
==== Front
MicroPubl Biol
MicroPubl Biol
microPublication Biology
2578-9430
Caltech Library

10.17912/micropub.biology.001315
WBPaper00067148
Materials and Reagents
Methods
C. Elegans
New Flexon-based reagents for tissue-specific Auxin-Inducible Degradation and for characterizing Cre and Flp drivers in C. elegans
Wittes Julia 1§
Greenwald Iva 1
1 Dept. of Biological Sciences, Columbia University, New York, New York, USA

§ Correspondence to: Julia Wittes ( jw2327@columbia.edu )
The authors declare that there are no conflicts of interest present.

19 8 2024
2024
2024 10.17912/micropub.biology.0013155 8 2024
17 8 2024
17 8 2024
Copyright: © 2024 by the authors
2024
https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
A Flexon stop cassette interrupts translation of a coding region until it is excised by a recombinase to allow for gene expression. We have expanded options for Auxin-Inducible Degradation by generating Flexon-based transgenes for tissue-specific expression of the ubiquitin ligase substrate recognition component TIR1 or the variant TIR1(F79G) after excision of the Flexon by Cre recombinase. We also describe Flexon-based tester transgenes to facilitate gathering accurate information about the expression pattern of Cre and Flp recombinase drivers that can be used in conjunction with any conditional expression reagents that utilize these recombinases.

This work was supported by grants R35GM131746 from the National Institute of General Medical Sciences (to I.G.), F32GM140732 (to J.W.), and training grant 5T32DK007328.
==== Body
pmc Figure 1. Flexon-based reagents for tissue-specific expression of TIR1 and for characterizing Cre and Flp recombinase excision patterns A) A Flexon stop cassette is an artificial exon that contains stop codons and a frameshift generator (***), leading to termination of protein translation and nonsense-mediated decay of the transcript. Triangles represent recombinase target sites and the thin line represents intronic sequences flanking the artificial exon. For further information and considerations about Flexon design and placement see Shaffer and Greenwald (2022). B) TIR1(flexon) is expressed under the control of a strong ubiquitous promoter from rps-27 ( rps-27p) . In the absence of Cre, the Flexon cassette interrupts TIR1 translation after codon 159. In the presence of Cre, the Flexon is excised and the complete TIR1 protein is expressed under the control of rps-27p . TIR1F79G(flexon) has an identical design to TIR1(flexon) . C) The design of Cre and Flp testers was based on the design of arTi361 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR] (Shaffer and Greenwald 2022). Nuclearly-localized GFP is expressed under the control of rps-27p after excision in the presence of an appropriate Cre or Flp driver. H2B represents the sequence of a histone gene, his-58 . All transgenes reported in this study use the neutral unc-54 3'UTR.

Description

The Auxin-Inducible Degradation (AID) system is a valuable method for conditional protein depletion in C. elegans (Zhang et al., 2015) . In this system, a degron tag (also represented as "AID") is added to the protein of interest, making it a potential substrate for recognition by the Arabidopsis TIR1 protein; the addition of auxin promotes association of TIR1 with the AID moiety, leading to ubiquitination and proteasome-dependent degradation of the degron-tagged protein. Spatial control over protein depletion is provided by tissue-specific expression of TIR1 and temporal control can be provided by the addition of auxin. A modified AID system uses TIR1(F79G) (Uchida et al., 2018; Hills-Muckey et al., 2022) , and both systems are useful additions to the C. elegans genetic toolbox.

In addition to being specific, appropriate drivers for tissue-specific AID should also result in strong expression of TIR1 to maximize the effectiveness of target protein depletion in the presence of auxin. However, a tissue-specific promoter may not produce a sustained high level of gene expression. In such cases, a stop cassette such as a Flexon ( Figure 1A ), which interrupts gene expression until excised via flanking recombinase sites, can provide strong, sustained expression. For example, in our work on the somatic gonad, we have relied extensively on a promoter derived from ckb-3 that is highly and specifically expressed in the somatic gonad precursors Z1 and Z4, but not in their descendants (Kroetz and Zarkower 2015; see also Shaffer and Greenwald 2022) . However, specific, strong, sustained expression in the somatic gonad has been achieved by combining a ckb-3p::Cre driver transgene with a transgene in which the strong promoter of a ribosomal protein gene drives expression of fluorescent proteins (Shaffer and Greenwald 2022) or biologically active proteins (O'Keeffe and Greenwald 2022) after excision of a Flexon in the somatic gonad. We adapted this approach to create Flexon-based reagents for strong, tissue-specific expression of TIR1 by generating Flexon-interrupted transgenes that express TIR1 under the control of rps-27p ( Figure 1B ). A high level of TIR1 expression is thus ensured in tissues where Cre recombinase is expressed.

In many existing TIR1 transgenes, the level and tissue-specificity of expression of TIR1 has been evaluated based on a fluorescent protein fused to TIR1 (e.g. Zhang et al., 2015) or co-expressed using a 2A peptide (e.g. Xiao et al., 2023). A limitation of this general approach is that it precludes the ability to use a fluorescent marker of the same color. Our Flexon-based TIR1 transgenes are not fluorescently tagged, so any fluorescent markers may be used.

It is important to characterize the excision pattern of recombinase drivers when using any reagents that depend on them for excision, including the TIR1(flexon) reagents described here. Promoters that appear tissue-specific based on expression of fluorescent proteins have been observed to produce broader excision patterns when used to express recombinases because of transient historical expression or low-level expression not readily detected using fluorescent reporter proteins (Ruijtenberg and van den Heuvel 2015; Tenen and Greenwald 2019) . To facilitate characterization of recombinase drivers, we developed Flexon-based reporters for Cre or Flp recombinase such that nuclearly-localized GFP is produced after excision of the Flexon ( Figure 1C ). Cre recombinase excision patterns can be visualized by generating strains containing the Cre driver and a miniMos transgene such as arTi452 or arTi361 (see Methods). In addition, we also developed a strain to facilitate the generation and characterization of new Cre drivers in one step: plasmids for Cre expression can be directly injected into the strain GS10037 , which contains arSi159 , a single-copy insertion generated by MosSCI at ttTi5605 II . This strain is convenient for direct injection because Cre drivers cloned in miniMos vectors that have G418 or hygromycin B selection markers (e.g. pCFJ910 or pCFJ1662) can be easily selected in this background. Finally, we also generated a Flexon-based reporter containing frt sites ( arTi461 ) , which can be used to characterize Flp drivers. Using this transgene we were able to confirm that the Flexon system works with the Flp-FRT system, as was previously proposed (Shaffer and Greenwald 2022) .

Methods

All constructs were cloned using Gibson Assembly (NEB HiFi reagent). All miniMos transgenes were generated in the N2 strain background by standard methods (Frøkjær-Jensen et al., 2014). The transgene arSi159 was made using mosSCI: by injecting into EG6699 [ ttTi5605 ; unc-119 ( ed3 ); oxEx1578 [eft-3p::GFP + Cbr-unc-119 ] ] (Frøkjær-Jensen et al., 2008).

Table 1 summarizes information about the new transgenes generated in this study, and Table 2 provides primer sequences that can be used for genotyping.

TIR1 Flexon-based expression reagents. pJSW49 [rps-27p::TIR1(flexon)::unc-54 3'UTR] was cloned in the pCFJ1662 miniMos vector, which includes a hygromycin B selection cassette (Frøkjær-Jensen et al., 2014). The TIR1 sequence is derived from pLZ31 (Zhang et al., 2015) and was modified by replacing the first synthetic intron (after codon 159) with a Flexon sequence identical to the one reported in Shaffer and Greenwald (2022). The sequence encoding the F-Box domain and first leucine-rich repeat (LRR) of TIR1 precede the Flexon and the sequence encoding the final 4 LRR domains and the remainder of TIR1 follow the Flexon, which guards against the production of a functional protein in the absence of Cre expression. This plasmid was injected to make the transgene arTi362 via standard miniMos protocols.

pJSW87 [rps-27p::TIR1F79G(flexon)::unc-54 3'UTR] was derived from pJSW49 by introducing the F79G mutation, changing the codon TTC to GGA (Uchida et al., 2018; Hills-Muckey et al., 2022) , by Gibson assembly. This plasmid was used to make the miniMos transgene arTi443 .

New Flexon-based recombinase testers. The previously-described tester arTi361 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR] has a Flexon flanked by lox2272 sites, and was derived from the plasmid pHK001 (Shaffer and Greenwald 2022) . pHK001 was modified to create the new plasmids described here.

Cre recombinase testers. arTi452 was derived from pJSW89, in which the lox2272 sites of pHK001 were replaced with loxP . arSi159 was derived from pJSW102, which has the same insert as pJSW89, but it was generated in the pCFJ151 mosSCI backbone (Frøkjær-Jensen et al., 2008). The availability of equivalent testers with different lox sites allows for maximum flexibility for their use as cell markers when combined with other genome engineered loci that have lox scars or paired lox sites.

Flp recombinase tester. arTi461 was derived from the plasmid pJSW96, in which the lox2272 sites of pHK001 were replaced by frt sites.

Transgene

	Plasmid

	Genotype

	Target

	Plasmid backbone, selection

	Genetic map location

	
arTi362

	pJSW49

	rps-27p::TIR1(flexon)::unc-54 3'UTR

	lox2272

	pCFJ1662, Hygromycin B

	-19.98 V

	
arTi443

	pJSW87

	rps-27p::TIR1F79G(flexon)::unc-54 3'UTR

	lox2272

	pCFJ1662,

Hygromycin B

	+21.99 V

	
arTi452 *

	pJSW89

	rps-27p::GFP(flexon)::H2B::unc-54 3'UTR

	loxP

	pCFJ910,

G418

	-4.81 I

	
arTi461 *

	pJSW96

	rps-27p::GFP(flexon)::H2B::unc-54 3'UTR

	frt

	pCFJ910,

G418

	-3.80 I

	
arSi159

	pJSW102

	rps-27p::GFP(flexon)::H2B::unc-54 3'UTR

	loxP

	pCFJ151,

Cbr-unc-119 (+)

	ttTi5605 II

	

Table 1.

The plasmids listed in Table 1 will be deposited at Addgene or available upon request. The following strains will be deposited at the CGC or available upon request.

GS9820 arTi443

GS9402 arTi362

GS9847 arTi452

GS9922 arTi461

GS10037 arSi159 ; unc-119 ( ed3 )

* GS9407 arTi361 [rps-27p::GFP(flexon)::H2B::unc-54 3'UTR] is equivalent to arTi452 and arTi461 except with lox2272 sites (Shaffer and Greenwald 2022) .

Transgene

	Genotyping primers

	Band sizes

	
arTi362

	oJSW172 = GGGATACAGTGTCAAGGCTAGTG

oJSW183 = CACGTCCTTGATGATTCTCGGCA

oCF1590 = CGATAAATATTTACGTTTGCGAGAC

	No transgene: 674 bp band

Transgene: 306 bp band

	
arTi443

	oJSW330 = AACCGAGAGAGACGTAGACAC

oJSW331 = GATTTGTCAGCCATTCGTCTG

oCF1591 = AAAAATGGCTCGATGAATGG

	No transgene: 481 bp band

Transgene: 251 bp band

	

Table 2.

Acknowledgments

Some strains used during the course of this work were provided by the Caenorhabditis Genetics Center, which is funded by NIH Office of Research Infrastructure Programs (P40OD010440). We thank undergraduate researchers Brianna Hodges, Chloe Paolucci and Alexis Terracciano for assistance with cloning and Dr. Justin Shaffer for advice in construct design.
==== Refs
Frøkjær-Jensen C Davis MW Sarov M Taylor J Flibotte S LaBella M Pozniakovsky A Moerman DG Jorgensen EM 2014 3 16 Random and targeted transgene insertion in Caenorhabditis elegans using a modified Mos1 transposon. Nat Methods 11 5 1548-7091 529 534 10.1038/nmeth.2889 24820376
Frøkjaer-Jensen C Davis MW Hopkins CE Newman BJ Thummel JM Olesen SP Grunnet M Jorgensen EM 2008 10 26 Single-copy insertion of transgenes in Caenorhabditis elegans. Nat Genet 40 11 1061-4036 1375 1383 10.1038/ng.248 18953339
Hills-Muckey K Martinez MAQ Stec N Hebbar S Saldanha J Medwig-Kinney TN Moore FEQ Ivanova M Morao A Ward JD Moss EG Ercan S Zinovyeva AY Matus DQ Hammell CM 2022 2 4 An engineered, orthogonal auxin analog/AtTIR1(F79G) pairing improves both specificity and efficacy of the auxin degradation system in Caenorhabditis elegans. Genetics 220 2 0016-6731 10.1093/genetics/iyab174 34739048
Kroetz MB Zarkower D 2015 10 23 Cell-Specific mRNA Profiling of the Caenorhabditis elegans Somatic Gonadal Precursor Cells Identifies Suites of Sex-Biased and Gonad-Enriched Transcripts. G3 (Bethesda) 5 12 2831 2841 10.1534/g3.115.022517 26497144
O'Keeffe C Greenwald I 2022 10 31 EGFR signal transduction is downregulated in C. elegans vulval precursor cells during dauer diapause. Development 149 21 0950-1991 10.1242/dev.201094 36227589
Ruijtenberg S van den Heuvel S 2015 7 2 G1/S Inhibitors and the SWI/SNF Complex Control Cell-Cycle Exit during Muscle Differentiation. Cell 162 2 0092-8674 300 313 10.1016/j.cell.2015.06.013 26144318
Shaffer JM Greenwald I 2022 1 18 Floxed exon (Flexon): A flexibly positioned stop cassette for recombinase-mediated conditional gene expression. Proc Natl Acad Sci U S A 119 3 0027-8424 10.1073/pnas.2117451119 35027456
Tenen CC Greenwald I 2019 2 28 Cell Non-autonomous Function of daf-18/PTEN in the Somatic Gonad Coordinates Somatic Gonad and Germline Development in C.&nbsp;elegans Dauer Larvae. Curr Biol 29 6 0960-9822 1064 1072.e8 10.1016/j.cub.2019.01.076 30827916
Uchida N Takahashi K Iwasaki R Yamada R Yoshimura M Endo TA Kimura S Zhang H Nomoto M Tada Y Kinoshita T Itami K Hagihara S Torii KU 2018 1 22 Chemical hijacking of auxin signaling with an engineered auxin-TIR1 pair. Nat Chem Biol 14 3 1552-4450 299 305 10.1038/nchembio.2555 29355850
Xiao Y Yee C Zhao CZ Martinez MAQ Zhang W Shen K Matus DQ Hammell C 2023 4 6 An expandable FLP-ON::TIR1 system for precise spatiotemporal protein degradation in Caenorhabditis elegans. Genetics 223 4 0016-6731 10.1093/genetics/iyad013 36722258
Zhang L Ward JD Cheng Z Dernburg AF 2015 11 9 The auxin-inducible degradation (AID) system enables versatile conditional protein depletion in C. elegans. Development 142 24 0950-1991 4374 4384 10.1242/dev.129635 26552885
