
==== Front
Sci Rep
Sci Rep
Scientific Reports
2045-2322
Nature Publishing Group UK London

39223184
71234
10.1038/s41598-024-71234-4
Article
Green synthesis of copper oxide nanoparticles using walnut shell and their size dependent anticancer effects on breast and colorectal cancer cell lines
Abdollahzadeh Hanieh 1
http://orcid.org/0000-0002-0572-2980
Pazhang Yaghub y.pazhang@urmia.ac.ir

12
Zamani Asghar 3
Sharafi Yousef 4
1 https://ror.org/032fk0x53 grid.412763.5 0000 0004 0442 8645 Department of Biology, Faculty of Sciences, Urmia University, Urmia, Iran
2 https://ror.org/032fk0x53 grid.412763.5 0000 0004 0442 8645 Department of Cellular and Molecular Biotechnology, Institute of Biotechnology, Urmia University, Urmia, Iran
3 https://ror.org/032fk0x53 grid.412763.5 0000 0004 0442 8645 Department of Nanotechnology, Faculty of Chemistry, Urmia University, Urmia, Iran
4 grid.473705.2 0000 0001 0681 7351 Dryland Agricultural Research Institute, Agricultural Research, Education and Extension Organization(AREEO), Maragheh, Iran
2 9 2024
2 9 2024
2024
14 2032312 7 2024
26 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Metal oxide nanoparticles(NPs) contain unique properties which have made them attractive agents in cancer treatment. The CuO nanoparticles were green synthesized using walnut shell powder in different calcination temperatures (400°, 500°, 700°, and 900 °C). The CuO nanoparticles are characterized by FTIR, XRD, BET, SEM and DLS analyses. SEM and DLS analyses showed that by increasing the required calcination temperature for synthesizing the NPs, their size was increased. DPPH analysis displayed no significant anti-oxidative properties of the CuO NPs. The MTT analysis showed that all synthesized CuO NPs exhibited cytotoxic effects on MCF-7, HCT-116, and HEK-293 cell lines. Among the CuO NPs, the CuO-900 NPs showed the least cytotoxic effect on the HEK-293 cell line (IC50 = 330.8 µg/ml). Hoechst staining and real-time analysis suggested that the CuO-900 NPs induced apoptosis by elevation of p53 and Bax genes expression levels. Also, the CuO-900 NPs increased the Nrf-2 gene expression level in MCF-7 cells, despite the HCT-116 cells. As can be concluded from the results, the CuO-900 NPs exerted promising cytotoxic effects on breast and colon cancer cells.

Keywords

Walnut shell
Green synthesis
CuO nanoparticles
Cancer therapy
Apoptosis
p53
Nrf-2
Subject terms

Biochemistry
Cancer
Cell biology
Chemical biology
Neuroscience
Plant sciences
Nanoscience and technology
issue-copyright-statement© Springer Nature Limited 2024
==== Body
pmcIntroduction

Metal oxide nanoparticles have gained more attentions rather than other nanoparticles due to their unique properties and their applications in various fields, such as anti-microbial agents, in semi-conducting devices, textile industry, microelectronics, cosmeceutical products, and biomedical fields1. Because of the emerging anticancer effects of the metal oxide NPs, they have been considered as agents to remove cancer cells in preclinical studies2. In recent years, the synthesis of CuO nanoparticles has been the goal of scientific research because of their various application especially biomedical applications3–5. It has been reported that CuO nanoparticles are more cytotoxic to human cells rather than other metal oxide NPs6. However, the anti-cancer effects of CuO NPs were studied on many cancer types, including liver7, lung8, and breast9,10, cervical11 and pancreatic12 cancers. In 2023, 1,958,310 new cancer cases and 609,820 cancer deaths are estimated to occur in the United States13. Despite the existence of multiple approaches to treat cancer including chemotherapy, immunotherapy, radiotherapy, and surgery, not only the disease is still a main health challenge in worldwide but also its related deaths are increasing year by year13. Therefore, finding new agents and approaches to treat cancer is one of significant health challenges in the field of medical science. Based on the WHO report, three prevalent cancer types in women include breast, lung and colorectal cancers. On another hand, the most prevalent cancer types in the men are prostate, lung, and colorectal cancers14. Increase in cancer prevalence is related partly to the resistance of cancer cells to the conventional therapies. Beside the conventional therapeutic strategies, capabilities of nanoparticles as an agent to treat cancer and to effectively deliver anticancer drugs have made them as a hopeful approach for overcoming cancer15.

Numerous synthesis procedures have been developed to synthesize CuO nanoparticles, including co-precipitation, sol–gel technique, thermal decomposition, and hydrothermal methods. However, these techniques, in addition to the environmental impacts, are usually hard to produce on the industrial scale. Accordingly, more attention has been recently paid to the green approach and biological method to the synthesis of nanoparticles, chiefly copper oxide nanoparticles16–19.

Agricultural waste biomass particularly lignocellulosic wastes such as nut shells have increasingly attracted some attention as a low-cost renewable resource in various fields20,21. Walnut is always a popular fruit in the world. Based on incomplete statistics, thousands of tons of walnuts are consumed every year in the world and the shells are usually cast-off. More recently, we synthesized nanostructured magnesium oxide22, alumina23, and cerium oxide nanoparticles24 by walnut shell. This abundantly available agricultural waste is composed of cellulose, hemicellulose, and lignin5,25 which can act as fuel or sacrificial templates in preparing metal oxide nanostructures. In this protocol, walnut shell grind was mixed with aqueous solutions of metal nitrate in diverse ratios without using any toxic chemicals. Stirring followed by evaporation and calcination of paste, resulting in desired nanostructures. In this paper, we present similar process for the preparation of CuO nanoparticles with different sizes by using walnut shell powder. The aim of this study is the green synthesis of different dimensions of CuO NPs to investigate their anticancer effects.

Material and methods

General remarks

Copper(II) nitrate hexahydrate, Cu(NO3)2.6H2O, from Merck and used without further purification. The walnut shell from a local walnut tree in Urmia (Iran) was crushed using a high-speed rotary cutting mill. X-ray diffraction patterns of the obtained materials were recorded at room temperature on Shimadzu XRD-6000 diffractometer with CuKα irradiation. The morphology of materials was observed by Hitachi S-4100 FESEM instrument (Japan). Also, BET analysis was performed by Belsorp-mini II-BEL, Inc. analyzer at 77 K. Fourier transform infrared (FT-IR) spectra were attained by a Bruker Vector 22 FT-IR spectrophotometer under ambient conditions in a KBr/Nujol mull in the range of 400–4000 cm−1.

Copper oxide nanoparticles preparation

Walnuts were purchased from local farmers and then the walnut shells separated from the kernel. Next, the walnut shells were grinded and the walnut shell powder was prepared. Copper oxide NPs was synthesized in the presence of walnut shell powder 30 g and copper(II) nitrate hexahydrate 6.65 g in 50 mL of deionized water (Millipore, Milli-Q grade). After 4 h stirring, the water was evaporated by a rotary evaporator under low pressure. The resulting paste was subsequently calcined at 400 °C for 4 h (at a heating rate of 10 °C/min) under open-air conditions to give a black solid (CuO-400). For comparison, CuO-500, CuO-700, and CuO-900 NPs were prepared at 500, 700, and 900 °C, respectively. A schematic diagram of Copper oxide NP preparation is shown in Fig. 1.Fig. 1 Schematic diagram of copper oxide NP preparation.

CuO NPs DPPH radical scavenging capacity.

DPPH test was employed to measure the CuO NPs antioxidant capacity. Shortly, the CuO NPs added to 3 ml of 0.1 mM of DPPH (Sigma) methanolic solution (Merck) at different concentrations (12.5 to 400 µg/ml) and then kept in dark at 37 °C for 30 min. The methanolic solution was applied as a control, and the Butylated hydroxyl anisole (BHA, Sigma) solution was used as standard. Next, the samples absorbance was read at 517 nm by a spectrophotometer. Eventually, the CuONPs free radical scavenging activity was evaluated by Eq. (1):1 %Free Radical Scavenging Capacity=Ac-As/Ac×100

In Eq. (1), the Ac and As are OD of control and standard or CuO NPs in methanolic solution, respectively26.

Cell culture and treatment

HCT-116, MCF-7 (cancer cells) and HEK-293 cells (healthy or normal cell) were obtained from the iranian pasture institute. Then, the cells maintained in DMEM high glucose medium (Gibco) containing 10% FBS (Gibco) and glutamine (Merck) enricnhed with 1% penicillin–streptomycin(Biowest) in CO2-incubator at 37 °C. For evaluation the cytotoxic effect of the CuO nanoparticles produced at different temperatures (400 °C, 500 °C, 700 °C, and 900 °C) as well as CuO bulk, 5 × 103 cells were seeded in 96 well plate and exposed to different concentrations of the nanoparticles(20,40, 80 µg/ml prepared in distilled water) for 72 h at 37 °C. After that, 10 µl of MTT dye solution (5mg/ml, Sigma) was added to each well and the plates were incubated at 37 °C in dark. Next, after removing each well medium, 100µl DMSO (Dimethyl sulfoxide, Merck) was poured into each well to dissolve the formazan crystals. Finally, the wells absorbance was read at 570 nm and based on the control wells absorbance, the treated cells viability were calculated and the plots drawn by GraphPad prism Ver. 9.0.0.

Hoechst staining to monitor apoptosis

In the apoptosis process, cells undergo some morphological alterations including nucleus condensation and fragmentation as well as apoptotic body formation27. The Hoechst33342 dye can bind to DNA and monitor the cell nucleus shape. First 2 × 105cells(HCT-116 and MCF-7 cell line) were seeded in each well of 24 well plate, then treated with 80µg/ml concentrations of the CuO nanoparticles produced at 400, 500, 700, and 900 °C as well as CuO bulk for 72 h. In order to Hoechst staining, the cells first washed once by PBS(phosphate buffered saline)and trysinized that followed by fixing in ice cold methanol(Merck) at − 20 °C for 30 min. Thereafter, the cells were centrifuged and the supernatant was discarded and the cell pellets were twice washed in PBS. In the next step, the cells stained by Hoechst 33,342 satin solution(Sigma, 1mg/ml) for 30 min out of light. Finally, the cells were transferred on glass coverslips and photographed by a fluorescent microscope (Zeiss) by a DAPI filter.

Q-PCR to analyze apoptotic and antioxidant genes expression

To evaluate the apoptotic and antioxidant genes expression by real-time PCR method, first, 2 × 106 MCF-7 and HCT-116 cells were seeded in each well of 6-well plate and then exposed to 80 µg/ml concentration of CuO-900 NPs. After that, the cells were trypsinized and centrifuged to obtain the cells pellets. Next, the cells RNAs were extracted by RNXplus kit(Sinaclon, Iran) based on manufacture’s protocol. After determining the RNAs concentrations by a Nanodrop (Biotek), the cDNA synthesis was performed using 1000 ng extracted RNA by cDNA synthesis kit(Parstus, Iran). Next, the samples cDNA were subjected to real-time PCR (Applied Biosystems) in the presence of Bax, Bcl-2, p53, Nrf-2, superoxide dismutase, catalase and Beta-action(as loading control) primers using sybergreen mastermix(Ampliqon) as the following steps:

Denaturation at 94 °C for 5 min, 40 cycles of Denaturation at 94 °C for 30 s, annealing at 58 °C for 30 s, elongation at 72 °C for 30 s.

All the primers sequence was designed by using Oligo 7 software, the primers sequences have been presented at Table 1.Table 1 primer sequences of apoptotic and antioxidant genes.

Gene	Primer	Primer sequence 5ʹ-3ʹ	
Bax	Forward	CGAGCAGGGCGAATGGGGG	
Reverse	GTCCCCGATGCGCTTGAGA	
Bcl-2	Forward	GGGGTGAACTGGGGGAGGATTG	
Reverse	TGCCGGTTCAGGTACTCAGTCA	
P53	Forward	CAACTCACTAGGGGAACCAAAC	
Reverse	AATGCGGACTCTGAACTGATGC	
Nrf-2	Forward	AGAGCTAGATAGTGCCCCTGGA	
Reverse	ATGACCAGGACTTACAGGCAAT	
CAT	Forward	AGCTGGTTAATGCAAATGGGGA	
Reverse	TGTGGCAATGGCGTTAAAAAGA	
SOD	Forward	AGGATGAAGAGAGGCATGTTGG	
Reverse	GTTTCCCGTCTTTGTACTTTCT	
β-Actin	Forward	CAACTGGGACGACATGGAGAAA	
Reverse	GATAGCACAGCCTGGATAGCAA	

Statistical analysis

The experiments were repeated at least three times (n = 3) and the obtained data were analyzed via one or two-way ANOVAs using the Tukey post hoc test by GraphPad prism Ver. 9.0.0 software. The p-value < 0.05, 0.01, 0.001, and 0.0001 were considered as significant difference between the control and treated groups.

Results and discussion

CuO NPs were synthesized in different sizes

The FTIR spectrums of CuO nanoparticles obtained by process described above are presented in Fig. 2. The FTIR spectrum shows peaks at 400–600 cm-1, which can be assigned to the vibrations of Cu–O bonds. Also, peaks at around 1400 cm−1 are attributed to carbon residue that an increased calcination temperature was followed by removal of carbon impurities and shortening of these peaks.Fig. 2 FT-IR analysis. In CuO-900 NPs the peak of wavenumber 1400 cm−1 has been disappeared.

X-ray diffraction(XRD) analysis of synthesized different-sized CuO NPs were shown in Fig. 3. The XRD pattern matched with the monoclinic structure of CuO crystal(JCPDS card 80–1917). An intense diffraction peak at 38.77° was detected corresponding to the lattice plane (111), in addition to this, some low-intensity peaks at 35.74° (002) and 48.94° (202), were also detected. The effect of temperature was also studied on crystal growth, showing the small changes in the sharpness of peaks and growth of (111) and (002) planes in CuO-400, CuO-500, CuO-700, and CuO-900, respectively. The crystallite size of different sizes CuO NPs was determined through Scherrer’s Eq. (2) and full-width half maximum (FWHM) of the most intense (111) peak.2 D=0.89λ/βcosθ

λ=X-ray wavelength (0.15418 nm), β= FWHM, D = crystallite size, θ= Bragg's angle.Fig. 3 X-ray diffraction (XRD) pattern of different size CuO NPs, (a) CuO-400, (b) CuO-500, (c) CuO-700 and (d) CuO-900.

The average crystallite size was found to be 28, 32, 35, and 42 nm for CuO-400, CuO-500, CuO-700 and CuO-900, respectively.

Additionally, the specific surface area and particle sizes of CuO NPs can be determined using the BET surface area (Table 1). The method works based on nitrogen gas adsorption at a constant temperature. This analysis indicated the average thermodynamic size of CuO-400 to be 71 nm. It has been observed that with the increase in temperature of calcination the average size increase to 127, 201, and 295 nm for CuO-500, CuO-700, and CuO-900, respectively. An increase in calcination temperature results in growing of crystals (coarsening or Ostwald ripening) and hence higher particle as well as crystallite sizes.

The BET results were further supported by FESEM images and a histogram of the particle size distribution (Fig. 4 and Table 2). From the FESEM images, it is clearly evident that with raising temperature, the average size and size distribution of nanoparticles also increases, and the interesting thing is that rod-like nanoparticles are also seen in CuO-900. It is also evident that nanoparticles at higher temperatures are more geometrically regular than nanoparticles prepared at lower temperatures. By carefully looking at the histograms, it can be seen that the highest frequency of nanoparticles in all 4 samples is related to nanoparticles under 100 nm, and in sample CuO-400, it is related to nanoparticles under 50 nm, but with increasing temperature, the size distribution of nanoparticles has expanded to larger values. As can be seen, the size of the particles obtained from DLS analysis is much larger than the size obtained using the FESEM histogram (Fig. 5). This difference is due to the principle that the DLS technique provides the hydrodynamic diameter of agglomerated particles rather than the real size of nanoparticles28.An increase in calcination temperature results in larger size of agglomerated particles and bimodal distribution.Fig. 4 FESEM images and size distribution histogram of (a) CuO-400, (b) CuO-500, (c) CuO-700 and (d) CuO-900.

Table 2 Surface area, BET particle sizes and FESEM particle sizes of copper oxide nanoparticles.

Sample	BET surface area (m2/g)	BET particle size (nm)	FESEM particle sizes (nm)	
CuO-400	13.4	71	69	
CuO-500	7.5	127	120	
CuO-700	4.7	201	195	
CuO-900	3.2	295	287	

Fig. 5 Dynamic Light Scattering analysis of CuO NPs. (a) CuO-400, (b) CuO-500, (c) CuO-700, and (d) CuO-900 NPs. As the results show the size of the CuO-NPs were increased by raising the calcinations temperature.

The proposed mechanism of the CuO nanoparticle formation is pictured in Fig. 6. It is possible that the Cu2+ ions were dispersed on the walnut shell containing cellulose, hemicellulose, and lignin via coordination with their alkoxy, hydroxyl, and other oxygenated groups. Therefore, walnut shell act as an adsorbent for the copper precursors. After adoption and dispersion of the Cu2+ on the walnut shell and calcination, the template was removed (walnut shell as sacrified template or fuel) by transformation of CO, CO2, and H2O (Fig. 6). Simultaneously, due to temperature increase CuO is formed with removal of template. The product should be nanostructured due to two reasons including 1-use of the template and 2- release of gases which increase the surface area (Fig. 6).Fig. 6 Proposed mechanism of the CuO NPs formation.

Fig. 7 Antioxidant capacity. The CuO NPs showed almost no DPPH scanenging capacity. BHA: Butylated hydroxyl anisole. ****p < 0.0001.

CuO nanoparticles especially CuO-900 NPs exerted anticancer effects

To determine cytotoxic effects of the synthesized CuO nanoparticles, the MCF-7, HCT-116, and HEK-293 cell lines were treated with different concentrations(20, 40, and 80 µg/ml) of the CuO nanoparticles(CuO-400, CuO-500, CuO-700, and CuO-900) as well as CuO bulk for 72 h (Figs. 8, 9, 10, 11 and 12). Because the CuO nanoparticles exhibited the most cytotoxic effects in 72 h (Figs. 8, 9, 10, 11 and 12), so, the treatment time was chosen to calculate the IC50 values (Table 3). After analyzing the MTT data, the nanoparticles IC50 values were calculated and summarized in Table 1. As the table showed, the nanoparticles exerted cytotoxic effects on the MCF-7, HCT-116, and HEK-293 cell lines, but the CuO-900 NPs showed lesser cytotoxic effect on HEK-293 cell line(IC50 = 330.8 µg/ml, Table 3) compared with the other CuO NPs. Accordingly, the CuO-900 nanoparticles exhibited an appropriate anticancer effect due to their lesser cytotoxic effects on the normal cell line, so, the CuO nanoparticles were chosen for further studies. As Figs. 8, 9, 10, 11 and 12 showed, the cytotoxic effects of all CuO NPs and also the CuO-bulk were in a time and dose-dependent manner. In a more recent work, Dutta et al. reported that biogenic CuO NPs derived from Erythrina variegate display cytotoxic effect on HeLa cell line(IC50 = 48 µg/ml), but the nanoparticles showed lesser toxic effect on HEK293 cell line29. In another work, the CuO nanoparticles synthesized via Annona muricata extract reduced breast cancer cells proliferation10. Additionaly, in another work, the CuO NPs derived from Houttuynia cordata displayed cytotoxic effects on cervical cancer cells11. Moreover, Sankar et al. have reported that CuO NPs synthesized from Ficus religiosa extract reduced A549 cell viability in dose dependent manner30. It has been reported that CuO NPs exhibited dose dependent cytotoxic effect on PANC-1 cancer cell line12. Therefore, this work results were similar to the previous works. Moreover, our results showed that the anticancer effect of the CuO NPs is correlated to the size of the NPs. The CuO-900 NPs exerted lower cytotoxic effects on HEK-293 cell line rather than other CuO NPs. Because IC50 value of the CuO-900 NPs on HUVEC cells was higher than it on MCF-7 and HCT-116 cells(Table 3), therefore, the CuO NPs were chosen as an appropriate anticancer agent to analyze the apoptotic and antioxidant genes expression in MCF-7 and HCT-116 cell lines.Fig. 8 Cytotoxic effects of CuO-400 NPs on MCF-7, HCT-116 and HEK-293 cell lines. CuO-400 NPs exhibited cytotoxic effect in all concentrations. Control: untreated cells. ****p < 0.0001.

Fig. 9 Effect of CuO-500 NPs on MCF-7, HCT-116 and HEK-293 cells viability. CuO-500 NPs reduced viability of the cells. Control: untreated cells. ****p < 0.0001.

Fig. 10 CuO-700 NPs’ cell viability reducing effect. CuO-700 decreased viability of MCF-7, HCT-116 and HEK-293 cell lines. Control: untreated cells. ****p < 0.0001.

Fig. 11 CuO-900 NPscytotoxic effect on MCF-7, HCT-116 and HEK-293 cell lines. CuO-900 suppressed the growth of the cell in all applied concentrations. Control: untreated cells. ****p < 0.0001.

Fig. 12 Cytotoxic effects of CuO NPs on MCF-7, HCT-116 and HEK-293 cell lines. CuO-Bulk exerted cytotoxic effect in all concentrations on the cells. Control: untreated cells. ****p < 0.0001.

Table 3 IC50 values(µg/ml) of CuO NPs and CuO-Bulk on HEK-293, HCT-116 and MCF-7 cells.

Cell line	CuO-400	CuO-500	CuO-700	CuO-900	CuO-Bulk	
HEK-293	24.59 ± 2.8	30.08 ± 3.7	108.9 ± 9.1	330.8 ± 22.6	22.27 ± 2.4	
HCT-116	65.14 ± 5.1	47.98 ± 3.8	128.8 ± 10.4	27.41 ± 3.2	46.56 ± 4.1	
MCF-7	84.79 ± 6.3	28.49 ± 3.4	221.7 ± 15.8	75.73 ± 5.7	16.74 ± 1.6	

All of the CuO nanoparticles induced apoptotic cell death

Apoptosis is a type of cell death that removes unwanted cells without damaging other cells; Therefore, this type of death is an important way for removing cancer cells31. Benguigui et al. reported that CuO NPs induce apoptosis in the PANC-1 cell line12. In another study, CuO NPs induced apoptosis in HepG2 cells7. In apoptotic cells, the cell nucleus undergoes some alterations, including condensation in early apoptosis and fragmentation in late apoptosis32. Dutta et al. showed biogenic CuO NPs induce apoptosis in HeLa cells29. In this work, the apoptosis inducing effects of the CuO NPs were analysed by Hoechst 33,342 staining to detect the apoptotic cells nuclei. As shown in Fig. 13, in the treated cells, the dense or fragmented nuclei were observed. In the HCT-116 cells, the most apoptotic nuclei were observed in the CuO-900 NPs treated cells, and the least apoptotic nuclei were obtained in CuO-700 treated cells (Fig. 13a). In the MCF-7 cells, the CuO bulk induced the most apoptotic nuclei. Additionally , in the cells, the most and least apoptotic nuclei were seen in CuO-500 and CuO-700 NPs treated cells, respectively (Fig. 13b). The results suggest that the cell viability reduction in the treated cells can be exerted by apoptosis induction. These data confirmed the MTT assay results.Fig. 13 Fluorescence micrographs of Hoechst staining (a) HCT-116 and (b) MCF-7 cell lines. The apoptotic nuclei are shown by red arrows, in the treated cells the number of the apoptotic nuclei are more than intact nuclei. The most apoptotic nuclei are seen in CuO-900 and CuO-bulk treated cells, respectively. The scale bar is 50 µM. Control: untreated cells, CuO-400: CuO-400 treated cells, CuO-500: CuO-500 treated cells, CuO-700: CuO-700 treated cells, CuO-900: CuO-900 treated cells, CuO-Bulk: CuO-Bulk treated cells.

Effect of CuO-900 nanoparticles on apoptotic genes expression

To illuminate the role of the CuO-NPs on apoptosis induction, real-time PCR analysis was done. As Fig. 14b showed, in treated MCF-7 cells, the expression levels of p53 and Bax genes were higher than untreated cells (p53:pcontrol vs treated < 0.0001, Bax: pcontrol vs treated < 0.05) while the expression level of Bcl-2 was not significantly altered in compared to the untreated cells(p = 0.9994). As shown in Fig. 1a, the expression level of p53 and Bax genes was increased in HCT-116 treated cells with compared to untreated cells(p53:pcontrol vs treated = 0.0016, Bax: pcontrol vs treated < 0.0001). In another hand, The expression level of Bcl-2 did not exhibit a significant change in treated cells(p = 0.999). The Bax/Bcl-2 ratio level in MCF-7 and HCT-116 cells were 1.66 and 3.5, respectively. According to an elevation of the Bax/Bcl-2 ratio level, which is an indicator of apoptosis, the results of the real-time analysis confirmed the hoechst 33,342 staining results that indicating apoptosis occurence in CuO-900 NPs treated MCF-7 and HCT-116 cell lines. The results are similar to a recent work’s results, which reported CuO NPs derived from Bacillus Coagulus elevate the Bax/Bcl2-2 level in MCF-7 and SKBR3 cell lines33. It was reported that DNA damage and reactive oxygen species increase the p53 gene expression34. Therefore, CuO-900 NPs may increase the p53 gene expression by DNA damage or ROS production, which leads to apoptosis induction.Fig. 14 Apoptotic and antioxidants genes expression plots. (a) gene expression plot of HCT-116 cells, the expression of Bax and p53 significantly elevated in treated cells, as a while, Nrf-2 gene and other antioxidant genes expression significantly decreased in HCT-116 treated cells. (b) gene expression profile in MCF-7 cells, the expression of Bax, and antioxidant genes increased in compared to control cells. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

CuO-900 NPs exhibit different effect on Nrf-2 gene expression in the MCF-7 and HCT-116 cell lines

The antioxidant activity of the CuO NPs was measured by the DPPH test. As Fig. 7 showed, the CuO NPs did not display antioxidant activity. Despite , in previous works, the green synthesized CuO NPs exhibited antioxidant activity35–37. According to the application of high temperatures in the synthesis procedure of the CuO NPs, it can be suggested that the high temperatures degrade the organic compounds which cause antioxidant activity. To investigate the effect of CuO-900 NPs on the antioxidant genes expression profile, real-time analysis was employed. Nrf-2(nuclear factor erythroid 2-related factor-2) is a transcription factor which plays a pivotal role in the redox state of cells by overexpressing of own gene expression as well as other redox genes expression, such as superoxide dismutase(SOD) and catalase(CAT) enzyme genes38–40. Therefore, Nrf-2 overexpression reduces the oxidative stress in cells41. Based on the role of the Nrf-2 , superoxide dismutase and catalase in the redox state of the cells, their gene expression level were chosen to investigate the redox genes expression analysis in the CuO-900 NPs treated cells. Tabatha et al. showed that CuO NPs activate the Nrf-2 pathway in the JB6 cells42. As shown in Fig. 14b, the Nrf-2 and SOD and CAT genes expression level was increased in MCF-7 treated cells (1.9, 3.4, and 3.3 times, respectively). The effect may be caused by CuO-900 NPs mediated ROS production that activates the Nrf-2 signaling pathway. Reversely, in the HCT-116 treated cells (Fig. 14a), expression level of Nrf-2, SOD, and CAT genes was decreased in compared to untreated cells (0.54, 0.29, and 0.23, respectively). Chen et al. reported that the Nrf-2 signaling pathway is suppressed by a high level of p53 protein43. Therefore, the suppressive effect of the CuO-900 on Nrf-2 expression may be a result of the NPs caused p53 gene overexpression in HCT-116 line. According to the results, based on the higher IC50 value of CuO-900 on MCF-7 cells in compared to HCT-116 cells, the different effect may be correlated to the MCF-7 cells’ lower sensitivity to the CuO NPs rather than HCT-116 cell line.

Conclusion

The CuO NPs were synthesized using a Walnut shell in four different temperatures for first time. The size of CuO NPs was increased by raising the calcination temperature. All the CuO NPs showed cytotoxic effect on MCF-7, HCT-116 and HEK-293 cell lines, but the CuO-900 NPs exhibited lesser cytotoxic effect on normal cell line with compared to other CuO NPs. The CuO NPs did not exhibit antioxidant activity, on the another hand, the CuO-900 NPs showed opposite effects on the expression of the Nrf-2 gene expression in the HCT-116 and MCF-7 cell lines. Furthermore, the CuO-900 NPs increased the expression of Bax and p53 genes in the HCT-116 and MCF-7 cell lines, indicating apoptosis occurence in the cell lines. According to the bigger size of the CuO-900 NPs compared to other CuO NPs, it can be suggested that CuO NPs’ anticancer effect is size dependent. Consequently, the Cuo-900 NPs may be a promising anticancer agent to suppress breast and colon cancers.

Acknowledgements

The authors appreciate Urmia University for the financial support.

Author contributions

H.A: Investigation, Methodology, Visualization, Software Y. P: Data curation, Supervision, Formal analysis, Funding acquisition, Writing—original draft, Writing—review & editing, Project administration, Methodology A. Z: Conceptualization, Validation, Writing—review & editing, Methodology. Y. S: Validation, Methodology, Visualization, Software.

Data availability

The datasets used and/or analysed during the current study available from the corresponding author on reasonable request.

Competing interests

The authors declare no competing interests.

Publisher's note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. Sajjad H Copper oxide nanoparticles: In vitro and in vivo toxicity, mechanisms of action and factors influencing their toxicology Comp. Biochem. Physiol. Part – C. Toxicol. Pharmacol. 2023 271 109682 10.1016/j.cbpc.2023.109682
Sajjad, H. et al. Copper oxide nanoparticles: In vitro and in vivo toxicity, mechanisms of action and factors influencing their toxicology. Comp. Biochem. Physiol. Part – C. Toxicol. Pharmacol. 271, 109682. 10.1016/j.cbpc.2023.109682 (2023).10.1016/j.cbpc.2023.109682
2. Subhan MA Advances with metal oxide-based nanoparticles as MDR metastatic breast cancer therapeutics and diagnostics RSC Adv. 2022 12 32956 32978 10.1039/D2RA02005J 36425155
Subhan, M. A. Advances with metal oxide-based nanoparticles as MDR metastatic breast cancer therapeutics and diagnostics. RSC Adv. 12, 32956–32978. 10.1039/D2RA02005J (2022).36425155 10.1039/D2RA02005J
3. Rabiee N Biosynthesis of copper oxide nanoparticles with potential biomedical applications Int. J. Nanomed. 2020 15 3983 3999 10.2147/ijn.s255398
Rabiee, N. et al. Biosynthesis of copper oxide nanoparticles with potential biomedical applications. Int. J. Nanomed. 15, 3983–3999. 10.2147/ijn.s255398 (2020).10.2147/ijn.s255398
4. Harishchandra BD Copper nanoparticles: a review on synthesis, characterization and applications Asian. Pac. J. Cancer. Biol. 2020 5 201 210 10.31557/apjcb.2020.5.4.201-210
Harishchandra, B. D. et al. Copper nanoparticles: a review on synthesis, characterization and applications. Asian. Pac. J. Cancer. Biol. 5, 201–210. 10.31557/apjcb.2020.5.4.201-210 (2020).10.31557/apjcb.2020.5.4.201-210
5. Haider MK Lignin-mediated in-situ synthesis of CuO nanoparticles on cellulose nanofibers: A potential wound dressing material Int. J. Biol. Macromol. 2021 173 315 326 10.1016/j.ijbiomac.2021.01.050 33450343
Haider, M. K. et al. Lignin-mediated in-situ synthesis of CuO nanoparticles on cellulose nanofibers: A potential wound dressing material. Int. J. Biol. Macromol. 173, 315–326. 10.1016/j.ijbiomac.2021.01.050 (2021).33450343 10.1016/j.ijbiomac.2021.01.050
6. Naz S Gul A Zia M Toxicity of copper oxide nanoparticles: a review study IET Nanobiotechnol. 2020 14 1 13 10.1049/iet-nbt.2019.0176 31935671
Naz, S., Gul, A. & Zia, M. Toxicity of copper oxide nanoparticles: a review study. IET Nanobiotechnol. 14, 1–13. 10.1049/iet-nbt.2019.0176 (2020).31935671 10.1049/iet-nbt.2019.0176
7. Fakhar-e-Alam M Assessment of green and chemically synthesized copper oxide nanoparticles against hepatocellular carcinoma J. King Saud Univ. Sci. 2021 33 101669 10.1016/j.jksus.2021.101669
Fakhar-e-Alam, M. et al. Assessment of green and chemically synthesized copper oxide nanoparticles against hepatocellular carcinoma. J. King Saud Univ. Sci. 33, 101669. 10.1016/j.jksus.2021.101669 (2021).10.1016/j.jksus.2021.101669
8. Kalaiarasi A Copper oxide nanoparticles induce anticancer activity in A549 lung cancer cells by inhibition of histone deacetylase Biotechnol. Lett. 2018 40 249 256 10.1007/s10529-017-2463-6 29116558
Kalaiarasi, A. et al. Copper oxide nanoparticles induce anticancer activity in A549 lung cancer cells by inhibition of histone deacetylase. Biotechnol. Lett. 40, 249–256. 10.1007/s10529-017-2463-6 (2018).29116558 10.1007/s10529-017-2463-6
9. Elsayed AM Novel quercetin encapsulated chitosan functionalized copper oxide nanoparticles as anti-breast cancer agent via regulating p53 in rat model Int. J. Biol. Macromol. 2021 185 134 152 10.1016/j.ijbiomac.2021.06.085 34147524
Elsayed, A. M. et al. Novel quercetin encapsulated chitosan functionalized copper oxide nanoparticles as anti-breast cancer agent via regulating p53 in rat model. Int. J. Biol. Macromol. 185, 134–152. 10.1016/j.ijbiomac.2021.06.085 (2021).34147524 10.1016/j.ijbiomac.2021.06.085
10. Mahmood RI Biosynthesis of copper oxide nanoparticles mediated Annona muricata as cytotoxic and apoptosis inducer factor in breast cancer cell lines Sci. Rep. 2022 12 16165 10.1038/s41598-022-20360-y 36171339
Mahmood, R. I. et al. Biosynthesis of copper oxide nanoparticles mediated Annona muricata as cytotoxic and apoptosis inducer factor in breast cancer cell lines. Sci. Rep. 12, 16165. 10.1038/s41598-022-20360-y (2022).36171339 10.1038/s41598-022-20360-y
11. Chen H Inhibiting the PI3K/AKT/mTOR signalling pathway with copper oxide nanoparticles from Houttuynia cordata plant: attenuating the proliferation of cervical cancer cells Artif Cells Nanomed. Biotechnol 2021 49 436 437 10.1080/21691401.2021.18901015
Chen, H. et al. Inhibiting the PI3K/AKT/mTOR signalling pathway with copper oxide nanoparticles from Houttuynia cordata plant: attenuating the proliferation of cervical cancer cells Artif Cells. Nanomed. Biotechnol 49, 436–437. 10.1080/21691401.2021.18901015 (2021).10.1080/21691401.2021.18901015
12. Benguigui M Copper oxide nanoparticles inhibit pancreatic tumor growth primarily by targeting tumor initiating cells Sci. Rep. 2019 9 12613 10.1038/s41598-019-48959-8 31471546
Benguigui, M. et al. Copper oxide nanoparticles inhibit pancreatic tumor growth primarily by targeting tumor initiating cells. Sci. Rep. 9, 12613. 10.1038/s41598-019-48959-8 (2019).31471546 10.1038/s41598-019-48959-8
13. Siegel RL Miller KD Wagle NS Jemal A Cancer statistics, 2023 CA Cancer. J. Clin. 2023 73 17 48 10.3322/caac.21763 36633525
Siegel, R. L., Miller, K. D., Wagle, N. S. & Jemal, A. Cancer statistics, 2023. CA Cancer. J. Clin. 73, 17–48. 10.3322/caac.21763 (2023).36633525 10.3322/caac.21763
14. Sung H Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries CA Cancer. J. Clin. 2021 71 209 249 10.3322/caac.21660 33538338
Sung, H. et al. Global cancer statistics 2020: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer. J. Clin. 71, 209–249. 10.3322/caac.21660 (2021).33538338 10.3322/caac.21660
15. Gavas S Quazi S Karpiński TM Nanoparticles for cancer therapy: current progress and challenges Nanoscale Res. Lett. 2021 16 173 10.1186/s11671-021-03628-6 34866166
Gavas, S., Quazi, S. & Karpiński, T. M. Nanoparticles for cancer therapy: current progress and challenges. Nanoscale Res. Lett. 16, 173. 10.1186/s11671-021-03628-6 (2021).34866166 10.1186/s11671-021-03628-6
16. Bogireddy NKR Gomez LM Osorio-Roman I Agarwal V Synthesis of gold nanoparticles using Coffea Arabica fruit extract Adv. Nano Res. 2017 5 253 10.1039/C8RA04332A
Bogireddy, N. K. R., Gomez, L. M., Osorio-Roman, I. & Agarwal, V. Synthesis of gold nanoparticles using Coffea Arabica fruit extract. Adv. Nano Res. 5, 253. 10.1039/C8RA04332A (2017).10.1039/C8RA04332A
17. Supraja N Avinash B Prasad T Nelumbo nucifera extracts mediated synthesis of silver nanoparticles for the potential applications in medicine and environmental remediation Adv. Nano Res. 2017 5 373 10.12989/anr.2017.5.4.373
Supraja, N., Avinash, B. & Prasad, T. Nelumbo nucifera extracts mediated synthesis of silver nanoparticles for the potential applications in medicine and environmental remediation. Adv. Nano Res. 5, 373. 10.12989/anr.2017.5.4.373 (2017).10.12989/anr.2017.5.4.373
18. Koutu V Rajawat S Shastri L Malik M Apoptosis and inhibition of human epithelial cancer cells by ZnO nanoparticles synthesized using plant extract Adv. Nano Res. 2019 7 231 239 10.12989/anr.2019.7.4.233
Koutu, V., Rajawat, S., Shastri, L. & Malik, M. Apoptosis and inhibition of human epithelial cancer cells by ZnO nanoparticles synthesized using plant extract. Adv. Nano Res. 7, 231–239. 10.12989/anr.2019.7.4.233 (2019).10.12989/anr.2019.7.4.233
19. Rafique M A review on synthesis, characterization and applications of copper nanoparticles using green method Nano 2017 12 1750043 10.1142/S1793292017500436
Rafique, M. et al. A review on synthesis, characterization and applications of copper nanoparticles using green method. Nano 12, 1750043. 10.1142/S1793292017500436 (2017).10.1142/S1793292017500436
20. Orooji Y Valorisation of nuts biowaste: Prospects in sustainable bio (nano) catalysts and environmental applications J. Clean. Prod. 2022 347 131220 10.1016/j.jclepro.2022.131220
Orooji, Y. et al. Valorisation of nuts biowaste: Prospects in sustainable bio (nano) catalysts and environmental applications. J. Clean. Prod. 347, 131220. 10.1016/j.jclepro.2022.131220 (2022).10.1016/j.jclepro.2022.131220
21. Zamani A Marjani AP Mousavi Z Agricultural waste biomass-assisted nanostructures: Synthesis and application Green Process. Synth. 2019 8 421 429 10.1515/gps-2019-0010
Zamani, A., Marjani, A. P. & Mousavi, Z. Agricultural waste biomass-assisted nanostructures: Synthesis and application. Green Process. Synth. 8, 421–429. 10.1515/gps-2019-0010 (2019).10.1515/gps-2019-0010
22. Zamani A Poursattar Marjani A Abedi Mehmandar M Synthesis of high surface area magnesia by using walnut shell as a template Green Process. Synth. 2019 8 199 206 10.1515/gps-2018-0066
Zamani, A., Poursattar Marjani, A. & Abedi Mehmandar, M. Synthesis of high surface area magnesia by using walnut shell as a template. Green Process. Synth. 8, 199–206. 10.1515/gps-2018-0066 (2019).10.1515/gps-2018-0066
23. Zamani A Marjani AP Abdollahpour N Synthesis of high surface area boehmite and alumina by using walnut shell as template Int. J. Nano Biomater. 2019 8 1 14 10.1504/IJNBM.2019.097588
Zamani, A., Marjani, A. P. & Abdollahpour, N. Synthesis of high surface area boehmite and alumina by using walnut shell as template. Int. J. Nano Biomater. 8, 1–14. 10.1504/IJNBM.2019.097588 (2019).10.1504/IJNBM.2019.097588
24. Zamani A Marjani AP Alimoradlu K Walnut shell-templated ceria nanoparticles: Green synthesis, characterization and catalytic application Int. J. Nanosci. 2018 17 1850008 10.1142/S0219581X18500084
Zamani, A., Marjani, A. P. & Alimoradlu, K. Walnut shell-templated ceria nanoparticles: Green synthesis, characterization and catalytic application. Int. J. Nanosci. 17, 1850008. 10.1142/S0219581X18500084 (2018).10.1142/S0219581X18500084
25. Hemmati F Jafari SM Kashaninejad M Barani Motlagh M Synthesis and characterization of cellulose nanocrystals derived from walnut shell agricultural residues Int. J. Biol. Macromol. 2018 120 1216 1224 10.1016/j.ijbiomac.2018.09.012 30193914
Hemmati, F., Jafari, S. M., Kashaninejad, M. & Barani Motlagh, M. Synthesis and characterization of cellulose nanocrystals derived from walnut shell agricultural residues. Int. J. Biol. Macromol. 120, 1216–1224. 10.1016/j.ijbiomac.2018.09.012 (2018).30193914 10.1016/j.ijbiomac.2018.09.012
26. Dulta K A novel approach of synthesis zinc oxide nanoparticles by bergenia ciliata rhizome extract: Antibacterial and anticancer potential J. Inorg. Organomet. Polym. Mater. 2021 31 180 190 10.1007/s10904-020-01684-6
Dulta, K. et al. A novel approach of synthesis zinc oxide nanoparticles by bergenia ciliata rhizome extract: Antibacterial and anticancer potential. J. Inorg. Organomet. Polym. Mater. 31, 180–190. 10.1007/s10904-020-01684-6 (2021).10.1007/s10904-020-01684-6
27. Ziegler U Groscurth P Morphological features of cell death Physiology 2004 19 124 128 10.1152/nips.01519.2004
Ziegler, U. & Groscurth, P. Morphological features of cell death. Physiology 19, 124–128. 10.1152/nips.01519.2004 (2004).10.1152/nips.01519.2004
28. Ma R Size-controlled dissolution of organic-coated silver nanoparticles Environ. Sci. Technol. 2012 46 752 759 10.1021/es201686j 22142034
Ma, R. et al. Size-controlled dissolution of organic-coated silver nanoparticles. Environ. Sci. Technol. 46, 752–759. 10.1021/es201686j (2012).22142034 10.1021/es201686j
29. Dutta G Biogenic synthesis of copper oxide nanoparticles: comprehensive in vitro profiling for cervical cancer treatment and antibacterial strategies New J. Chem. 2024 48 10697 10716 10.1039/D4NJ01194E
Dutta, G. et al. Biogenic synthesis of copper oxide nanoparticles: comprehensive in vitro profiling for cervical cancer treatment and antibacterial strategies. New J. Chem. 48, 10697–10716. 10.1039/D4NJ01194E (2024).10.1039/D4NJ01194E
30. Sankar R Anticancer activity of Ficus religiosa engineered copper oxide nanoparticles Mater. Sci. Eng. C. 2014 44 234 239 10.1016/j.msec.2014.08.030
Sankar, R. et al. Anticancer activity of Ficus religiosa engineered copper oxide nanoparticles. Mater. Sci. Eng. C. 44, 234–239. 10.1016/j.msec.2014.08.030 (2014).10.1016/j.msec.2014.08.030
31. Carneiro BA El-Deiry WS Targeting apoptosis in cancer therapy Nat. Rev. Clin. Oncol. 2020 17 395 417 10.1038/s41571-020-0341-y 32203277
Carneiro, B. A. & El-Deiry, W. S. Targeting apoptosis in cancer therapy. Nat. Rev. Clin. Oncol. 17, 395–417. 10.1038/s41571-020-0341-y (2020).32203277 10.1038/s41571-020-0341-y
32. Rogalińska M Alterations in cell nuclei during apoptosis Cell. Mol. Biol. Lett. 2002 7 995 1018 12511968
Rogalińska, M. Alterations in cell nuclei during apoptosis. Cell. Mol. Biol. Lett. 7, 995–1018 (2002).12511968
33. Dolati M Biogenic copper oxide nanoparticles from Bacillus coagulans induced reactive oxygen species generation and apoptotic and anti-metastatic activities in breast cancer cells Sci. Rep. 2023 13 3256 10.1038/s41598-023-30436-y 36828883
Dolati, M. et al. Biogenic copper oxide nanoparticles from Bacillus coagulans induced reactive oxygen species generation and apoptotic and anti-metastatic activities in breast cancer cells. Sci. Rep. 13, 3256. 10.1038/s41598-023-30436-y (2023).36828883 10.1038/s41598-023-30436-y
34. Shi T DNA damage and oxidant stress activate p53 through differential upstream signaling pathways Free. Radic. Biol. Med. 2021 172 298 311 10.1016/j.freeradbiomed.2021.06.013 34144191
Shi, T. et al. DNA damage and oxidant stress activate p53 through differential upstream signaling pathways. Free. Radic. Biol. Med. 172, 298–311. 10.1016/j.freeradbiomed.2021.06.013 (2021).34144191 10.1016/j.freeradbiomed.2021.06.013
35. Djamila B In vitro antioxidant activities of copper mixed oxide (CuO/Cu2O) nanoparticles produced from the leaves of Phoenix dactylifera L Biomass Convers. Biorefin. 2022 10.1007/s13399-022-02743-3
Djamila, B. et al. In vitro antioxidant activities of copper mixed oxide (CuO/Cu2O) nanoparticles produced from the leaves of Phoenix dactylifera L. Biomass Convers. Biorefin.10.1007/s13399-022-02743-3 (2022).10.1007/s13399-022-02743-3
36. Peddi P Ptsrk PR Rani NU Tulasi SL Green synthesis, characterization, antioxidant, antibacterial, and photocatalytic activity of Suaeda maritima (L.) Dumort aqueous extract-mediated copper oxide nanoparticles J. Genet. Eng. Biotechnol. 2021 19 131 10.1186/s43141-021-00229-9 34460013
Peddi, P., Ptsrk, P. R., Rani, N. U. & Tulasi, S. L. Green synthesis, characterization, antioxidant, antibacterial, and photocatalytic activity of Suaeda maritima (L.) Dumort aqueous extract-mediated copper oxide nanoparticles. J. Genet. Eng. Biotechnol. 19, 131. 10.1186/s43141-021-00229-9 (2021).34460013 10.1186/s43141-021-00229-9
37. Thandapani G Green synthesis of copper oxide nanoparticles using Spinacia oleracea leaf extract and evaluation of biological applications: Antioxidant, antibacterial, larvicidal and biosafety assay Mater. Today Commun. 2023 34 105248 10.1016/j.mtcomm.2022.105248
Thandapani, G. et al. Green synthesis of copper oxide nanoparticles using Spinacia oleracea leaf extract and evaluation of biological applications: Antioxidant, antibacterial, larvicidal and biosafety assay. Mater. Today Commun. 34, 105248. 10.1016/j.mtcomm.2022.105248 (2023).10.1016/j.mtcomm.2022.105248
38. Chapman E Zhang D NRF2 and the Hallmarks of Cancer Cancer Cell 2018 34 21 43 10.1016/j.ccell.2018.03.022 29731393
Chapman, E. & Zhang, D. NRF2 and the Hallmarks of Cancer. Cancer Cell 34, 21–43. 10.1016/j.ccell.2018.03.022 (2018).29731393 10.1016/j.ccell.2018.03.022
39. Wang R Reactive oxygen species and NRF2 signaling, friends or foes in cancer? Biomolecules 2023 10.3390/biom13020353 38275755
Wang, R. et al. Reactive oxygen species and NRF2 signaling, friends or foes in cancer?. Biomolecules10.3390/biom13020353 (2023).38275755 10.3390/biom13020353
40. He F Ru X Wen T NRF2, a transcription factor for stress response and beyond Int. J. Mol. Sci. 2022 10.3390/ijms21134777 36614060
He, F., Ru, X. & Wen, T. NRF2, a transcription factor for stress response and beyond. Int. J. Mol. Sci.10.3390/ijms21134777 (2022).36614060 10.3390/ijms21134777
41. Kumar H Role of Nrf2 signaling cascade in breast cancer: Strategies and treatment Front. Pharmacol. 2022 13 720076 10.3389/fphar.2022.720076 35571115
Kumar, H. et al. Role of Nrf2 signaling cascade in breast cancer: Strategies and treatment. Front. Pharmacol. 13, 720076. 10.3389/fphar.2022.720076 (2022).35571115 10.3389/fphar.2022.720076
42. Barber TL Copper oxide nanoparticles activate Nrf2, KEAP 1, and downstream target genes in JB6 cells possibly through ROS generation and antioxidant response element (ARE) mechanisms FASEB J 2020 34 1 1 10.1096/fasebj.2020.34.s1.04011
Barber, T. L. et al. Copper oxide nanoparticles activate Nrf2, KEAP 1, and downstream target genes in JB6 cells possibly through ROS generation and antioxidant response element (ARE) mechanisms. FASEB J 34, 1–1. 10.1096/fasebj.2020.34.s1.04011 (2020).10.1096/fasebj.2020.34.s1.04011
43. Chen W Does Nrf2 contribute to p53-mediated control of cell survival and death? Antioxid. Redox Signal 2012 10.1089/ars.2012.4674 23088254
Chen, W. et al. Does Nrf2 contribute to p53-mediated control of cell survival and death?. Antioxid. Redox Signal10.1089/ars.2012.4674 (2012).23088254 10.1089/ars.2012.4674
