
==== Front
Neoplasia
Neoplasia
Neoplasia (New York, N.Y.)
1522-8002
1476-5586
Neoplasia Press

S1476-5586(24)00080-0
10.1016/j.neo.2024.101038
101038
Original Research
Synthetic lethality between ATR and POLA1 reveals a potential new target for individualized cancer therapy
Schneider Hanna Elisabeth ab
Schmitt Lisa-Maria a
Job Albert a
Lankat-Buttgereit Brigitte a
Gress Thomas a
Buchholz Malte a
Gallmeier Eike eike.gallmeier@klinikum-memmingen.de
ac⁎
a Center for Tumor Biology and Immunology, Department of Gastroenterology, Endocrinology and Metabolism, University Hospital of Marburg, Philipps-University Marburg, Marburg, Germany
b Department of Medicine A - Hematology, Oncology and Pneumology, University Hospital Münster, Muenster, Germany
c Department of Internal Medicine II - Gastroenterology, Oncology and Metabolism, Hospital Memmingen, Memmingen, Germany
⁎ Corresponding author at: Department of Internal Medicine II - Gastroenterology, Oncology and Metabolism, Hospital Memmingen, Bismarckstr. 23, 87700 Memmingen, Germany. eike.gallmeier@klinikum-memmingen.de
10 8 2024
11 2024
10 8 2024
57 10103830 5 2024
6 8 2024
6 8 2024
© 2024 The Authors. Published by Elsevier Inc.
2024

https://creativecommons.org/licenses/by/4.0/ This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).
The ATR-CHK1 pathway plays a fundamental role in the DNA damage response and is therefore an attractive target in cancer therapy. The antitumorous effect of ATR inhibitors is at least partly caused by synthetic lethality between ATR and various DNA repair genes. In previous studies, we have identified members of the B-family DNA polymerases as potential lethal partner for ATR, i.e. POLD1 and PRIM1. In this study, we validated and characterized the synthetic lethality between ATR and POLA1.

First, we applied a model of ATR-deficient DLD-1 human colorectal cancer cells to confirm synthetic lethality by using chemical POLA1 inhibition. Analyzing cell cycle and apoptotic markers via FACS and Western blotting, we were able to show that apoptosis and S phase arrest contributed to the increased sensitivity of ATR-deficient cancer cells towards POLA1 inhibitors. Importantly, siRNA-mediated POLA1 depletion in ATR-deficient cells caused similar effects in regard to impaired cell viability and cumulation of apoptotic markers, thus excluding toxic effects of chemical POLA1 inhibition. Conversely, we demonstrated that siRNA-mediated POLA1 depletion sensitized several cancer cell lines towards chemical inhibition of ATR and its main effector kinase CHK1.

In conclusion, the synthetic lethality between ATR/CHK1 and POLA1 might represent a novel and promising approach for individualized cancer therapy: First, alterations of POLA1 could serve as a screening parameter for increased sensitivity towards ATR and CHK1 inhibitors. Second, alterations in the ATR-CHK1 pathway might predict in increased sensitivity towards POLA1 inhibitors.

Graphical abstract

Image, graphical abstract

Keywords

Synthetic letality
ATR
POLA1
Colon cancer
S phase arrest
Apoptosis, Cancer therapy
Abbreviations

ATR ataxia telangiectasia and Rad3-related protein

ATRIP ATR interacting protein

CHK1 Checkpoint kinase 1

COSMIC Catalogue of Somatic Mutations In Cancer and Cell

IC50 half-maximal inhibitory concentration

MMC Mitomycin C

NTC non-transfected cells

PARP poly(ADP-ribose) polymerase

PI propidium iodide

RPA replication protein A

ssDNA single stranded DNA
==== Body
pmcIntroduction

Cancer therapy is one of the most permanent changing subjects of modern medicine. Currently, a main goal is to establish more efficient cancer treatments by using individualized and targeted approaches for tumor cells and thereby to minimize the frequency and severity of side effects. To this end, genotype-based cancer treatment represents a promising tool. During carcinogenesis the accumulation of mutations – particularly within the DNA repair pathways – is one crucial process for the malignant transformation of normal cells to cancer cells. To compensate the impairment in certain DNA repair pathways due to the accumulation of mutations, other DNA repair pathways are often upregulated in cancer cells [20]. This process facilitates novel therapeutic approaches through practical application of the principle of synthetic lethality.

Synthetic lethality describes the relationship between two genes where inactivation of either gene alone has no effect, but inactivation of both genes is lethal to the cell carrying these mutations [32]. Thus, by pharmacologically targeting a gene, which compensates the loss – mediated by mutations during carcinogenesis – of its synthetically lethal partner, synthetic lethality increases toxicity specifically towards cancer cells. A well-known example with clinical impact is the role of poly(ADP-ribose) polymerase (PARP) inhibitors in tumors harboring BRCA1/2 mutations [15]. This targeted approach is already used for multiple cancer entities including breast, ovarian and pancreatic cancers [26].

One important part of the DNA repair machinery is the phosphoinositide 3-kinase (PIK)-related kinase named ataxia telangiectasia and Rad3-related protein (ATR). Activated by replication protein A (RPA)-coated single stranded DNA (ssDNA), ATR stabilizes the replication fork and mediates cell cycle arrest and DNA repair [6]. ATR exists in a complex with the ATR interacting protein (ATRIP), which enables activation by the topoisomerase binding protein 1 (TopBP1)-RAD9-RAD1-HUS1 (9-1-1) complex [9,30]. Together with claspin, the activated ATR induces cell cycle arrest by phosphorylation of Checkpoint kinase 1 (CHK1), which represents the major downstream effector of ATR [14].

In our previous studies on the synthetically lethal relationship between ATR and POLD1 and ATR and PRIM1 [21,23,24], preliminary experiments indicated another synthetically lethal relationship, namely between ATR and POLA1, encoding the catalytic subunit of the DNA polymerase α [8]. This assumption was further supported by Rogers et. al. [35], which also confirmed a synthetic lethal relationship between CHK1 and multiple DNA polymerases such as POLA1, POLE and POLE2.

To gain a more detailed understanding of the effects already described and thereby provide a basis for clinical benefit, we have investigated and characterized this relationship between ATR and POLA1. First, we applied a well-described cellular model of ATR-deficiency in the human colorectal cancer cell line DLD-1 [16,21,22,46], consisting of parental DLD-1 cells (subsequently referred to as ATR+/+ cells) and a derived DLD-1 cell clone homozygously harboring the a hypomorphic ATR Seckel mutation (subsequently referred to as ATRs/s cells). While total loss of ATR is incompatible with cell viability [5], the Seckel mutation applied in this system causes subtotal ATR protein depletion without any detectable effect on viability. To model POLA1 deficiency, we applied ST1926, an atypical retinoid that has already been shown to inhibit POLA1 and proliferation of colorectal cancer cells [1].

Vice versa, as POLA1 mutations occur in about 7 % of colorectal and pancreatic cancer samples, we additionally used four different ATR and CHK1 inhibitors to assess the chemical inducibility of synthetic lethality in various POLA1-depleted colon and pancreatic cancer cell lines.

Our results illustrate a novel potential approach for individualized cancer therapy using specific ATR/CHK1 inhibitors or POLA1 inhibitors for the individualized treatment of ATR- or POLA1-deficient tumors, respectively.

Material and methods

Cell culture

Various human colon cancer cell lines (colon: DLD-1 (Leibniz Institut DSMZ, Braunschweig, Germany) and its well characterized ATRs/s cell clone [16,17,22,46] (Fred Bunz, John Hopkins University, Baltimore, MD, USA), HCT-116 (CLS Cell Line Service GmbH, Eppelheim, Germany), RKO (American Type Culture Collection, LGC Standards, Wesel, Germany); pancreas: PaTu 8988t (Hans-Peter Elsässer, Philipps-University Marburg, Germany)) were cultivated at 37°C and 5 % CO2 in Roswell Park Memorial Institute (RPMI 1640) medium or Dulbecco's Modified Eagle Medium (DMEM) (Thermo Fisher Scientific, Schwerte, Germany) containing 10 % fetal bovine serum (FBS) (Thermo Fisher Scientific, Schwerte, Germany).

Drugs

The following drugs were used while performing experiments: AZD6738 and VE-822 (MedKoo Biosciences, Morrisville, NC), MK-8776 and LY2603618 (Selleckchem, Munich, Germany), and mitomycin C (MMC) and ST1926 (Sigma-Aldrich, Hamburg, Germany).

Transfection

Protein knockdown was achieved by transfection experiments. For this purpose, HiPerFect (QIAGEN, Hilden, Germany) was mixed with 5 nM siRNA targeting POLA1 (ATGGCAGTCTTTCCTCTCTTA) (QIAGEN, Hilden, Germany) in medium without FBS. After 20 minutes of incubation, this mixture was added to recently plated cells. Allstars negative (non-targeting) and medium without FBS were established as controls to monitor off-target effects.

Cell proliferations assays

Drug sensitivity was assessed by cell proliferation assays in ATR+/+, ATR+/s and ATRs/s cells. Therefore, 1500 cells of ATR+/+, ATR+/s and ATRs/s were sown in 96-well plates. After 24 h, they were exposed to the above-mentioned drugs for 120 h. 0.2 % SYBR-green (Lonza, Cologne, Germany) solution in Aqua destillata was added and fluorescence was measured by Victor3 V plate reader (PerkinElmer, Waltham, MA). Survival fraction was determined by dividing treated cells by an untreated control group.

Cell viability assays

Cell viability assays examined either the impact of POLA1 depletion through transfection or the sensibility towards various drugs. For the former, 12,500 – 50,000 ATR+/+ cells and 15,000 – 60,000 ATRs/s cells were transferred in 6-well plates, transfected as described above and incubated for 72 – 168 h. For the latter, 140,000 ATR+/+, RKO, HCT-116 or PaTu8988t cells were transferred in 6-well plates and transfected as described above. After 72 h, 2,000 – 25,000 cells of POLA1 depleted cells and control samples were plated in 96-well plates. After another 24 h, they were treated with various drugs for 120 h.

Afterwards, cells were washed with Dulbecco´s Phosphate Buffered Saline (DPBS) (Thermo Fisher Scientific, Schwerte, Germany) and treated with MTT. For the MTT-reagent, 0.5 % Thiazolylblue (Roth, Karlsruhe, Germany) solution in DPBS was added to RPMI without FBS. This reagent was added to each well and incubated for 90 minutes. Absorption was measured using a Multiscan FC (Thermo Fisher Scientific, Schwerte, Germany), and cell viability was determined by dividing treated cells by an untreated control group.

Western blotting

Western blotting was performed as in previous works of our group [23,24]. Protein extracts were extracted by lysing cells, and were then boiled and loaded onto 10 % or 15 % polyacrylamide gels for electrophoresis. Proteins were then transferred to PVDF membranes. Membranes were incubated for 1 h in 5 % milk powder in TBS + 0.1 % Tween 20 (TBS-T) and then incubated overnight with the primary antibody in TBS-T at 4°C. The primary antibodies that were used were anti‐Caspase 3, anti‐cleaved Caspase 3 (Asp175), anti‐Caspase 8 (1C12), anti-PARP and anti-posphoCHK1 (anti-pCHK1; Ser345) (133D3) (Cell Signaling Technology, Cambridge, UK), anti-ATR (N-19), anti‐Caspase 9 (H-170), anti-Cdc25A (5H51), anti-CHK1 (G4), anti‐Cyclin A (H-432), and anti-POLA1 (D-4) (Santa Cruz Biotechnology, Dallas, TX); and anti‐β-Actin (AC-15) (Sigma-Aldrich, Hamburg, Germany). After washing, the membranes were incubated with the secondary antibodies. The secondary antibodies that were used were HRP-conjugated anti-goat, anti-rat, anti-mouse, and anti-rabbit antibodies (Sigma-Aldrich, Hamburg, Germany). Proteins were visualized via chemiluminescence using PerkinElmer Western Lightning Ultra or Clarity Western ECL Substrate (Bio-Rad Laboratories, Munich, Germany) according to the manufacturer's instructions. ß-Actin was included as a loading control. All western blots are representative of at least three separate experiments.

Flow cytometry

To investigate cell cycle and apoptosis, flow cytometry was performed according to the methods previously described by our group [23,24]. 62,500 – 250,000 ATR+/+ cells and 75,000 – 300,000 ATRs/s cells were seeded in 6-well plates and were then treated with ST1926 24 h after seeding. Cells were harvested after a subsequent 24, 48 and 72 h. For cell cycle analysis, cells were washed and stained with propidium iodide (PI; 0.1 % sodium citrate, 0.1 % Triton X-100, 50 μg/ml propidium iodide) according to previously described protocols [31]. For apoptosis analysis, cells were washed and stained with FITC-conjugated Annexin-V (Biolegend, San Diego, CA) diluted 1:40 in Hanks Balanced Salt solution (HBSS) (Thermo Fisher Scientific, Schwerte, Germany) for 20 minutes at room temperature in the dark. Afterwards, 1 µl propium iodide (1mg/ml, Thermo Fisher Scientific, Schwerte, Germany) was immediately added before measurement.

The BD FACSCanto II from BD Biosciences (San Jose, CA) and the FlowJo v10 software from FlowJo, LLC (Ashland, OR) were used to analyze both cell cycle and apoptosis. For each sample, a minimum of 30,000 gated events were assessed. According to Wlodjowic et al. [47] PI−/Annexin V+ were interpreted as early apoptotic and PI+/Annexin V+ cells as late apoptotic cells.

Statistical analyses

GraphPad Prism 9.5.0 (La Jolla, CA, USA) was used for all statistical analyses. Error bars represent ± SD. A minimum of three separately experiments were performed. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant.

Results

Synthetic lethality between ATR and POLA1 in an ATR-knock-in DLD-1 model

To verify the synthetic lethal interaction between ATR and POLA1 we initially applied a well-described model of ATR-deficient DLD-1 human colorectal cancer cells [16,21,22,46]. First, we confirmed and quantified ATR and POLA1 expression in these cell lines via Western blotting (Fig. 1A and B). In concordance with our previous studies, ATR+/+ cells showed the highest ATR protein levels, whereas the ATR levels slightly decreased in ATR+/s cells and were almost undetectable in ATRs/s cells (Fig. 1A). Interestingly, POLA1 protein levels reciprocally increased with decreasing ATR protein levels, showing the highest expression in ATRs/s cells and the lowest expression in ATR+/+ cells (Fig. 1B). Next, we confirmed the previously described increased sensitivity of ATRs/s cells towards the DNA interstrand-crosslinking agent MMC [17] as compared to ATR+/+ and ATR+/s cells (Fig. 1C). Then, we assessed the sensitivity of ATRs/s as compared to ATR+/+ cells towards chemical POLA1 inhibition using ST1926 (Fig. 1D). Notably, with IC50 ratios of 6 and 4, respectively, ST1926 showed at least comparable if not even stronger effects than MMC. Taken together, these data illustrate a synthetically lethal relationship between ATR and POLA1 through simultaneous impairment of ATR and POLA1 in DLD-1 colorectal cancer cells.Fig. 1 Synthetic lethality between ATR and POLA1 in an ATR-knock-in DLD-1 model. (A) Confirmation of ATR expression in ATR+/+, ATR+/s and ATRs/s cells via Western blotting. (B) Confirmation of POLA1 expression in ATR+/+, ATR+/s and ATRs/s cells via Western blotting. (C) Assessment of MMC sensitivity on the proliferation of ATR+/+, ATR+/s and ATRs/s cells via proliferation assay 120 h post treatment. (D) Assessment of ST1926 sensitivity on the proliferation of ATR+/+ and ATRs/s cells via MTT-assay 120 h post treatment. Data points are based on triplicate wells of a minimum of three separate experiments. Error bars represent ± SD. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant. Asterisks were used for comparisons between ATR+/+ and ATRs/s, triangles for comparisons between ATR+/+ and ATR+/s, hash symbols for comparisons between ATR+/s and ATRs/s. Western blots show representative results of at least three separately performed experiments.

Fig. 1

ST1926-mediated effects on cell cycle distribution in ATR+/+ cells vs ATRs/s cells

To assess whether cell cycle arrest or apoptosis contributed to the increased sensitivity of ATRs/s cells towards ST1926, we next examined the cell cycle distribution including the sub-G1 fraction in ATR+/+ cells and ATRs/s cells 24 h, 48 h and 72 h after ST1926 treatment. Upon treatment with ST1926, both ATR+/+ and ATRs/s cells showed increased S phase- and decreased G2/M phase-fractions (Fig. 2A). In contrast, only ATRs/s cells but not ATR+/+ cells showed a significantly increased sub-G1 fraction upon ST1926 treatment (Fig. 2B). This effect increased in a time-dependent manner with approximately 10 % of cells in sub-G1 at 72 h post treatment (Fig. 2C). Thus, the POLA1 inhibitor ST1926 induced S phase-arrest in both ATR-proficient and ATR-deficient DLD-1 cells, but consecutive apoptosis (as indicated by the subG1 fraction) only and specifically in cells lacking ATR.Fig. 2 ST1926-mediated effects on cell cycle distribution in ATR+/+ cells vs ATRs/s cells. (A) Cell cycle profile of ATR+/+ and ATRs/s cells 24 h, 48 h and 72 h after ST1926 treatment assessed by FACS analysis. (B) Histograms of ATR+/+ and ATRs/s cells 48 h after ST1926 [40nM] treatment as measured by FACS analysis. (C) SubG1 fraction of the cell cycle analysis (Fig. 2A) as measured by FACS analysis. Data points are based on triplicate wells of a minimum of three separate experiments. Error bars represent ±SD. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant.

Fig. 2

ST1926-mediated induction of apoptosis in ATR+/+ cells vs ATRs/s cells

To evaluate whether the observed increased sub-G1 fraction in ATRs/s cells was indeed ascribable to apoptosis, we next performed Annexin V assays in ATR+/+ cells and ATRs/s cells upon ST1926 treatment. While neither ATR+/+ cells nor ATRs/s cells showed an increase of Annexin V+ without ST1926 treatment (data not shown), we observed an increase of early (PI−/Annexin V+) as well as late apoptosis (PI+/Annexin V+) in ATRs/s cells as compared to ATR+/+ cells upon ST1926 treatment (Fig. 3A and B). While this effect was not yet visible after 24 h, the percentage of Annexin V+ ATRs/s cells increased continuously over the following time points. To characterize apoptosis more specifically and mechanistically, we examined the protein levels of essential apoptosis markers via Western blotting in ATRs/s and ATR+/+ cells 24 h, 48 h and 72 h post treatment with ST1926 (Fig. 3C). We found an ST1926-induced increase of PARP cleavage exclusively in ATRs/s cells but not in ATR+/+ cells. Accordingly, the cleavage of caspase 3, the main effector caspase in the execution phase of apoptosis [13], was also increased specifically in ATRs/s cells at 48 h and 72 h but not in ATR+/+ cells after ST1926 treatment. Taken together, the increased sensitivity of ATRs/s cells towards chemical POLA1 inhibition can therefore be explained, at least in part, by S-phase arrest and subsequent apoptosis as contributing mechanisms.Fig. 3 ST1926-mediated induction of apoptosis in ATR+/+ cells vs ATRs/s cells. (A) Quantification of early apoptotic (PI−/annexin V+) and late apoptotic cells (PI+/annexin V+) in ATR+/+ and ATRs/s cells at 24, 48 and 72 h post treatment with 100 nM ST1926 as measured by flow cytometry. (B) Representative histograms of data shown in (A) of ATR+/+ and ATRs/s cells 72 h post treatment with 100 nM ST1926 as measured by flow cytometry. (C) Representative results of essential apoptotic markers in ATR+/+ and ATRs/s cells by Western blotting 24, 48 and 72 h post treatment with 100 nM ST1926. Data points are based on triplicate wells of a minimum of three separate experiments. Error bars represent ± SD. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant.

Fig. 3

siRNA-mediated POLA1 depletion in ATR+/+ cells vs ATRs/s cells

We wanted to examine the effects of a simultaneous inactivation of ATR and POLA1 in another, perhaps more specific model of POLA1 inactivation. Therefore, we tested the effects of POLA1 protein depletion in ATR+/+ cells vs ATRs/s cells. Efficient POLA1 depletion was confirmed in both ATR+/+ cells and ATRs/s cells at 72 h, 96 h and 120 h after siPOLA1 transfection (Fig. 4A). We observed an increased sensitivity of ATRs/s cells 72 – 168 h after siPOLA1 transfection as compared to ATR+/+ cells (Fig. 4B, C). To test whether apoptosis contributed to these effects – as similarly shown for ST1926 – we further quantified protein levels of essential apoptosis markers via Western blotting in ATR+/+ cells vs ATRs/s cells upon siPOLA1 transfection. Increased levels of cleaved PARP, pChk1 and cleaved Caspase 3 was observed at 96 h and 120 h after siPOLA1 transfection specifically in ATRs/s cells (Fig. 4D). After siRNA-mediated POLA1 depletion, only the ATRs/s cells showed increased cleaved caspase 3 levels. Similarly, the levels of Poly(ADP-ribose) polymerase (PARP) were elevated in POLA1 depleted ATRs/s cells. In addition, CHK1, the major downstream effector kinase of ATR [34,49] was phosphorylated after POLA1 depletion only in ATRs/s. These effects became apparent at 96 h and lasted until 120 h after transfection. Thus, siRNA-mediated POLA1 depletion induced similar effects as did ST1926 in ATR-deficient cells, further supporting our hypothesis of synthetic lethality between ATR and POLA1 in colorectal cancer cells.Fig. 4 siRNA-mediated POLA1 depletion in ATR+/+ cells vs ATRs/s cells. (A) Depletion of POLA1 in ATR+/+ and ATRs/s cells 72, 96 and 120 h after siRNA mediated knock-down shown via Western blotting. A minimum of three independent experiments were performed. (B) Cell viability after siRNA mediated knock-down in ATR+/+ and ATRs/s cells 72, 96 and 120 h after transfection. (C) Cell viability after siRNA mediated knock-down in ATR+/+ and ATRs/s cells 144 and 168 h after transfection. Cell viability of siPOLA1- and mock-transfected cells was calculated on the basis of non-treated cells. Data points are based on triplicate wells of a minimum of three separate experiments. Error bars represent ±SD. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant. (D) Protein quantification of apoptotic markers in ATR+/+ and ATRs/s cells at 72, 96 and 120 h after siRNA mediated POLA1 knock-down via Western blotting. A minimum of three independent experiments were performed.

Fig. 4

siRNA-mediated POLA1 depletion sensitizes ATR-proficient DLD-1 cells towards ATR and CHK1 inhibitors

We next assessed whether - similar to the interactions between ATR and POLA1 observed in the above model systems - ATR or CHK1inhibitors increased the sensitivity of ATR-proficient DLD-1-cells towards siRNA-mediated POLA1 depletion, applying widely used ATR inhibitors (AZD6738 and VE-822) or CHK1 inhibitors (LY2603618 and MK-8776), respectively [34]. As compared to non-transfected cells (NTC) or mock-transfected cells, only siPOLA1-transfected cells showed a significant increased sensitivity towards treatment with AZD6738 and VE-822 (IC50 ratios of 9 and 4) (Fig. 5A) and with LY2603618 and MK-8776 (IC50 ratios of 6 and 8) (Fig. 5B). Thus, siRNA-mediated POLA1 depletion sensitizes ATR+/+ cells towards chemical ATR- and CHK1-inhibition, respectively.Fig. 5 siRNA-mediated POLA1 depletion sensitizes ATR-proficient DLD-1 cells towards ATR and CHK1 inhibitors. Sensitization towards (A) ATR inhibitors and (B) CHK1 inhibitors was measured after 120 h of drug treatment in POLA1-depleted ATR+/+ cells vs. control and mock-transfected ATR+/+ cells by MTT-assay. Data points are based on triplicate wells from a minimum of three separate experiments. Error bars represent ± SD. performed. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant. Asterisks were used for comparisons between NTC and siPOLA1, triangles for comparisons between NTC and mock, hash symbols for comparisons between mock and siPOLA1.

Fig. 5

siRNA-mediated POLA1 depletion sensitizes HCT-116 and PaTu8988t cells towards ATR and CHK1 inhibitors

To test whether our data initially obtained in DLD-1 were generalizable beyond one cell line or tumor entity, we next assessed whether POLA1 depletion also sensitized other cancer cell lines towards ATR/CHK1-inhibition. Therefore, the colorectal cancer cell line HCT-116 and the pancreatic cancer cell line PaTu8988t were treated with ATR and CHK1 inhibitors, respectively. After verification of efficient POLA1 depletion (Fig. 6A and B), we were able to show a significant increased sensitivity towards treatment with ATR inhibitors AZD6738 and VE-822 upon siPOLA1-transfection in both cell lines (IC50 ratios between 3 and 7; Fig. 6C). Similarly, we observed in both cell lines a significant increased sensitivity towards treatment with CHK1 inhibitors LY2603618 and MK-8776 upon siPOLA1-transfection (IC50 ratios between 3 and 13; Fig. 6D). Thus, siPOLA1-mediated sensitization to ATR and CHK1 inhibitors is not a cell line-specific phenomenon of DLD-1 cells but can be generalized to a panel of cell lines of different tumor entities.Fig. 6 siRNA-mediated POLA1 depletion sensitizes HCT-116 and PaTu8988t cells towards ATR and CHK1 inhibitors. POLA1 depletion after siRNA mediated knock-down in (A) HCT-116 cells and (B) PaTu 8988t cells 72 h after transfection via Western blotting. A minimum of three independent experiments were performed. Sensitization towards (C) ATR inhibitors and (D) CHK1 inhibitors was measured after 120 h of drug treatment in POLA1 depleted HCT-116 or PaTu 8988t cells vs. control and mock-transfected HCT-116 or PaTu 8988t cells by MTT-assay. Data points are based on triplicate wells from a minimum of three separate experiments. Error bars represent ± SD. Statistical analysis was performed by two-way ANOVA with Bonferroni post-hoc test, where P values of P < 0.05 (*), P < 0.01 (**) or P < 0.001 (***) were considered significant. Asterisks were used for comparisons between NTC and siPOLA1, triangles for comparisons between NTC and mock, hash symbols for comparisons between mock and siPOLA1.

Fig. 6

Discussion

Using siRNA-library screening of DNA repair genes, we previously identified several genes from B-family DNA-polymerases as potential synthetic lethal partners for the checkpoint kinase ATR of which we consecutively characterized POLD1 and PRIM1 in follow-up studies [21,23,24]. In this study, we validated and characterized the relationship between ATR and another previously identified candidate partner, i.e. POLA1. To this end, we applied various genetic, epigenetic and chemical experimental settings to model ATR- and POLA1-impairment.

In line with our initial hypothesis of synthetic lethality between POLA1 and ATR, we first demonstrated in ATR+/+ and ATRs/s cells that POLA1 protein levels increased reciprocally with decreasing ATR protein levels, suggesting a perhaps compensatory activation of POLA1 upon inactivation of ATR. This hypothesis was further corroborated by the increased sensitivity of ATR-deficient DLD-1 cells towards treatment with the POLA1 inhibitor ST1926.

To gain more mechanistic insights into the synthetically lethal relationship between ATR and POLA1, we next investigated whether cell cycle perturbations or apoptosis contributed to the observed effects. ST1926 has already been reported to induce cytostatic and cytotoxic effects including S-phase arrest and apoptosis [[1], [2], [3],43]. Besides, apoptosis and cell cycle arrest has also been reported in glioblastoma cell lines treated with ST1926. However, compared to the previously described S phase arrest, this was associated with G0/G1 arrest and a significant reduction of cells in S phase [12]. Interestingly, in our study both ATR-proficient and ATR-deficient cells displayed an increased S and decreased G2/M phase upon ST1926 treatment, while increased subG1 phase was only detectable in ATR-deficient cells. This could indicate that after ST1926-induced cell cycle arrest only ATR-proficient cells can initiate sufficient DNA damage repair to prevent replication catastrophe, while ATR-deficient cells cannot [41].

ATR is activated by RPA coated ssDNA and suppresses the emergence of more ssDNA and the RPA exhaustion by inhibiting origin firing. Furthermore, it is proficient to prevent replication catastrophe [42]. Interestingly, Ercilla et. al. [14] showed that POLA1 activity is also capable to prevent replication catastrophe by avoiding accumulation of ssDNA and RPA exhaustion. Thus, we presume that vice versa the inhibition of POLA1 induces accumulation of ssDNA and consumption of RPA. This assumption is supported by RPA phosphorylation after sole POLA1 depletion, indicating that lower levels of POLA1 might correlate with the amount of replicative stress [35]. If POLA1 is thus inhibited in ATR- or CHK1-deficient cancer cells, global RPA exhaustion and therefore replication catastrophe culminating into apoptosis might be the consequence.

As we observed an increased subG1 fraction in ATR-deficient cells upon POLA1 inhibition, we assumed that apoptosis contributed to the synthetically lethal interactions between ATR and POLA1, which was confirmed by the elevated levels of Annexin V, Caspase 3 cleavage and PARP cleavage in ATR and POLA1 co-depleted cells. Caspase 3 is a central executioner of regulated cell death and is activated by other caspases [18]. PARP cleavage itself is catalyzed by Caspase 3 to prevent depletion of PARP substrates and is therefore also an indicator for apoptosis [4,38]. Thus, the growth inhibition and decreased cell viability induced by the simultaneous ATR and POLA1-impairment can be ascribed at least partially to apoptosis.

Further, POLA1 depletion combined with ATR/CHK1 deficiency induced by chemical ATR/CHK1 inhibition decreased cell viability significantly in our experiments. This phenomenon was observed not only in our initial model of DLD-1 colorectal cancer cells, but was generalizable to various cell lines of different tumor entities. Although POLA1 knockdown was also successfully performed in the colorectal cancer cell line RKO, we did not observe similar effects upon treatment with ATR or CHK1 inhibitors, respectively, in POLA1 depleted cells (data not shown), indicating that expectedly, the therapeutic targeting of POLA1 impaired or vice versa ATR impaired cells using the respective inhibitors will not unequivocally work in all cell lines. This is likely explainable by the highly heterogenous mutation patterns of different tumor cell lines, some of which could harbor mutations that overrule the synthetically lethal effects between ATR/CHK1 and POLA1.

Of note, our data demonstrating increased sensitivity of ATR/CHK1 inhibitors in POLA1 depleted cells are strongly supported by already published data [35] showing synthetic lethality between CHK1 and B-family DNA polymerase including POLA1 in both lung and colorectal cancer cells. In that study, it was demonstrated that the simultaneously chemical inhibition of POLA1 and CHK1 increases replication stress, DNA damage and apoptosis compared to single drug using. Some of these B-family DNA polymerase members, e.g. POLD1 and POLE, are already known to be mutated in some familial colorectal carcinomas and adenomas [33]. Although such a correlation is not yet known for POLA1, POLA1 mutations are found in 6,7 % of tested colon cancer samples and in 22 out of 55 tested colon cancer cell lines according to Catalogue of Somatic Mutations In Cancer and Cell (COSMIC) [10] by Sanger Institute. In addition, studies showed that colorectal cancer cells which are resistant towards ST1926 and its parent molecule CD437 develop POLA1 mutations [1,19]. Future studies are needed to determine, whether these previously described POLA1 mutations in other malignant entities are similarly interacting synthetically lethal with ATR and CHK1 inhibitors as has been shown in our study.

The potential impact on clinical anticancer therapy might not only be restricted to pathogenic POLA1 mutations but potentially also extendable to mere altered POLA1 expression, as low POLA1 expression leads to increased sensitivity against CHK1 inhibitors [35], consistent with high yH2AX levels as an indicator for increased replication stress in CHK1 and POLA1 siRNA-mediated co-depleted cells [40]. Therefore, altered POLA1 expression could potentially also serve as indicator for tumor response after treatment with CHK1 inhibitors.

In addition, Takahashi et al. [39] developed a transcriptional profile, the repstress score, for replication stress that includes POLA1 as a marker. The repstress score has been shown to predict sensitivity to ATR inhibitors and is therefore a potential tool for patient selection. Although many other factors are included in this score, it further corroborates the relationship between POLA1 and ATR as characterized in our study.

Finally, CHK1 frameshift mutations might contribute to tumorgenesis in microsatellite instable colon carcinomas due to consecutive defects in the DNA damage response [27]. Although COSMIC by Sanger Institute only counted approximately 2 % of CHK1 mutations in the large intestine, many of these alterations could have a pathological impact with almost 30 % frameshift insertions or deletions [10]. Therefore, it would be interesting to analyze the effects of POLA1 inhibitors specifically in cancer cells harboring these mutations. Unfortunately, a Phase I clinical trial in patients with advanced ovarian cancer displayed reduced bioavailability of ST1926 due to glucuroconjugation [36] and was therefore not further investigated. Nevertheless, ST1926 was able to reduce tumor burden and prolong survival in a murine model.

In conclusion, our study suggests that the synthetically lethal effects of simultaneous impairment of ATR and POLA1 in cancer cells might represent a novel and promising approach for individualized cancer therapy. Specific functional POLA1 mutations could potentially serve as a new biomarker for selection of tumors with an increased sensitivity towards ATR or CHK1 inhibitors and, vice versa, CHK1 mutations might serve as a new biomarker to predict an increased sensitivity towards POLA1 inhibitors. Currently, novel compounds with POLA1 inhibitory activity are tested in murine xenograft models [7]. Interestingly, two novel dual inhibitors, MIR002 and GEM144, have been shown to specifically inhibit POLA1, causing S-phase arrest and activation of the ATR pathway, and have also demonstrated significant antitumor activity when administered orally in two different human orthotopic malignant pleural mesothelioma xenografts [11]. Moreover, many chemical ATR and CHK1 inhibitors are already investigated in phase I or II clinical trials (e.g. the ATR inhibitor AZD6738 [29,45] and M6620 [48] or CHK1 inhibitors MK-8776 [44], LY2603618 [37] and SRA737 [25,28]). These studies, especially when stratifiable by mutational tumor status in regard to POLA1, ATR and CHK1, respectively, will further elucidate the potential clinical implications of our study.

Funding

This work was funded in part by a grant of 10.13039/501100001659 Deutsche Forschungsgemeinschaft to E. G. (DFG 762/3-2 ).

CRediT authorship contribution statement

Hanna Elisabeth Schneider: Writing – original draft, Visualization, Methodology, Investigation, Formal analysis. Lisa-Maria Schmitt: Visualization, Investigation. Albert Job: Supervision, Methodology. Brigitte Lankat-Buttgereit: Supervision, Methodology. Thomas Gress: Resources, Funding acquisition. Malte Buchholz: Supervision, Resources. Eike Gallmeier: Writing – review & editing, Supervision, Resources, Project administration, Methodology, Funding acquisition, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Data availability statement

The data presented in the study is available in the article and on reasonable request from the corresponding author.

Acknowledgements

We thank Bettina Geisel's technical assistance for experiments and the team of the FACS Core facility. Servier Medical Art was used to create the graphical abstract (https://smart.servier.com, accessed on 21 July 2024), provided by Servier and licensed under a Creative Commons Attribution 4.0 unported license. Illustrations have been modified in colour.

This work is part of the doctoral thesis of HES.
==== Refs
References

1 Abdel-Samad R. Aouad P. Gali-Muhtasib H. Sweidan Z. Hmadi R. Kadara H. D'Andrea E.L. Fucci A. Pisano C. Darwiche N. Mechanism of action of the atypical retinoid ST1926 in colorectal cancer: DNA damage and DNA polymerase α Am. J. Cancer Res. 8 1 2018 39 55 29416919
2 Aouad P. Saikali M. Abdel-Samad R. Fostok S. El-Houjeiri L. Pisano C. Talhouk R. Darwiche N. Antitumor activities of the synthetic retinoid ST1926 in two-dimensional and three-dimensional human breast cancer models Anticancer Drugs 28 7 2017 757 770 28471809
3 Basma H. Ghayad S.E. Rammal G. Mancinelli A. Harajly M. Ghamloush F. Dweik L. El-Eit R. Zalzali H. Rabeh W. Pisano C. Darwiche N. Saab R. The synthetic retinoid ST1926 as a novel therapeutic agent in rhabdomyosarcoma Int. J. Cancer 138 6 2016 1528 1537 26453552
4 Boulares A.H. Yakovlev A.G. Ivanova V. Stoica B.A. Wang G. Iyer S. Smulson M. Role of poly(ADP-ribose) polymerase (PARP) cleavage in apoptosis. Caspase 3-resistant PARP mutant increases rates of apoptosis in transfected cells J. Biol. Chem. 274 33 1999 22932 22940 10438458
5 Brown E.J. Baltimore D. ATR disruption leads to chromosomal fragmentation and early embryonic lethality Genes Dev. 14 4 2000 397 402 10691732
6 Cimprich K.A. Cortez D. ATR: an essential regulator of genome integrity Nat. Rev. Mol. Cell Biol. 9 8 2008 616 627 18594563
7 Cincinelli R. Musso L. Guglielmi M.B. La Porta I. Fucci A. Luca D'Andrea E. Cardile F. Colelli F. Signorino G. Darwiche N. Gervasoni S. Vistoli G. Pisano C. Dallavalle S. Novel adamantyl retinoid-related molecules with POLA1 inhibitory activity Bioorg. Chem. 104 2020 104253
8 Coloma J. Johnson R.E. Prakash L. Prakash S. Aggarwal A.K. Human DNA polymerase α in binary complex with a DNA:DNA template-primer Sci. Rep. 6 2016 23784 27032819
9 Cortez D. Guntuku S. Qin J. Elledge S.J. ATR and ATRIP: partners in checkpoint signaling Science 294 5547 2001 1713 1716 11721054
10 Anon. Cosmic. 2023. COSMIC - catalogue of somatic mutations in cancer. https://cancer.sanger.ac.uk/cosmic. Accessed 9 April 2024.
11 Dallavalle S. Musso L. Cincinelli R. Darwiche N. Gervasoni S. Vistoli G. Guglielmi M.B. La Porta I. Pizzulo M. Modica E. Prosperi F. Signorino G. Colelli F. Cardile F. Fucci A. D'Andrea E.L. Riccio A. Pisano C. Antitumor activity of novel POLA1-HDAC11 dual inhibitors Eur. J. Med. Chem. 228 2022 113971
12 El-Baba C. Ayache Z. Goli M. Hayar B. Kawtharani Z. Pisano C. Kobeissy F. Mechref Y. Darwiche N. The antitumor effect of the DNA polymerase alpha inhibitor ST1926 in glioblastoma: a proteomics approach Int. J. Mol. Sci. 24 2023 18
13 Elmore S. Apoptosis: a review of programmed cell death Toxicol. Pathol. 35 4 2007 495 516 17562483
14 Ercilla A. Benada J. Amitash S. Zonderland G. Baldi G. Somyajit K. Ochs F. Costanzo V. Lukas J. Toledo L. Physiological tolerance to ssDNA enables strand uncoupling during DNA replication Cell Rep. 30 7 2020 2416 2429 e7 32075739
15 Farmer H. McCabe N. Lord C.J. Tutt A.N.J. Johnson D.A. Richardson T.B. Santarosa M. Dillon K.J. Hickson I. Knights C. Martin N.M.B. Jackson S.P. Smith G.C.M. Ashworth A. Targeting the DNA repair defect in BRCA mutant cells as a therapeutic strategy Nature 434 7035 2005 917 921 15829967
16 Gallmeier E. Hermann P.C. Mueller M.-T. Machado J.G. Ziesch A. Toni E.N.de Palagyi A. Eisen C. Ellwart J.W. Rivera J. Rubio-Viqueira B. Hidalgo M. Bunz F. Göke B. Heeschen C Inhibition of ataxia telangiectasia- and Rad3-related function abrogates the in vitro and in vivo tumorigenicity of human colon cancer cells through depletion of the CD133(+) tumor-initiating cell fraction Stem Cells (1981) 29 3 2011 418 429
17 Gallmeier E. Hucl T. Calhoun E.S. Cunningham S.C. Bunz F. Brody J.R. Kern S.E. Gene-specific selection against experimental fanconi anemia gene inactivation in human cancer Cancer Biol. Ther. 6 5 2007 654 660 17387268
18 Galluzzi L. López-Soto A. Kumar S. Kroemer G. Caspases connect cell-death signaling to organismal homeostasis Immunity. 44 2 2016 221 231 26885855
19 Han T. Goralski M. Capota E. Padrick S.B. Kim J. Xie Y. Nijhawan D. The antitumor toxin CD437 is a direct inhibitor of DNA polymerase α Nat. Chem. Biol. 12 7 2016 511 515 27182663
20 Helleday T. Petermann E. Lundin C. Hodgson B. Sharma R.A. DNA repair pathways as targets for cancer therapy Nature Rev. Cancer 8 3 2008 193 204 18256616
21 Hocke S. Guo Y. Job A. Orth M. Ziesch A. Lauber K. Toni E.N.de Gress T.M. Herbst A. Göke B. Gallmeier E A synthetic lethal screen identifies ATR-inhibition as a novel therapeutic approach for POLD1-deficient cancers Oncotarget. 7 6 2016 7080 7095 26755646
22 Hurley P.J. Wilsker D. Bunz F. Human cancer cells require ATR for cell cycle progression following exposure to ionizing radiation Oncogene 26 18 2007 2535 2542 17043640
23 Job A. Schmitt L.-M. Wenserski L.von Lankat-Buttgereit B. Gress T.M. Buchholz M. Gallmeier E. Inactivation of PRIM1 function sensitizes cancer cells to ATR and CHK1 inhibitors Neoplasia 20 11 2018 1135 1143 30257222
24 Job A. Tatura M. Schäfer C. Lutz V. Schneider H. Lankat-Buttgereit B. Zielinski A. Borgmann K. Bauer C. Gress T.M. Buchholz M. Gallmeier E. The POLD1(R689W) variant increases the sensitivity of colorectal cancer cells to ATR and CHK1 inhibitors Sci. Rep. 10 1 2020 18924 33144657
25 Jones R. Plummer R. Moreno V. Carter L. Roda D. Garralda E. Kristeleit R. Sarker D. Arkenau T. Roxburgh P. Walter H.S. Blagden S. Anthoney A. Klencke B.J. Kowalski M.M. Banerji U. A phase I/II trial of oral SRA737 (a Chk1 Inhibitor) given in combination with low-dose gemcitabine in patients with advanced cancer Clin. Cancer Res 29 2 2023 331 340 36378548
26 Kamel D. Gray C. Walia J.S. Kumar V. PARP Inhibitor Drugs in the Treatment of Breast, Ovarian, Prostate and Pancreatic Cancers: An Update of Clinical Trials Curr. Drug Targets. 19 1 2018 21 37 28699513
27 Kim C.J. Lee J.H. Song J.W. Cho Y.G. Kim S.Y. Nam S.W. Yoo N.J. Park W.S. Lee J.Y. Chk1 frameshift mutation in sporadic and hereditary non-polyposis colorectal cancers with microsatellite instability Eur. J. Surg. Oncol. 33 5 2007 580 585 17408908
28 Kristeleit R. Plummer R. Jones R. Carter L. Blagden S. Sarker D. Arkenau T. Evans T.R.J. Danson S. Symeonides S.N. Veal G.J. Klencke B.J. Kowalski M.M. Banerji U. A Phase 1/2 trial of SRA737 (a Chk1 inhibitor) administered orally in patients with advanced cancer Br. J. Cancer 129 1 2023 38 45 37120671
29 Kwon M. Kim G. Kim R. Kim K.-T. Kim S.T. Smith S. Mortimer P.G.S. Hong J.Y. Loembé A.-B. Irurzun-Arana I. Koulai L. Kim K.-M. Kang W.K. Dean E. Park W.-Y. Lee J. Phase II study of ceralasertib (AZD6738) in combination with durvalumab in patients with advanced gastric cancer J. ImmunOther Cancer 10 2022 7
30 Lee J. Kumagai A. Dunphy W.G. The Rad9-Hus1-Rad1 checkpoint clamp regulates interaction of TopBP1 with ATR J. Biol. Chem. 282 38 2007 28036 28044 17636252
31 Nicoletti I. Migliorati G. Pagliacci M.C. Grignani F. Riccardi C. A rapid and simple method for measuring thymocyte apoptosis by propidium iodide staining and flow cytometry J. Immunol. Methods 139 2 1991 271 279 1710634
32 O'Neil N.J. Bailey M.L. Hieter P. Synthetic lethality and cancer Nat. Rev. Genet. 18 10 2017 613 623 28649135
33 Palles C. Cazier J.-B. Howarth K.M. Domingo E. Jones A.M. Broderick P. Kemp Z. Spain S.L. Guarino E. Salguero I. Sherborne A. Chubb D. Carvajal-Carmona L.G. Ma Y. Kaur K. Dobbins S. Barclay E. Gorman M. Martin L. Kovac M.B. Humphray S. Thomas H.J.W. Maher E. Evans G. Lucassen A. Cummings C. Stevens M. Walker L. Halliday D. Armstrong R. Paterson J. Hodgson S. Homfray T. Side L. Izatt L. Donaldson A. Tomkins S. Morrison P. Goodman S. Brewer C. Henderson A. Davidson R. Murday V. Cook J. Haites N. Bishop T. Sheridan E. Green A. Marks C. Carpenter S. Broughton M. Greenhalge L. Suri M. Donnelly P. Bell J. Bentley D. McVean G. Ratcliffe P. Taylor J. Wilkie A. Broxholme J. Buck D. Cornall R. Gregory L. Knight J. Lunter G. Tomlinson I. Kingsbury Z. Grocock R. Hatton E. Holmes C.C. Hughes L. Humburg P. Kanapin A. Murray L. Rimmer A. Petridis C. Roylance R. Sawyer E.J. Kerr D.J. Clark S. Grimes J. Kearsey S.E. Houlston R.S. Germline mutations affecting the proofreading domains of POLE and POLD1 predispose to colorectal adenomas and carcinomas Nat. Genet. 45 2 2013 136 144 23263490
34 Qiu Z. Oleinick N.L. Zhang J. ATR/CHK1 inhibitors and cancer therapy RadiOther Oncol. 126 3 2018 450 464 29054375
35 Rogers R.F. Walton M.I. Cherry D.L. Collins I. Clarke P.A. Garrett M.D. Workman P. CHK1 inhibition is synthetically lethal with loss of B-Family DNA polymerase function in human lung and colorectal cancer cells Cancer Res. 80 8 2020 1735 1747 32161100
36 Sala F. Zucchetti M. Bagnati R. D'Incalci M. Pace S. Capocasa F. Marangon E. Development and validation of a liquid chromatography-tandem mass spectrometry method for the determination of ST1926, a novel oral antitumor agent, adamantyl retinoid derivative, in plasma of patients in a Phase I study J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 877 27 2009 3118 3126
37 Scagliotti G. Kang J.H. Smith D. Rosenberg R. Park K. Kim S.-W. Su W.-C. Boyd T.E. Richards D.A. Novello S. Hynes S.M. Myrand S.P. Lin J. Smyth E.N. Wijayawardana S. Lin A.B. Pinder-Schenck M. Phase II evaluation of LY2603618, a first-generation CHK1 inhibitor, in combination with pemetrexed in patients with advanced or metastatic non-small cell lung cancer Invest. New Drugs 34 5 2016 625 635 27350064
38 Soldani C. Scovassi A.I. Poly(ADP-ribose) polymerase-1 cleavage during apoptosis: an update Apoptosis 7 4 2002 321 328 12101391
39 Takahashi N. Kim S. Schultz C.W. Rajapakse V.N. Zhang Y. Redon C.E. Fu H. Pongor L. Kumar S. Pommier Y. Aladjem M.I. Thomas A Replication stress defines distinct molecular subtypes across cancers Cancer Res. Commun. 2 6 2022 503 517 36381660
40 Taricani L. Shanahan F. Parry D. Replication stress activates DNA polymerase alpha-associated Chk1 Cell Cycle 8 3 2009 482 489 19177015
41 Toledo L. Neelsen K.J. Lukas J Replication catastrophe: when a checkpoint fails because of exhaustion Mol. Cell 66 6 2017 735 749 28622519
42 Toledo L.I. Altmeyer M. Rask M.-B. Lukas C. Larsen D.H. Povlsen L.K. Bekker-Jensen S. Mailand N. Bartek J. Lukas J ATR prohibits replication catastrophe by preventing global exhaustion of RPA Cell 155 5 2013 1088 1103 24267891
43 Valli C. Paroni G. Di Francesco A.M. Riccardi R. Tavecchio M. Erba E. Boldetti A. Gianni' M. Fratelli M. Pisano C. Merlini L. Antoccia A. Cenciarelli C. Terao M. Garattini E Atypical retinoids ST1926 and CD437 are S-phase-specific agents causing DNA double-strand breaks: significance for the cytotoxic and antiproliferative activity Mol. Cancer Ther. 7 9 2008 2941 2954 18790775
44 Webster J.A. Tibes R. Morris L. Blackford A.L. Litzow M. Patnaik M. Rosner G.L. Gojo I. Kinders R. Wang L. Doyle L.A. Huntoon C.J. Karnitz L.M. Kaufmann S.H. Karp J.E. Smith B.D. Randomized phase II trial of cytosine arabinoside with and without the CHK1 inhibitor MK-8776 in relapsed and refractory acute myeloid leukemia Leuk. Res. 61 2017 108 116 28957699
45 Wethington S.L. Shah P.D. Martin L. Tanyi J.L. Latif N. Morgan M. Torigian D.A. Rodriguez D. Smith S.A. Dean E. Domchek S.M. Drapkin R. Shih I.-M. Brown E.J. Hwang W.-T. Armstrong D.K. Gaillard S. Giuntoli R. Simpkins F. Combination ATR (ceralasertib) and PARP (olaparib) Inhibitor (CAPRI) trial in acquired PARP inhibitor-resistant homologous recombination-deficient ovarian cancer Clin. Cancer Res. 29 15 2023 2800 2807 37097611
46 Wilsker D. Bunz F. Loss of ataxia telangiectasia mutated- and Rad3-related function potentiates the effects of chemotherapeutic drugs on cancer cell survival Mol. Cancer Ther. 6 4 2007 1406 1413 17431119
47 Wlodkowic D. Telford W. Skommer J. Darzynkiewicz Z. Apoptosis and beyond: cytometry in studies of programmed cell death Methods Cell Biol. 103 2011 55 98 21722800
48 Yap T.A. O'Carrigan B. Penney M.S. Lim J.S. Brown J.S. de Miguel Luken Maria J Tunariu N. Perez-Lopez R. Rodrigues D.N. Riisnaes R. Figueiredo I. Carreira S. Hare B. McDermott K. Khalique S. Williamson C.T. Natrajan R. Pettitt S.J. Lord C.J. Banerji U. Pollard J. Lopez J. Bono J.S.de Phase I trial of first-in-class ATR Inhibitor M6620 (VX-970) as monotherapy or in combination with carboplatin in patients with advanced solid tumors J. Clin. Oncol. 38 27 2020 3195 3204 32568634
49 Zhang Y. Hunter T. Roles of Chk1 in cell biology and cancer therapy Int. J. Cancer 134 5 2014 1013 1023 23613359
