
==== Front
Int J Food Sci
Int J Food Sci
IJFS
International Journal of Food Science
2356-7015
2314-5765
Wiley

10.1155/2024/2790180
Research Article
Detection of Staphylococcal Enterotoxins A and E and Methicillin Resistance in Staphylococcus aureus Strains From Moroccan Broiler Chicken Meat
https://orcid.org/0000-0002-5083-6805
Nacer Sabrine nacer.sabrine@gmail.com
1 2
https://orcid.org/0000-0002-2173-9280
Nassik Saâdia 2
https://orcid.org/0000-0002-8623-9949
El Ftouhy Fatima Zahra 3
https://orcid.org/0000-0002-3355-2800
Derqaoui Sophia 2
https://orcid.org/0000-0003-3090-2630
Mouahid Mohamed 4
https://orcid.org/0000-0002-4886-601X
Lkhider Mustapha 1
1 Laboratory of Virology Oncology Biosciences Environment and New Energies Faculty of Science and Technology Mohammedia University Hassan II, Casablanca, Morocco
2 Avian Pathology Unit Department of Veterinary Pathology and Public Health Hassan II Agronomic and Veterinary Institute, Rabat, Morocco
3 Laboratory of Biochemistry Environment and Agri-Food Faculty of Science and Technology Mohammedia University Hassan II, Casablanca, Morocco
4 Mouahid's Veterinary Clinic, Temara 12000, Morocco
Academic Editor: Mozaniel Oliveira

2024
26 8 2024
2024 279018026 11 2023
27 6 2024
31 7 2024
Copyright © 2024 Sabrine Nacer et al.
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Foodborne epidemics have become a serious public health emergency worldwide. Foods of animal origin, in particular chicken meat, are considered to be potential vectors of pathogenic bacteria, particularly Staphylococcus aureus. This bacterium can be resistant in the form of methicillin-resistant S. aureus (MRSA) or produce enterotoxins leading to food poisoning when ingested. This study is aimed at exploring the virulence genes in S. aureus responsible for producing enterotoxins (staphylococcal enterotoxin [SE] A [sea] and SE E [see]) and determining the prevalence of MRSA in raw broiler meat in the Casa-Rabat region in Morocco. A quantitative (q) PCR (qPCR) assay, using specific primers for S. aureus (nuc) confirmation and detection of enterotoxin genes (sea and see), as well as the methicillin-resistant gene (mecA), was employed. Our findings indicated that all tested strains were positively identified as S. aureus. Among them, one isolate (1/54) tested positive for the see gene (1.85%), while none carried the sea gene. Furthermore, the mecA gene, indicative of MRSA, was present in 12/54 of the isolates (22.22%). The potential presence of MRSA in Moroccan poultry meat underscores a public health risk. Thus, stringent measures are imperative to curtail the contamination and proliferation of this bacterium during the slaughtering process, underscoring the importance of continuing research into the prevalence of MRSA colonization among poultry slaughterhouse personnel.

Keywords

broiler chicken meat
MRSA
sea
see
Staphylococcus aureus
==== Body
pmc1. Introduction

Staphylococcus aureus (S. aureus), an opportunistic and notorious zoonotic pathogen, is responsible for worldwide outbreaks of food poisoning [1, 2]. It possesses two aggravating characteristics: toxin production and antimicrobial resistance [3]. The consumption of S. aureus-contaminated foods, mainly chicken meat, remains the major factor in the development of staphylococcal food poisoning in humans [2, 4]. This contamination arises from poor hygiene during slaughter handling and quality of water used for processing [5]. Therefore, meats and meat products can act as transmission vectors in the transmission of methicillin-resistant S. aureus (MRSA) to both butchers and consumers [6].

The treatment of infections caused by S. aureus has been further complicated by antimicrobial resistance in bacteria, particularly MRSA [7]. As a result, S. aureus has been listed by the World Health Organization (WHO) as one of the “priority pathogens” posing a threat to public health [8]. This threat is compounded by MRSA attributed mainly to the presence of the mecA gene, located on one of staphylococcal cassette chromosome mec (SCCmec), which encodes for penicillin-binding protein 2a (PBP2a) and has a low affinity for most beta-lactam antimicrobials, complicating the treatment of infections [3]. Consequently, the importance of monitoring MRSA in retail meat has been highlighted [9].

In addition, staphylococcal enterotoxins (SEs), including SEs A and E (sea and see), produced by enterotoxigenic strains of S. aureus, constitute a superfamily of pyrogenic exotoxins that share structural and functional similarities [10]. In fact, as of today, at least 28 SEs and SE-like toxins have been identified [11], which are of paramount importance and danger. sea, for example, is responsible for the symptoms associated with outbreaks of staphylococcal food poisoning [12, 13] and also contributes to the development of organisms' resistance to heat treatment [14], while the presence of SE E (see) has been implicated in many cases of foodborne illness [12].

The disease is characterized by a rapid onset of symptoms, including nausea, violent vomiting, abdominal cramps, and diarrhea which typically last from 24 to 48 h. Complete recovery usually occurs within 1–3 days, and the illness is usually self-limiting; occasionally, it is severe enough to require hospitalization.

Today, the phenomena of food poisoning, foodborne antimicrobial resistance, and resistance gene transfer represent a growing biological risk, necessitating in-depth research into these issues and their underlying nature.

Furthermore, in Morocco, 146 cases of collective food poisoning (CFP) were reported in 2021, without specifying the agent or foodstuff responsible [15]. Therefore, we have no data on CFP caused by S. aureus, in particular MRSA and enterotoxin-encoding genes. This study is aimed at exploring the S. aureus virulence genes responsible for enterotoxin production (sea and see) and determining the prevalence of MRSA in broiler meat in the region.

2. Material and Methods

2.1. Samples and Bacteriological Identification

In this study, we are extending our previous research, “Prevalence and antibiotic resistance of Salmonella spp. and Staphylococcus aureus isolated from broiler meat in modern and traditional slaughterhouses in Morocco” [16], using PCR methods to further investigate the presence of S. aureus and MRSA and also to examine the expression of specific staphylococcal toxin genes (see, sea), to provide valuable information on the pathogenicity of this bacterium.

A total of 54 S. aureus isolates were identified in the current study using the microbiological test. The isolates originated from 540 broiler chicken meat samples collected from both traditional and modern poultry slaughterhouses in Morocco as described earlier [16]. The strains were phenotypically confirmed as S. aureus based on ISO 6888-1: 1999 standard. For that purpose, 25 g of each neck skin, breast, and thigh sample was placed in a sterile bag containing 225 mL of water peptone buffer and then homogenized using the Stomacher to achieve a 10% stock suspension. Serial dilutions up to 10−5 were carried out from the 10−1 stock solution.

The prepared Petri dishes were inoculated with 0.1 mL of different dilutions with a sterile glass rake in Baird Parker's selective medium (BK055HA Biokar Diagnostics, Zac de Ther, France) with egg yolk and potassium tellurite (3554205Bio-Rad Marnes-la-Coquette, France) and incubated at 37°C for 24–48 h. Suspected S. aureus colonies were then confirmed using the catalase (1840, SOLVAPUR, SOLVACHIM, Morocco) and coagulase tests (6BR0020, Biokar Diagnostics, Zac de Ther, France). Finally, each S. aureus species was stored at −80°C in TSB with 20% glycerol, until further molecular analysis.

2.2. DNA Extraction

Bacterial DNA was extracted from the samples using a commercial column-based kit Invitrogen™ PureLink™ Microbiome DNA Purification Kit (Life Technologies, Thermo Fisher Scientific, Foster City, CA, USA), following the manufacturer's user guide. Briefly, up to 2 × 109 Gram-positive cells were collected by centrifugation, resuspended in 180 μL of lysozyme digestion buffer containing lysozyme, and thoroughly mixed by brief vortexing. Samples were incubated at 37°C for 30 min; then, 20 μL of proteinase K was added, and 200 μL of PureLink™ genomic lysis/binding buffer and carefully vortexed and incubated at 55°C. After 30 min, 200 μL of 96%–100% ethanol was poured into the lysates. The resulting 640 μL of lysate solution, prepared for swabs, was then placed in collection tubes and centrifuged at 10 000 rpm for 1 min at room temperature. These collection tubes were then replaced, and two rounds of washing were then carried out using the washing solutions supplied with the kit. Finally, the DNA was recovered after the elution step and stored at −20°C until use.

2.3. Quantitative (q) PCR (qPCR) Assay

qPCR was employed to detect and quantify the nuc, mecA, see, and sea genes in broiler chicken meat samples, as described in previous studies [17–19], and to verify the efficiency of the qPCR reaction, we used a positive control (reagents and known target DNA). For that, each qPCR reaction was set up in duplicate, with each well containing 10 μL of the reaction mixture, comprising 2.2 μL of the test sample and 7.8 μL of the one-step mix. This mix included nuclease-free water, specific forward and reverse primers for each target gene [20–22] (Table 1), and SYBR Green (Applied Biosystems, Life Technologies, Burlington, ON, Canada).

After sealing the plate with adhesive film, it was placed in a thermal cycler (Agilent AriaMx Real-Time PCR System) according to the melting temperature of the primers for all the genes (Table 2). The values obtained are expressed as quantification of qPCR cycle numbers (Cq). Unlike established “Cq cut-off” values for pathogens such as Salmonella and Campylobacter, any sample registering a Cq value greater than 35 in this study was deemed negative.

3. Results

3.1. S. aureus Confirmation

All 54 samples, initially identified as S. aureus positive using the microbiological method, were subsequently confirmed as S. aureus (100%) using the qPCR method. The Cq values for these samples ranged from 14.80 to 33.81 (Table 3 and Figure 1).

3.2. SE (sea, see) Screening

Among the isolates of S. aureus positive for SE genes (sea, see), one isolate (1/54) was positive to see (1.85%), although none of these S. aureus colonies carried sea gene (Table 4 and Figure 2).

3.3. MRSA Prevalence from Broiler Chicken Meat

Overall, out of 54 positive S. aureus samples, 12 samples (22.22%) were resistant to methicillin, with a Cq value ranging from 32.59 to 34.94. Also, 17 samples (31.48%) showed no resistance with a Cq value ranging from 35 to 39.42. (Table 5 and Figure 3).

4. Discussion

S. aureus contamination in food, particularly in chicken meat, results from inadequate hygienic handling and processing. It constitutes a potential risk to public health due to its capability to produce enterotoxins [3, 24], which are major virulence factors of S. aureus, particularly concerning food safety [25]. On the other hand, the fact that food, intended for consumption, may contain MRSA is a real disaster, as MRSA strains are considered to be “super-bacteria” in the health field [26]. In Morocco, there are no consistent data concerning MRSA and the virulence genes see and sea in broiler chicken meat.

In the present work, all 54 broiler meat samples that tested positive for S. aureus using the microbiological method were also confirmed by qPCR, attributed to the presence of the nuc gene amplicon. Our findings indicated that 1.85% of the isolates were enterotoxigenic, containing only one gene. This contrasts with studies from Turkey [27] and China [28], where 69% and 46% of S. aureus isolates from raw chicken meat tested positive for one or more toxin genes, respectively.

Of the two virulence genes examined (sea and see), the see gene was detected, with a prevalence of 1.85% (1/54). This rate is lower than those reported in Nigeria [29] and Kaliobia Governorate [30]. Interestingly, studies from Chennai, India [5], and Thailand [9] align with our findings, reporting no S. aureus isolates carrying the sea gene, whereas another study conducted on frozen chicken meat revealed that three out of six samples (50%) were enterotoxigenic, while two strains produced sea [31].

The variation found in the predominant enterotoxin genes of S. aureus in these different studies might be influenced by geographical differences, which could be further affected by the different ecological origins of the isolated strains [28, 32].

Since the first characterization of sea in 1959, five SEs, named sea to see, have also been identified on the basis of differences in SE antigenicity [13, 33, 34]. These SEs represent emetic toxins and are one of the causes of food poisoning in humans [35]. SEs have been classified as members of the superantigen family of pyrogenic toxins because of their biological activities and structural relatedness [36].

Indeed, it is known that about 95% of staphylococcal food poisoning outbreaks are caused by SE types sea to see [34]; they are responsible for the clinical manifestations of staphylococcal food poisoning and a septic shock-like illness, and their ingestion leads to severe gastroenteritis with emesis, nausea, and diarrhea [37].

On the other hand, the evolution of S. aureus in the antibiotic era has revealed the emergence of virulent strains, many of which have acquired resistance to methicillin, representing a real threat to human health [38]. Our findings show that MRSA was detected in 22.22% of broiler meat samples from slaughterhouses. Several studies carried out in different parts of the world and concordant with us have recorded higher prevalence rates: 29.9% in Nigeria [29], 35.4% in the Czech Republic [39], 38% in Egypt [7], and 56% in South Africa [40]. Lower prevalence rates have also been reported: 1.3% in Canada [41], 4.3% in South Africa [42], 1.7% in China [43], and 0.3% in Korea [44]. This difference might be linked to the different slaughtering conditions or the strategies used to combat antibiotic resistance.

It should also be noted that a previous study carried out on live poultry in Northern Morocco did not reveal the presence of MRSA [38].

In recent years, antibiotic-resistant bacteria have received considerable attention due to their immediate risk to public health, and MRSA is no exception. The presence of this bacterium in poultry and poultry products not only increases the incidence of foodborne outbreaks but also represents a risk of horizontal transmission of resistance between bacterial strains, as this means that even strains that have never been exposed to antibiotics can acquire this resistance through gene transfer [45], rather than through the selection pressure exerted by the excessive use of antibiotics.

The burden of foodborne disease caused by MRSA and SEs is likely to continue to increase in the coming years. Although one of the common superantigen genes, sea, was not detected in our study, there are probably other types of superantigen than see. In addition, these results underline the presence of pathogenic MRSA in Moroccan broiler chicken meat. This emphasizes the imperative need to implement robust preventive measures to control the spread of methicillin-resistant strains, as well as to minimize the presence of potentially dangerous enterotoxin-producing staphylococci. These constatations also highlight the need to improve hygiene practices throughout the food production chain, from farming to consumption, in order to reduce the risks to public health.

5. Conclusion

To the best of our knowledge, this study is the first to report the presence of the enterotoxin gene (see) at 1.85% and methicillin resistance at 22.22% in broiler chicken meat from selected slaughterhouses in Casablanca and Rabat areas, Morocco. This discovery underscores a potential public health concern. It is imperative to implement stringent preparation practices and hygiene measures throughout the food chain to mitigate the risk of MRSA transmission to consumers. Further investigations are also required, including molecular analysis of avian strains, comparing the genetic profile of avian strains with human clinical isolates.

Acknowledgments

The authors would like to thank the team at the microbiology laboratory of the Avian Pathology Unit at the Hassan II Agronomy and Veterinary Medicine Institute in Rabat, Morocco, for their cooperation and support during this experimental study. Also, the authors express their sincere gratitude to Doctor Tarik Embarki for his participation in the layout of the manuscript.

Data Availability Statement

The authors declare that they have all the necessary data and are available where appropriate or requested by the editor.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding

The authors received no specific funding for this work.

Figure 1 Presence of Staphylococcus aureus with corresponding Cq value in broiler chicken meat.

Figure 2 Presence of staphylococcal enterotoxin E (see) in broiler chicken meat.

Figure 3 Presence of MRSA with corresponding Cq values in broiler chicken meat.

Table 1 Primer sequences of nuc, mecA, see, and sea genes.

Gene	Primers	GenBank accession N°	Reference	
nuc	F: GCGATTGATGGTGATACGGTT	JX499023-6	[20]	
R: AGCCAAGCCTTGACGAACTAAAGC	
mecA	F: AAAATCGATGGTAAAGGTTGGC	Y00688	[21]	
R: AGTTCTGCAGTACCGGATTTGC	
sea	F: GGTTATCAATGTGCGGGTGG	M18970	[22]	
R: CGGCACTTTTTTCTCTTCGG	
see	F: AGGTTTTTTCACAGGTCATCC	M21319	[22]	
R: CTTTTTTTTCTTCGGTCAATC	

Table 2 Cycling mode of all tested genes according to the melting temperature of their primers [23].

Step	Incubation	Cycles	
Temperature (°C)	Time	
UDG activation	50	2 min	Hold	
Dual-lock DNA polymerase	95	2 min	Hold	
Denature	95	15 s	40	
Anneal	55–60	15 s	
Extend	72	1 min	

Table 3 Presence of Staphylococcus aureus with corresponding Cq values in broiler chicken meat.

Samples	Cq value	
1	26.99	
2	28.67	
3	28.41	
4	26.63	
5	25.43	
6	18.53	
7	26.33	
8	26	
9	26.77	
10	28.31	
11	27.72	
12	27.8	
13	27.65	
14	29.04	
15	32.62	
16	30.19	
17	26.92	
18	27.51	
19	27.2	
20	26.31	
21	22.68	
22	28.26	
23	27.81	
24	26.39	
25	27.04	
26	27.09	
27	28.41	
28	33.81	
29	26.8	
30	15.79	
31	30.01	
32	28.4	
33	27.28	
34	23.89	
35	33.53	
36	27.62	
37	27.26	
38	29.1	
39	26.18	
40	26.5	
41	27.75	
42	28.23	
43	28.25	
44	14.8	
45	27.89	
46	28.48	
47	31.23	
48	28.84	
49	27.56	
50	28.19	
51	27.08	
52	31.77	
53	30.81	
54	15.66	
Note: No Cq and Cq > 35 were considered negative.

Abbreviation: Cq, quantification cycle.

Table 4 Presence of the staphylococcal enterotoxin E (see) with corresponding Cq values in broiler chicken meat.

Samples	Cq value	
1	No Cq	
2	No Cq	
3	34.55	
4	No Cq	
5	No Cq	
6	No Cq	
7	No Cq	
8	No Cq	
9	No Cq	
10	No Cq	
11	No Cq	
12	No Cq	
13	No Cq	
14	No Cq	
15	No Cq	
16	No Cq	
17	No Cq	
18	No Cq	
19	No Cq	
20	No Cq	
21	No Cq	
22	No Cq	
23	No Cq	
24	No Cq	
25	No Cq	
26	No Cq	
27	No Cq	
28	No Cq	
29	No Cq	
30	No Cq	
31	No Cq	
32	No Cq	
33	No Cq	
34	No Cq	
35	No Cq	
36	No Cq	
37	No Cq	
38	No Cq	
39	No Cq	
40	No Cq	
41	No Cq	
42	No Cq	
43	No Cq	
44	No Cq	
45	No Cq	
46	No Cq	
47	No Cq	
48	No Cq	
49	No Cq	
50	No Cq	
51	No Cq	
52	No Cq	
53	No Cq	
54	No Cq	
Note: No Cq and Cq > 35 were considered negative.

Abbreviation: Cq, quantification cycle.

Table 5 MRSA prevalence from broiler chicken meat with corresponding Cq values in broiler meat.

Samples	Cq value	
1	No Cq	
2	No Cq	
3	No Cq	
4	37.97	
5	34.95	
6	No Cq	
7	No Cq	
8	35.19	
9	No Cq	
10	36.58	
11	34.73	
12	33.94	
13	34.68	
14	34.94	
15	No Cq	
16	37.81	
17	No Cq	
18	32.59	
19	35.15	
20	No Cq	
21	34.42	
22	36.79	
23	35.28	
24	35	
25	No Cq	
26	33.93	
27	35.18	
28	No Cq	
29	No Cq	
30	39.77	
31	No Cq	
32	35.24	
33	37.86	
34	No Cq	
35	No Cq	
36	37.07	
37	No Cq	
38	39.42	
39	No Cq	
40	No Cq	
41	No Cq	
42	No Cq	
43	34.71	
44	36.04	
45	No Cq	
46	35.99	
47	33.99	
48	No Cq	
49	No Cq	
50	No Cq	
51	35.05	
52	No Cq	
53	33.18	
54	33.64	
Note: No Cq and Cq > 35 were considered negative.

Abbreviation: Cq, quantification cycle.
==== Refs
1 Urmi M. R. Ansari W. K. Islam M. S. Sobur M. A. Rahman M. Rahman M. T. Antibiotic resistance patterns of Staphylococcus spp. isolated from fast foods sold in different restaurants of Mymensingh, Bangladesh Journal of Advanced Veterinary and Animal Research 2021 8 2 274 281 10.5455/javar.2021.h512 34395598
2 Ballah F. M. Islam M. S. Rana M. L. Virulence determinants and methicillin resistance in biofilm-forming Staphylococcus aureus from various food sources in Bangladesh Antibiotics 2022 11 11 p. 1666 10.3390/antibiotics11111666 36421310
3 Abd El Tawab A. A. El-Hofyand F. I. Maarouf A. A. A. Mousa D. H. Bacteriological and molecular studies on methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and its products in Kaliobia Governorate Benha Veterinary Medical Journal 2016 31 1 64 72 10.21608/bvmj.2016.31221
4 Karami M. Food poisoning ability of Staphylococcus aureus isolated from meat products and poultry meat Assiut Veterinary Medical Journal 2019 65 162 7 13 10.21608/avmj.2019.168932
5 Savariraj W. R. Ravindran N. B. Kannan P. Rao V. A. Occurrence and enterotoxin gene profiles of Staphylococcus aureus isolated from retail chicken meat Food Science and Technology International 2021 27 7 619 625 10.1177/1082013220980204 33307778
6 Boost M. Ho J. Guardabassi L. O’Donoghue M. Colonization of butchers with livestock-associated methicillin-resistant Staphylococcus aureus Zoonoses Public Health 2013 60 8 572 576 10.1111/zph.12034 2-s2.0-84888134786 23279691
7 Sallam K. I. Abd-Elghany S. M. Elhadidy M. Tamura T. Molecular characterization and antimicrobial resistance profile of methicillin-resistant Staphylococcus aureus in retail chicken Journal of Food Protection 2015 78 10 1879 1884 10.4315/0362-028X.JFP-15-150 2-s2.0-84942604202 26408138
8 Tacconelli E. Carrara E. Savoldi A. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis The Lancet Infectious Diseases 2018 18 3 318 327 10.1016/S1473-3099(17)30753-3 2-s2.0-85038810538 29276051
9 Bunnoeng N. Themphachana M. Pewleang T. High prevalence and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from retailed meats, South Thailand International Food Research Journal 2014 21 2 569 576
10 Mekhloufi O. A. Chieffi D. Hammoudi A. Bensefia S. A. Fanelli F. Fusco V. Prevalence, enterotoxigenic potential and antimicrobial resistance of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) isolated from Algerian ready to eat foods Toxins 2021 13 12 p. 835 10.3390/toxins13120835
11 Chieffi D. Fanelli F. Cho G. S. Novel insights into the enterotoxigenic potential and genomic background of Staphylococcus aureus isolated from raw milk Food Microbiology 2020 90, article 103482 10.1016/j.fm.2020.103482 32336356
12 Pinchuk I. V. Beswick E. J. Reyes V. E. Staphylococcal enterotoxins Toxins 2010 2 8 2177 2197 10.3390/toxins2082177 2-s2.0-79952098979 22069679
13 Balaban N. Rasooly A. Staphylococcal enterotoxins International Journal of Food Microbiology 2000 61 1 1 10 10.1016/S0168-1605(00)00377-9 2-s2.0-0034307973 11028954
14 Neelam V. Jain V. K. Singh M. Virulence and antimicrobial resistance gene profiles of Staphylococcus aureus associated with clinical mastitis in cattle PLoS One 2022 17 5, article e0264762 10.1371/journal.pone.0264762 35503758
15 Directorate of Epidemiology and Disease Control (Ministry of Health and Social Protection of the Kingdom of Morocco) Epidemiological situation of high epidemic potential diseases in Morocco, Year 2021 Bulletin of Epidemiology and Public Health 2022 64 80 8 9
16 Nacer S. El Ftouhy F. Z. Derqaoui S. Khayli M. Nassik S. Lkhider M. Prevalence and antibiotic resistance of Salmonella spp. and Staphylococcus aureus isolated from broiler chicken meat in modern and traditional slaughterhouses of Morocco World’s Veterinary Journal 2022 12 4 430 439 10.54203/scil.2022.wvj53
17 Mukhopadhya I. Hansen R. Nicholl C. E. A comprehensive evaluation of colonic mucosal isolates of Sutterella wadsworthensis from inflammatory bowel disease PLoS One 2011 6 10, article e27076 10.1371/journal.pone.0027076 2-s2.0-80055112335 22073125
18 Suzuki M. T. Giovannoni S. J. Bias caused by template annealing in the amplification of mixtures of 16S rRNA genes by PCR Applied and Environmental Microbiology 1996 62 2 625 630 10.1128/aem.62.2.625-630.1996 8593063
19 Bustin S. A. Mueller R. Real-time reverse transcription PCR (qRT-PCR) and its potential use in clinical diagnosis Clinical Science 2005 109 4 365 379 10.1042/CS20050086 2-s2.0-26844512816 16171460
20 Brakstad O. G. Aasbakk K. Maeland J. A. Detection of Staphylococcus aureus by polymerase chain reaction amplification of the nuc gene Journal of Clinical Microbiology 1992 30 7 1654 1660 10.1128/jcm.30.7.1654-1660.1992 1629319
21 Strommenger B. Kettlitz C. Werner G. Witte W. Multiplex PCR assay for simultaneous detection of nine clinically relevant antibiotic resistance genes in Staphylococcus aureus Journal of Clinical Microbiology 2003 41 9 4089 4094 10.1128/JCM.41.9.4089-4094.2003 2-s2.0-0042922286 12958230
22 Monday S. R. Bohach G. A. Use of multiplex PCR to detect classical and newly described pyrogenic toxin genes in Staphylococcal isolates Journal of Clinical Microbiology 1999 37 10 3411 3414 10.1128/JCM.37.10.3411-3414.1999 10488222
23 Thermo Fisher Scientific User guide: PowerUp SYBER Green Master Mix – Universal 2X Master Mix for Real-Time PCR Workflows 2023 1 34 https://assets.thermofisher.com/TFS-Assets/LSG/manuals/MAN0013511_PowerUp_mastermix_UG.pdf
24 Abd El-Tawab A. A. Hofy F. I. Mohamed S. R. Amin S. H. Characterization of methicillin resistance Staphylococcus aureus isolated from chicken and human Benha Veterinary Medical Journal 2017 32 1 132 137 10.21608/bvmj.2017.31198
25 Fisher E. L. Otto M. Cheung G. Y. C. Basis of virulence in enterotoxin-mediated staphylococcal food poisoning Frontiers in Microbiology Journal 2018 9 p. 436 10.3389/fmicb.2018.00436 2-s2.0-85043512080 29662470
26 Dubey D. Rath S. Sahu M. C. Pattnaik L. Debata N. K. Padhy R. N. Surveillance of infection status of drug resistant Staphylococcus aureus in an Indian teaching hospital Asian Pacific Journal of Tropical Disease 2013 3 2 133 142 10.1016/S2222-1808(13)60057-2 2-s2.0-84875059733
27 Sahin S. Mogulkoc M. N. Kalin R. Karahan M. Determination of the important toxin genes of Staphylococcus aureus isolated from meat samples, food handlers and food processing surfaces in Turkey Israel Journal of Veterinary Medicine 2020 75 2 42 49
28 Li S. Wang P. Zhao J. Characterization of toxin genes and antimicrobial susceptibility of Staphylococcus aureus from retail raw chicken meat Journal of Food Protection 2018 81 4 528 533 10.4315/0362-028X.JFP-17-309 2-s2.0-85044190909 29513103
29 Igbinosa E. O. Beshiru A. Igbinosa I. H. Ogofure A. G. Ekundayo T. C. Okoh A. I. Prevalence, multiple antibiotic resistance and virulence profile of methicillin-resistant Staphylococcus aureus (MRSA) in retail poultry meat from Edo, Nigeria Frontiers in Cellular and Infection Microbiology 2023 13 p. 1122059 10.3389/fcimb.2023.1122059
30 Hassanen F. S. Shaltout F. A. Amani M. S. Maarouf A. A. Rasha A. Detection of virulence genes of enterotoxigenic Staphylococcus aureus isolated from chicken meat cuts by using PCR Benha Veterinary Medical Journal 2017 33 2 410 417 10.21608/bvmj.2017.30515
31 Elmossalamy D. A. Hamdy M. M. Aideia H. A. M. Yassien N. A. Zaki H. M. B. A. Incidence of Staphylococcus aureus and its enterotoxins in chicken meat and its products International Journal of Veterinary Science 2020 9 4 573 577
32 Abolghait S. K. Fathi A. G. Youssef F. M. Algammal A. M. Methicillin-resistant Staphylococcus aureus (MRSA) isolated from chicken meat and giblets often produces staphylococcal enterotoxin B (SEB) in non-refrigerated raw chicken livers International Journal of Food Microbiology 2020 328, article 108669 10.1016/j.ijfoodmicro.2020.108669 32497922
33 Casman E. P. Further serological studies of staphylococcal enterotoxin Journal of Bacteriology 1960 79 6 849 856 10.1128/jb.79.6.849-856.1960 13808165
34 Bergdoll M. S. Surgalla M. J. Dack G. M. Staphylococcal enterotoxin The Journal of Immunology 1959 83 3 334 338 10.4049/jimmunol.83.3.334 13799262
35 Argudín M. Á. Mendoza M. C. Rodicio M. R. Food poisoning and Staphylococcus aureus enterotoxins Toxins 2010 2 7 1751 1773 10.3390/toxins2071751 2-s2.0-79952075864 22069659
36 Xu S. X. McCormick J. K. Staphylococcal superantigens in colonization and disease Frontiers in Cellular and Infection Microbiology 2012 2 p. 52 10.3389/fcimb.2012.00052
37 Robinson R. K. Batt C. A. Patel P. D. Encyclopedia of Food Microbiology 2000 Academic Press
38 Mourabit N. Arakrak A. Bakkali M. Zian Z. Bakkach J. Laglaoui A. Antimicrobial resistance trends in Staphylococcus aureus strains carried by poultry in north of Morocco: a preliminary analysis Journal of Food Quality 2021 2021 5 8856004 10.1155/2021/8856004
39 Tegegne H. A. Koláčková I. Florianová M. Detection and molecular characterisation of methicillin-resistant Staphylococcus aureus isolated from raw meat in the retail market Journal of Global Antimicrobial Resistance 2021 26 233 238 10.1016/j.jgar.2021.06.012 34271219
40 Mkize N. Zishiri O. T. Mukaratirwa S. Genetic characterisation of antimicrobial resistance and virulence genes in Staphylococcus aureus isolated from commercial broiler chickens in the Durban metropolitan area, South Africa The Journal of the South African Veterinary Association 2017 88 e1 e7 10.4102/jsava.v88i0.1416 2-s2.0-85028978986 28470080
41 Bernier-Lachance J. Arsenault J. Usongo V. Prevalence and characteristics of livestock associated methicillin-resistant Staphylococcus aureus (LA-MRSA) isolated from chicken meat in the province of Quebec, Canada PLoS One 2020 15 1, article e0227183 10.1371/journal.pone.0227183 31923238
42 Adigun O. Gcebe N. Jambwa K. Fasina F. Adesiyun A. A. Molecular and phenotypic characterization of Staphylococcus aureus strains isolated from carcass swabs and carcass drips of chickens slaughtered in the informal market in Gauteng Province, South Africa Journal of Food Safety 2020 40 4, article e12806 10.1111/jfs.12806
43 Wang X. Tao X. Xia X. Staphylococcus aureus and methicillin-resistant Staphylococcus aureus in retail raw chicken in China Food Control 2013 29 1 103 106 10.1016/j.foodcont.2012.06.002 2-s2.0-84862999375
44 Lim S. K. Nam H. M. Park H. J. Prevalence and characterization of methicillin-resistant Staphylococcus aureus in raw meat in Korea Journal of Microbiology and Biotechnology 2010 20 4 775 778 20467252
45 Bitrus A. A. Zunita Z. Bejo S. K. Othman S. Nadzir N. A. A. In vitro transfer of methicillin resistance determinants mecA from methicillin resistant Staphylococcus aureus (MRSA) to methicillin susceptible Staphylococcus aureus (MSSA) BMC Microbiology 2017 17 1 p. 83 10.1186/s12866-017-0994-6 2-s2.0-85016822193 28376716
