev.nutr.27.061406.093710 18435590
Storch J, Corsico B. The emerging functions and mechanisms of mammalian fatty acid–binding proteins. Annu Rev Nutr. 2008;28:73–95.18435590 10.1146/annurev.nutr.27.061406.093710
139. -Al-Zghoul MB Saleh KM Jaradat ZW Expression of digestive enzyme and intestinal transporter genes during chronic heat stress in the thermally manipulated broiler chicken Poult Sci 2019 98 9 4113 22 10.3382/ps/pez249 31065718
Al-Zghoul MB, Saleh KM, Jaradat ZW. Expression of digestive enzyme and intestinal transporter genes during chronic heat stress in the thermally manipulated broiler chicken. Poult Sci. 2019;98(9):4113–22.31065718 10.3382/ps/pez249
140. -Habashy WS Milfort MC Fuller AL Attia YA Rekaya R Aggrey SE Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens Int J Biometeorol 2017 61 2111 8 10.1007/s00484-017-1414-1 28799035
Habashy WS, Milfort MC, Fuller AL, Attia YA, Rekaya R, Aggrey SE. Effect of heat stress on protein utilization and nutrient transporters in meat-type chickens. Int J Biometeorol. 2017;61:2111–8.28799035 10.1007/s00484-017-1414-1
141. -Garriga C Hunter RR Amat C Planas JM Mitchell MA Moretó M Heat stress increases apical glucose transport in the chicken jejunum Am J Physiology-Regulatory Integr Comp Physiol 2006 290 1 R195 201 10.1152/ajpregu.00393.2005
Garriga C, Hunter RR, Amat C, Planas JM, Mitchell MA, Moretó M. Heat stress increases apical glucose transport in the chicken jejunum. Am J Physiology-Regulatory Integr Comp Physiol. 2006;290(1):R195–201.10.1152/ajpregu.00393.2005
142. -March DS Marchbank T Playford RJ Jones AW Thatcher R Davison G Intestinal fatty acid-binding protein and gut permeability responses to exercise Eur J Appl Physiol 2017 117 931 41 10.1007/s00421-017-3582-4 28290057
March DS, Marchbank T, Playford RJ, Jones AW, Thatcher R, Davison G. Intestinal fatty acid-binding protein and gut permeability responses to exercise. Eur J Appl Physiol. 2017;117:931–41.28290057 10.1007/s00421-017-3582-4
143. -Chen J Tellez G Richards JD Escobar J Identification of potential biomarkers for gut barrier failure in broiler chickens Front Veterinary Sci 2015 2 14 10.3389/fvets.2015.00014
Chen J, Tellez G, Richards JD, Escobar J. Identification of potential biomarkers for gut barrier failure in broiler chickens. Front Veterinary Sci. 2015;2:14. 10.3389/fvets.2015.00014.10.3389/fvets.2015.00014
144. -Shi Y Zhong L Liu Y Zhang J Lv Z Li Y Hu Y Effects of dietary andrographolide levels on growth performance, antioxidant capacity, intestinal immune function and microbioma of rice field eel (Monopterus albus) Animals 2020 10 10 1744 10.3390/ani10101744 32992929
Shi Y, Zhong L, Liu Y, Zhang J, Lv Z, Li Y, Hu Y. Effects of dietary andrographolide levels on growth performance, antioxidant capacity, intestinal immune function and microbioma of rice field eel (Monopterus albus). Animals. 2020;10(10):1744.32992929 10.3390/ani10101744
145. -Su H Mo J Ni J Ke H Bao T Xie J Xu Y Xie L Chen W Andrographolide exerts antihyperglycemic effect through strengthening intestinal barrier function and increasing microbial composition of Akkermansia muciniphila Oxidative Med Cell Longev 2020 2020 1 6538930
Su H, Mo J, Ni J, Ke H, Bao T, Xie J, Xu Y, Xie L, Chen W. Andrographolide exerts antihyperglycemic effect through strengthening intestinal barrier function and increasing microbial composition of Akkermansia muciniphila. Oxidative Med Cell Longev. 2020;2020(1):6538930.
146. -Li YY Cui Y Dong WR Liu TT Zhou G Chen YX Terminalia bellirica fruit extract alleviates DSS-induced ulcerative colitis by regulating gut microbiota, inflammatory mediators, and cytokines Molecules 2023 28 15 5783 10.3390/molecules28155783 37570753
Li YY, Cui Y, Dong WR, Liu TT, Zhou G, Chen YX. Terminalia bellirica fruit extract alleviates DSS-induced ulcerative colitis by regulating gut microbiota, inflammatory mediators, and cytokines. Molecules. 2023;28(15):5783.37570753 10.3390/molecules28155783
147. -Kong Q Shang Z Liu Y Fakhar-e-Alam Kulyar M Suo-Lang S Xu Y Tan Z Li J Liu S Preventive effect of Terminalia bellirica (Gaertn.) Roxb. Extract on mice infected with Salmonella Typhimurium Front Cell Infect Microbiol 2023 12 1054205 10.3389/fcimb.2022.1054205 36699727
Kong Q, Shang Z, Liu Y, Fakhar-e-Alam Kulyar M, Suo-Lang S, Xu Y, Tan Z, Li J, Liu S. Preventive effect of Terminalia bellirica (Gaertn.) Roxb. Extract on mice infected with Salmonella Typhimurium. Front Cell Infect Microbiol. 2023;12:1054205.36699727 10.3389/fcimb.2022.1054205
148. -Li Y Xie Z Gao T Li L Chen Y Xiao D Liu W Zou B Lu B Tian X Han B A holistic view of gallic acid-induced attenuation in colitis based on microbiome-metabolomics analysis Food Funct 2019 10 7 4046 61 10.1039/C9FO00213H 31225554
Li Y, Xie Z, Gao T, Li L, Chen Y, Xiao D, Liu W, Zou B, Lu B, Tian X, Han B. A holistic view of gallic acid-induced attenuation in colitis based on microbiome-metabolomics analysis. Food Funct. 2019;10(7):4046–61.31225554 10.1039/C9FO00213H
149. -Zhao L Mehmood A Soliman MM Iftikhar A Iftikhar M Aboelenin SM Wang C Protective effects of ellagic acid against alcoholic liver disease in mice Front Nutr 2021 8 744520 10.3389/fnut.2021.744520 34595202
Zhao L, Mehmood A, Soliman MM, Iftikhar A, Iftikhar M, Aboelenin SM, Wang C. Protective effects of ellagic acid against alcoholic liver disease in mice. Front Nutr. 2021;8:744520.34595202 10.3389/fnut.2021.744520
150. -Bamias G Arseneau KO Cominelli F Cytokines and mucosal immunity Curr Opin Gastroenterol 2014 30 6 547 10.1097/MOG.0000000000000118 25203451
Bamias G, Arseneau KO, Cominelli F. Cytokines and mucosal immunity. Curr Opin Gastroenterol. 2014;30(6):547.25203451 10.1097/MOG.0000000000000118
151. -Malago JJ Koninkx JF van Dijk JE The heat shock response and cytoprotection of the intestinal epithelium Cell Stress Chaperones 2002 7 2 191 10.1379/1466-1268(2002)007<0191:THSRAC>2.0.CO;2 12380687
Malago JJ, Koninkx JF, van Dijk JE. The heat shock response and cytoprotection of the intestinal epithelium. Cell Stress Chaperones. 2002;7(2):191.12380687 10.1379/1466-1268(2002)007<0191:THSRAC>2.0.CO;2
152. -Nemeth E Fajdiga S Malago J Koninkx J Tooten P Van Dijk J Inhibition of Salmonella-induced IL-8 synthesis and expression of Hsp70 in enterocyte-like Caco-2 cells after exposure to non-starter lactobacilli Int J Food Microbiol 2006 112 3 266 74 10.1016/j.ijfoodmicro.2006.09.002 17045688
Nemeth E, Fajdiga S, Malago J, Koninkx J, Tooten P, Van Dijk J. Inhibition of Salmonella-induced IL-8 synthesis and expression of Hsp70 in enterocyte-like Caco-2 cells after exposure to non-starter lactobacilli. Int J Food Microbiol. 2006;112(3):266–74.17045688 10.1016/j.ijfoodmicro.2006.09.002
153. -Newton K Dixit VM Signaling in innate immunity and inflammation Cold Spring Harb Perspect Biol 2012 4 3 a006049 10.1101/cshperspect.a006049 22296764
Newton K, Dixit VM. Signaling in innate immunity and inflammation. Cold Spring Harb Perspect Biol. 2012;4(3):a006049.22296764 10.1101/cshperspect.a006049
154. Yu L, Liu Y, Cao C, Yang L, Liu H, Wang C. Andrographolide attenuates inflammation due to intra-abdominal sepsis by enhancing bacterial clearance in mice. J Inflamm Res. 2023 Dec;31:4413–23.
155. -Liu S Li J Feng LH Gallic acid regulates immune response in a mouse model of rheumatoid arthritis Immun Inflamm Dis 2023 11 2 e782 10.1002/iid3.782 36840490
Liu S, Li J, Feng LH. Gallic acid regulates immune response in a mouse model of rheumatoid arthritis. Immun Inflamm Dis. 2023;11(2):e782.36840490 10.1002/iid3.782
156. Hu G, Zhou X. Gallic acid ameliorates atopic dermatitis-like skin inflammation through immune regulation in a mouse model. Clinical, Cosmetic and Investigational Dermatology. 2021 Nov 16:1675–83.
157. Wittebole X, Castanares-Zapatero D, Laterre PF. Toll-like receptor 4 modulation as a strategy to treat sepsis. Mediators of inflammation. 2010;2010.
158. -Huang S Upregulation of TLR4 mRNA expression levels in broiler chickens under acute heat stress Brazilian J Poult Sci 2017 19 87 94 10.1590/1806-9061-2016-0344
Huang S. Upregulation of TLR4 mRNA expression levels in broiler chickens under acute heat stress. Brazilian J Poult Sci. 2017;19:87–94.10.1590/1806-9061-2016-0344
159. -Thakur AK Soni UK Rai G Chatterjee SS Kumar V Andrographolide modulate some toll-like receptors and cytokines expressions in HL-60 cell line Pharm Pharmacol Int J 2015 2 3 00027
Thakur AK, Soni UK, Rai G, Chatterjee SS, Kumar V. Andrographolide modulate some toll-like receptors and cytokines expressions in HL-60 cell line. Pharm Pharmacol Int J. 2015;2(3):00027.
160. -Gupta S Mishra KP Kumar B Singh SB Ganju L Andrographolide attenuates complete freund’s adjuvant induced arthritis via suppression of inflammatory mediators and pro-inflammatory cytokines J Ethnopharmacol 2020 261 113022 10.1016/j.jep.2020.113022 32569719
Gupta S, Mishra KP, Kumar B, Singh SB, Ganju L. Andrographolide attenuates complete freund’s adjuvant induced arthritis via suppression of inflammatory mediators and pro-inflammatory cytokines. J Ethnopharmacol. 2020;261:113022.32569719 10.1016/j.jep.2020.113022
161. -Ciesielska A Matyjek M Kwiatkowska K TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling Cell Mol Life Sci 2021 78 1233 61 10.1007/s00018-020-03656-y 33057840
Ciesielska A, Matyjek M, Kwiatkowska K. TLR4 and CD14 trafficking and its influence on LPS-induced pro-inflammatory signaling. Cell Mol Life Sci. 2021;78:1233–61.33057840 10.1007/s00018-020-03656-y
162. -Su Y Wang T Wu N Li D Fan X Xu Z Mishra SK Yang M Alpha-ketoglutarate extends Drosophila lifespan by inhibiting mTOR and activating AMPK Aging 2019 11 12 4183 10.18632/aging.102045 31242135
Su Y, Wang T, Wu N, Li D, Fan X, Xu Z, Mishra SK, Yang M. Alpha-ketoglutarate extends Drosophila lifespan by inhibiting mTOR and activating AMPK. Aging. 2019;11(12):4183.31242135 10.18632/aging.102045
163. -Fazolini NP Cruz AL Werneck MB Viola JP Maya-Monteiro CM Bozza PT Leptin activation of mTOR pathway in intestinal epithelial cell triggers lipid droplet formation, cytokine production and increased cell proliferation Cell Cycle 2015 14 16 2667 76 10.1080/15384101.2015.1041684 26017929
Fazolini NP, Cruz AL, Werneck MB, Viola JP, Maya-Monteiro CM, Bozza PT. Leptin activation of mTOR pathway in intestinal epithelial cell triggers lipid droplet formation, cytokine production and increased cell proliferation. Cell Cycle. 2015;14(16):2667–76.26017929 10.1080/15384101.2015.1041684
164. -Du H Zhang X Zeng Y Huang X Chen H Wang S Wu J Li Q Zhu W Li H Liu T A novel phytochemical, DIM, inhibits proliferation, migration, invasion and TNF-α induced inflammatory cytokine production of synovial fibroblasts from rheumatoid arthritis patients by targeting MAPK and AKT/mTOR signal pathway Front Immunol 2019 10 1620 10.3389/fimmu.2019.01620 31396207
Du H, Zhang X, Zeng Y, Huang X, Chen H, Wang S, Wu J, Li Q, Zhu W, Li H, Liu T. A novel phytochemical, DIM, inhibits proliferation, migration, invasion and TNF-α induced inflammatory cytokine production of synovial fibroblasts from rheumatoid arthritis patients by targeting MAPK and AKT/mTOR signal pathway. Front Immunol. 2019;10:1620.31396207 10.3389/fimmu.2019.01620
165. -You JS McNally RM Jacobs BL Privett RE Gundermann DM Lin KH Steinert ND Goodman CA Hornberger TA The role of raptor in the mechanical load-induced regulation of mTOR signaling, protein synthesis, and skeletal muscle hypertrophy FASEB J 2019 33 3 4021 10.1096/fj.201801653RR 30509128
You JS, McNally RM, Jacobs BL, Privett RE, Gundermann DM, Lin KH, Steinert ND, Goodman CA, Hornberger TA. The role of raptor in the mechanical load-induced regulation of mTOR signaling, protein synthesis, and skeletal muscle hypertrophy. FASEB J. 2019;33(3):4021.30509128 10.1096/fj.201801653RR
166. -Rajaei-Sharifabadi H Ellestad L Porter T Donoghue A Bottje WG Dridi S Noni (Morinda citrifolia) modulates the hypothalamic expression of stress-and metabolic-related genes in broilers exposed to acute heat stress Front Genet 2017 8 192 10.3389/fgene.2017.00192 29259622
Rajaei-Sharifabadi H, Ellestad L, Porter T, Donoghue A, Bottje WG, Dridi S. Noni (Morinda citrifolia) modulates the hypothalamic expression of stress-and metabolic-related genes in broilers exposed to acute heat stress. Front Genet. 2017;8:192.29259622 10.3389/fgene.2017.00192
167. -Sun X Zhang H Sheikhahmadi A Wang Y Jiao H Lin H Song Z Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus Domesticus) Int J Biometeorol 2015 59 127 35 10.1007/s00484-014-0829-1 24736810
Sun X, Zhang H, Sheikhahmadi A, Wang Y, Jiao H, Lin H, Song Z. Effects of heat stress on the gene expression of nutrient transporters in the jejunum of broiler chickens (Gallus gallus Domesticus). Int J Biometeorol. 2015;59:127–35.24736810 10.1007/s00484-014-0829-1
