
==== Front
Virol J
Virol J
Virology Journal
1743-422X
BioMed Central London

2478
10.1186/s12985-024-02478-9
Research
Persistence of two coronaviruses and efficacy of steam vapor disinfection on two types of carpet
Huang Jinge
Fraser Angela
Jiang Xiuping xiuping@clemson.edu

https://ror.org/037s24f05 grid.26090.3d 0000 0001 0665 0280 Department of Food, Nutrition, and Packaging Sciences, Clemson University, 228A Life Science Facility, Clemson, SC 29634 USA
2 9 2024
2 9 2024
2024
21 20712 6 2024
20 8 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Background

Coronaviruses, a group of highly transmissible and potentially pathogenic viruses, can be transmitted indirectly to humans via fomites. To date, no study has investigated their persistence on carpet fibers. Establishing persistence is essential before testing the efficacy of a disinfectant.

Methods

The persistence of BCoV and HCoV OC43 on polyethylene terephthalate (PET) and nylon carpet was first determined using infectivity and RT-qPCR assays. Then, the disinfectant efficacy of steam vapor was evaluated against both coronaviruses on nylon carpet.

Results

Immediately after inoculation of carpet coupons, 32.50% of BCoV and 3.87% of HCoV OC43 were recovered from PET carpet, compared to 34.86% of BCoV and 24.37% of HCoV OC43 recovered from nylon carpet. After incubation at room temperature for 1 h, BCoV and HCoV OC43 showed a 3.6 and > 2.8 log10 TCID50 reduction on PET carpet, and a 0.6 and 1.8 log10 TCID50 reduction on nylon carpet. Based on first-order decay kinetics, the whole gRNA of BCoV and HCoV OC43 were stable with k values of 1.19 and 0.67 h− 1 on PET carpet and 0.86 and 0.27 h− 1 on nylon carpet, respectively. A 15-s steam vapor treatment achieved a > 3.0 log10 TCID50 reduction of BCoV and > 3.2 log10 TCID50 reduction of HCoV OC43 on nylon carpet.

Conclusion

BCoV was more resistant to desiccation on both carpet types than HCoV OC43. Both viruses lost infectivity quicker on PET carpet than on nylon carpet. Steam vapor inactivated both coronaviruses on nylon carpet within 15 s.

Keywords

Bovine coronavirus
Human coronavirus OC43
Carpet
Persistence
Steam vapor disinfection
Clemson UniversityOpen access funding provided by the Carolinas Consortium.

issue-copyright-statement© BioMed Central Ltd., part of Springer Nature 2024
==== Body
pmcIntroduction

Coronaviruses, a group of RNA viruses, can infect various mammalian species, including humans. Among them, betacoronaviruses play a significant role in causing infection. Human betacoronaviruses, such as human coronavirus (HCoV) OC43, Middle East Respiratory Syndrome coronavirus (MERS-CoV), severe acute respiratory syndrome coronavirus (SARS-CoV), and SARS-CoV-2, can cause infections ranging from asymptomatic to severe [1–3]. In cattle, seroprevalence studies indicate that over 90% of cattle are exposed to bovine coronavirus (BCoV) during their lifetime, causing both respiratory and enteric infections [4]. Importantly, due to their close antigenic and genetic relatedness, betacoronaviruses including BCoV, HCoV OC43, SARS-CoV and SARS-CoV-2 exhibit the capacity for interspecies transmission [4–6]. For example, the original host of SARS-CoV was possibly identified as bats [7]. Betacoronaviruses cause a more infection so are a good surrogate for SARS-CoV-2, which can cause a severe infection [7, 8].

Coronaviruses are primarily transmitted through direct contact with aerosols and droplets, with indirect transmission possible when persistent in the environment [9]. Multiple laboratory studies confirmed SARS-CoV-2 persistence on fomites (e.g., furniture, remote controls, countertops) but persistence varies widely depending on surface material [9–12]. For example, stainless steel coupons, a non-porous material, inoculated with SARS-CoV-2 showed a 1 log10 TCID50 reduction in 1 to 2 days, whereas cotton, a porous material, showed more wide-ranging results, from < 1 log10 to > 4 log10 TCID50 reduction in 1 day [10, 13]. These variations suggest the need to determine persistence of coronaviruses on a wider range of surface materials.

Hard flooring has been reported to be a reservoir for viral particles [14]. These particles can be re-suspended in the air through mechanical agitation (e.g., walking and vacuuming) [14, 15]. Less is known about porous flooring materials, such as carpet, which is widely used in public spaces, as it provides comfort, insulates sound, and prevents falls so is often impractical to replace with non-porous materials, such as hard flooring [16, 17]. Carpet is unique due to its composition and structure, which presents special challenges when assessing recovery, persistence, and disinfection of viruses. Traditionally, carpet is cleaned by frequent vacuuming [18, 19]. However, the process of vacuuming might unintentionally resuspend viral particles, dispersing them into the surrounding environment [15, 20]. To disinfect carpet after a bodily fluid event, the U.S. Centers for Disease Control and Prevention (CDC) recommends steam cleaning [20, 21]. Steam vapor is reportedly effective against feline calicivirus (FCV) with a > 3 log10 plaque-forming-unit reduction on wool and nylon carpet within 1.5 min, and bacteriophage Phi6 on polyethylene terephthalate carpet within 1 min [15, 22]. While steam vapor has demonstrated efficacy against some viruses on carpet, its efficacy against coronaviruses, particularly betacoronaviruses, has yet to be confirmed.

The detection of viruses from porous materials is challenging, hence, investigators often rely on the degradation of viral RNA as the sole metric for assessing concentrations of virus in the environment [23, 24]. While this approach provides valuable insights into persistence of the viral genome and structural integrity, it does not provide an assessment of coronavirus infectivity. Furthermore, coronaviruses have exhibited sensitivity to recovery methodology, e.g., detergents used for recovery [25], supporting the need to identify a better recovery method.

We aimed to fill these knowledge gaps by first evaluating the persistence of two pathogenic betacoronaviruses, BCoV and HCoV OC43, on two types of carpet -- polyethylene terephthalate (PET) and nylon. Then we tested the disinfection efficacy of steam vapor against these two coronaviruses on nylon carpet. Our findings can be used to inform disinfection strategies on porous materials, such as carpet.

Materials and methods

Virus propagation and assays

The cell line and virus were cultured as previously described [26]. Briefly, human rectal tumor (HRT-18G) cells, CRL-11663 were acquired from American Type Culture Collection (ATCC)] and cultured in Dulbecco’s Modified Eagle Medium (DMEM) containing 4.5 g/L glucose, 3% low-endotoxin heat-inactivated fetal bovine serum (FBS), 100 U/L penicillin, and 100 mg/L streptomycin at 37 °C and 5% CO2. Ninety percent (90%) confluent monolayers of HRT-18G cells were infected with bovine coronavirus (BCoV) strain Mebus (acquired from BEI Resources, NR-445), or HCoV OC43 (acquired from ATCC, VR-1558) at a multiplicity of infection (MOI) of 0.01, then incubated at 37 °C for five days. BCoV and HCoV OC43 were then harvested from cell lysates by three freeze-thaw cycles followed by centrifugation for 10 min at 5,000 × g and 4 °C. BCoV and HCoV OC43 stocks at ca. 108 50% tissue culture infectious dose (TCID50)/mL were aliquoted and stored at -80 °C. HRT-18G cells were passaged less than 30 times for all experiments.

Infectious BCoV and HCoV OC43 were quantified by TCID50 assay as previously described, with modifications [27]. Briefly, monolayers of HRT-18G cells at 90% confluency were infected with 100 µL of viral samples at 33 °C for 1 h in a humidified 5% CO2 incubator. This was followed by the addition of 100 µL of DMEM containing 4.5 g/L glucose, 2% low-endotoxin FBS, 100 U/L penicillin, and 100 mg/L streptomycin. After incubating at 33 °C in a humidified 5% CO2 incubator for seven days, the virus titer was determined by the improved Kärber method [28]. To test cell line susceptibility to infection and viability, BCoV or HCoV OC43 stock and phosphate buffer saline (PBS) were used as positive and negative controls, respectively.

Carpet coupon preparation and selection of steam cleaner

Two common and popular commercial carpet materials, which accounted for > 50% of production in the United States, PET carpet (Profusion 20®, Shaw Inc., GA, USA) and nylon carpet (Color Accent®, Shaw Inc., GA, USA), were tested. The choice of these two carpets was made according to the Carpet and Rug Institute guidelines - CRI Test Method 114 (carpet-rug.org) and expert opinion. Both PET and nylon carpet had no antimicrobial coating and were low pile with fiber pile thickness at 3.58 and 2.92 mm, respectively. Carpet samples were cut into 5 × 5 cm2 coupons with a mechanical cutting die (model 1500, Freeman Schwabe, OH, USA) (kindly provided by Dr. Daniel Price, Interface Inc., GA, USA) then dusted by gloved hand to remove loose fibers. To remove additional residue, coupons were scoured using a boiling solution of 5 g/L Tergitol N-101 (Spectrum Chemical Inc., New Brunswick, NJ) and 5 g/L of Na2CO3 (Fisher Scientific, MA, USA), then rinsed with cold tap water until visibly clean. Before testing, carpet coupons were autoclaved on a 20-min dry cycle and cooled at room temperature overnight.

A household steam cleaner (IVASTEAMR20, Ivation, NJ, USA) that can generate 170 °C, 29–65 psi steam in its boiler was used with a small round head (4 cm in diameter) to test the efficacy of steam vapor. To prevent cross-contamination during steam vapor treatment, the head of a steam cleaner was wrapped with a sterile terry cloth folded into four layers.

Persistence of coronaviruses on carpet

BCoV and HCoV OC43 were prepared at ca. 108 TCID50/mL with 5% heat-inactivated FBS representing soil load. Each pre-cut carpet coupon was inoculated with 100 µL suspension of either BCoV or HCoV OC43 then kept for 120 min under a biosafety cabinet (Model 1300 A2, Thermo Fisher, MD, USA) at room temperature with a relative humidity at 30–50%. After kept for 0, 10, 20, 30, 60, 90 and 120 min, three coupons were immediately transferred into a flask with 100 mL of PBS plus 0.02% Tween-80 [22, 25]. All flasks were ultrasonicated for 1 min at 40 kHz (Model FS110, Fisher, PA, USA) then vigorously shaken by hand for 30 s. Samples were recovered and concentrations of each coronavirus in each sample were assayed as described above. The percent recovery rate was calculated from titer values without logarithm transformation, while other data was logarithm transformed for analysis. The detection limit was 2.6 log10 TCID50/coupon.

RT-qPCR and RNase-treated RT-qPCR

Viral genome RNA (gRNA) extraction was performed as previously described [22]. Briefly, BCoV and HCoV OC43 gRNAs were extracted from 0.15 mL of carpet samples using an ENZA viral RNA kit (Omega Bio-Tek, GA, USA) per manufacturer instructions. After extraction, gRNAs were stored at -80 °C before further analysis.

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) was performed for BCoV and HCoV OC43 separately to determine the loss of viral gRNAs using a Platinum SYBR Green PCR kit (Invitrogen, CA, USA). For RT-qPCR analysis, the forward and reverse primer sequences were CTGGAAGTTGGTGGAGTT and ATTATCGGCCTAACATACATC for BCoV, respectively, and CGATGAGGCTATTCCGACTAGGT and CCTTCCTGAGCCTTCAATATAGTAACC for HCoV OC43, respectively. The standard curves were individually prepared for BCoV and HCoV OC43 by 7-step, 10-fold dilutions of virus stocks.

To assess the structural integrity of the viral capsid, the exposed gRNA, due to capsid cleavage, was removed by RNase I pretreatment of samples prior to RNA extraction [29]. Briefly, 0.1 U/µL RNase I (Thermo Fisher, MD, USA) was mixed with 250 µL of samples and incubated at 37 °C for 15 min. RNA extraction was performed immediately after the RNase-I pretreatment as described above.

Determination of disinfection efficacy of steam vapor against coronaviruses on nylon carpet

As both coronaviruses did not persist on the PET carpet, disinfection efficacy of steam vapor was determined only on nylon carpet following the protocol in a previous study with minor modifications [22]. Briefly, each pre-cut coupon was inoculated with a 100 µL suspension of either BCoV or HCoV OC43 then dried for 1 h at room temperature at a relative humidity at 30–50%. To evaluate steam vapor efficacy, the steam cleaner was preheated, then the wrapped head and hose were saturated with steam for 10 s per manufacturer instructions. The cloth wrapped head was changed between samples to avoid cross-contamination. Coupons were scrubbed vertically for 15 s with steam. All coupons were transferred into a flask with 100 ml of PBS plus 0.02% Tween-80 to elute virus from carpet coupons. To evaluate the effect of scrubbing on virus inoculum, three coupons were scrubbed using the wrapped head of steam cleaner without heat as the scrubbed controls, while three unscrubbed coupons were immediately transferred to elution buffer after drying to evaluate desiccation effect. All flasks were ultrasonicated for 1 min at 40 kHz then vigorously shaken by hand for 30 s to recover virus inoculum from carpet coupons. Titers of BCoV and HCoV OC43 in samples were assayed by TCID50 assay as described above. A 3 log10 TCID50/coupon reduction was used as the benchmark for successful disinfection efficacy, which is in accordance with guidelines from the U.S. Environment Protection Agency [30]. The temperature of steam vapor was measured using type T thermocouples (HotMux, DCC Corporation, NJ, USA).

Carpet absorption capacity

To measure the hydrophobicity of carpet fibers, the water absorption capacity of carpet fibers was tested as described previously [31]. Briefly, the carpet fibers were cut from the coupons using a disposable scalpel (Sklar, PA, USA) then 0.1 g of fibers were packed in a 2-mL microcentrifuge tube (Fisher Scientific, CA, USA). PET and nylon fibers were thoroughly mixed with an indicator dye, safranin solution (0.1%), in increments of 0.05 mL until the carpet was saturated and removed afterwards. The weight of residual liquid was obtained by subtracting the weight of the empty microcentrifuge tube from the weight of the microcentrifuge tube after treatment.

Statistical analysis

Six replicates were tested in two independent tests to determine persistence of each coronavirus, whereas 2 independent tests with 5 replicates (N = 10) were conducted to test disinfection efficacy of steam vapor against each of the two coronaviruses. Microbial reductions were calculated using log10 (N0/Nd), where N0 is the average coronavirus titers from the samples at 0 min after drying or the control samples, and Nd is the average coronavirus titers from the samples at different sampling times or the steam-treated samples.

For RNA determination, the first-order decay rate constants (k) were calculated using the following Eq. (1), where N0 is the average amount of coronavirus RNA at 0 h and Nt the average amount of coronavirus RNA at time (t). k values were calculated by plotting ln (Nt/N0) versus time (t) and calculating the slope, its standard error, with β0 as the intercept.1 \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{mathrsfs} \usepackage{upgreek} \setlength{\oddsidemargin}{-69pt} \begin{document}$$\:\text{ln}\left(\frac{{N}_{t}}{{N}_{0}}\right)={\beta\:}_{0}-kt$$\end{document}

Statistical analysis was performed using a one-way multiple-comparison ANOVA and Tukey’s test to determine the relationship between steam vapor and virus titer reduction. All results were expressed as mean ± standard deviation. Statistical significance was defined as a p-value of < 0.05. Statistical analyses were conducted using GraphPad Prism 6.01 (GraphPad Software, Inc., CA, USA).

Results

Persistence of infectious coronaviruses on carpet

The immediate recovery rate of BCoV from PET and nylon carpet, with an initial inoculum level at 4.2 × 106 – 1.8 × 107 TCID50/coupon, was 32.50% and 34.86%, respectively. This was significantly higher than the recovery rate of HCoV OC43 from PET and nylon carpet, with initial inoculum level at 7.1 × 106 – 2.1 × 107 TCID50/coupon, which was 3.87% and 24.37%, respectively (Table 1).

Table 1 Recovery rate of BCoV and HCoV OC43 from carpets

Virus	Recovery rate (%) a	
PET carpet	Nylon carpet	
Viability	gRNA copies	Viability	gRNA copies	
BCoV	32.50 ± 14.32A	52.32 ± 35.43A	34.86 ± 12.44A	57.64 ± 6.54A	
HCoV OC43	3.87 ± 2.02B	40.84 ± 7.57A	24.37 ± 6.21B	28.54 ± 8.71B	
a The percent recovery rate was calculated from titer values without logarithm transformation. Data are expressed as mean ± standard deviation (SD) from triplicates from each of 2 independent experiments. Values with different letters for the same fiber (e.g., A, B) indicate significant difference (p < 0.05) in Tukey’s test grouping

After 0, 10, 20, 30, 60, and 90 min of inoculation, the titers of BCoV on PET carpet were 6.1, 5.8, 5.6, 5.1, 2.7, and < 2.6 log10 TCID50/coupon, respectively, and the titers of HCoV OC43 were 5.4, 4.8, 4.4, 4.1, < 2.6, and < 2.6 log10 TCID50/coupon, respectively (Fig. 1A). In contrast, 6.8, 6.7, 6.5, 6.2, 6.1, 6.0 and 5.3 log10 TCID50/coupon of BCoV were detected on nylon carpet after 0, 10, 20, 30, 60, 90, and 120 min, respectively (Fig. 1B), and 6.7, 6.5, 6.6, 6.4, 5.7, 5.5 and 4.9 log10 TCID50/coupon of HCoV OC43, respectively.

Fig. 1 Two infectious coronaviruses on PET (A) and nylon (B) carpets. Data are expressed as mean ± standard deviation (SD) from six replicates in two trials. Dotted lines indicate the detection limit at 2.6 log10 TCID50

Persistence of coronavirus whole genome on carpet

The immediate recovery rate of BCoV gRNA from PET and nylon carpet was 52.32% and 57.64%, respectively, as compared with 40.84% and 28.54% for HCoV OC43 gRNA from PET and nylon carpet, respectively (Table 1). On PET carpet, gRNA of BCoV decreased by 0.23, 0.69, 0.90. 0.97, and 1.08 log10 genome copies (gc)/coupon, respectively, and a 0.22, 0.35, 0.50, 0.57, and 0.61 log10 gc/coupon reduction of HCoV OC43 after 10, 20, 30, 60, and 90 min, respectively (Fig. 2A). On nylon carpet, gRNAs of BCoV showed a 0.11, 0.13, 0.14, 0.47, 0.52, and 0.87 log10 gc/coupon reduction after 10, 20, 30, 60, 90, and 120 min, respectively, while gRNA of HCoV OC43 had a 0.20, 0.21, 0.16, 0.06, 0.28, and 0.44 log10 gc/coupon reduction, respectively (Fig. 2B). Based on first-order decay kinetics, the k values of BCoV and HCoV OC43 whole gRNA on PET carpet were 1.19 and 0.67 h− 1, respectively, and on nylon carpet were 0.86 and 0.27 h− 1, respectively (Table 2).

Fig. 2 RNA copy reduction of BCoV and HCoV OC43 on PET (A) and nylon (B) carpets, and RNase I-treated BCoV and HCoV OC43 on PET (C) and nylon (D) carpets. Data are expressed as mean ± standard deviation (SD) from six replicates in two trials

Table 2 First-order decay rate constants k for whole gRNAs and unexposed gRNAs of BCoV and HCoV OC43 on PET and nylon carpet

Virus	Decay rate constants k (h− 1) a	
Whole gRNA	Unexposed gRNA	
PET carpet	Nylon carpet	PET carpet	Nylon carpet	
BCoV	1.19 ± 0.62A/A	0.86 ± 0.29A/A	0.61 ± 0.20A/A	0.84 ± 0.21A/A	
HCoV OC43	0.67 ± 0.30A/A	0.27 ± 0.14A/A	0.28 ± 0.33A/A	0.43 ± 0.20B/A	
a Data are expressed as mean ± standard deviation (SD), calculated based on triplicates at each of the five sampling time intervals. Values with different letters within/across carpet type (e.g., A/A, B/A) for the whole gRNA or unexposed gRNA indicate significant difference (p < 0.05) in Tukey’s test grouping

Persistence of coronavirus unexposed genome on carpet

Compared to the whole gRNA, unexposed gRNA wrapped inside viral capsids, which representing the intact capsid, was decreased more slowly on PET carpet by a 0.03, 0.18, 0.10, 0.14, and 0.33 log10 gc/coupon reduction of BCoV, and a 0.38, 0.29, 0.36, 0.52, 0.40 log10 gc/coupon reduction of HCoV OC43 after 10, 20, 30, 60, and 90 min, respectively (Fig. 2C). On nylon carpet, gRNA of BCoV was decreased by 0.07, 0.33, 0.19, 0.23, 0.43, and 0.73 log10 gc/coupon reduction after 10, 20, 30, 60, 90, and 120 min, respectively, whereas gRNA of HCoV OC43 had a 0.38, 0.29, 0.36, 0.52, 0.40, and 0.63 log10 gc/coupon reduction, respectively (Fig. 2D). As the exposed gRNA was removed by RNase I, the k values of unexposed gRNA from BCoV and HCoV OC43 were 0.61 and 0.28 h− 1 on PET carpet, respectively, and 0.84 and 0.43 h− 1on nylon carpet, respectively (Table 2).

Efficacy of steam vapor against coronaviruses on nylon carpet

Following a 1-hour drying period on nylon carpet, desiccation resulted in a 0.4 log10 TCID50 reduction for BCoV and 0.6 log10 TCID50/coupon reduction for HCoV OC43 (Fig. 3). The temperature of steam vapor from the steam cleaner head reached 99.44 ± 0.98 °C. Subsequent treatment with steam vapor inactivated both BCoV and HCoV OC43 across all carpet coupons in 15 s, indicating virucidal efficacy of this approach. Specifically, steam vapor achieved a > 3.0 log10/coupon TCID50 reduction of BCoV and > 3.2 log10 TCID50/coupon of HCoV OC43 on nylon carpet. Mechanical scrubbing alone resulted in a 0.2 log10 TCID50/coupon reduction for both BCoV and HCoV OC43.

Fig. 3 Efficacy of steam vapor against two coronaviruses on nylon carpet. Data are expressed as mean ± standard deviation (SD) from ten replicates in two trials. The dash lines indicate the detection limit for titer reduction (BCoV >3.0, HCoV OC43 >3.2 log10 TCID50/coupon). The p-value among treatments for each virus was ≥ 0.05 (ns), < 0.01 (**) and < 0.0001 (****)

Carpet absorption capacity

PET fiber (0.1 g) absorbed up to 0.65–0.70 mL of safranin solution (Table 3). In contrast, 0.1 g of nylon fibers reached saturation, retaining only 0.50–0.55 mL of safranin solution. When 0.55 mL of safranin solution was added, nylon fibers had a greater amount of residual liquid than did PET fibers. Therefore, PET fibers tested exhibited a higher degree of hydrophilicity compared to nylon fibers.

Table 3 Absorptive capacity of carpet fibers

Samplea	Vol added (mL)	Residual wt (µg)b	
PET	0.500	6.2 ± 1.3A	
	0.550	7.2 ± 1.8AB	
	0.600	8.5 ± 2.3AB	
	0.650	12.5 ± 5.2BC	
	0.700	15.3 ± 5.2C	
Nylon	0.400	5.7 ± 1.0A	
	0.450	8.8 ± 1.8A	
	0.500	9.7 ± 2.5AB	
	0.550	16.3 ± 6.0B	
	0.600	23.5 ± 6.9C	
a Carpet fiber samples were 0.1 g each

b Data are expressed as mean ± standard deviation (SD) from triplicates at each of 2 independent experiments. Values of residual weight with different letters for the same fiber (e.g., A, B) indicate significant difference (p < 0.05) in Tukey’s test grouping

Discussion

The persistence of two betacoronaviruses on PET and nylon carpets and the efficacy of steam disinfection of both coronaviruses on nylon carpet were investigated. In our study, more viable BCoV was recovered from both carpet types than was HCoV OC43, while BCoV was more resistant to desiccation on surfaces with a slower loss in infectivity. The more hydrophilic PET carpet caused significant loss of infectivity for both coronaviruses and possible viral capsid damage, highlighting that infection assays are more accurate in assessing coronavirus infectivity loss than RT-qPCR assays. Our persistence results suggest risk of viral transmission may be low after the contamination of PET carpet by coronaviruses due to the rapid loss of infectivity. Conversely, both viruses declined slowly on nylon carpet. Lastly, steam vapor was efficacious enough to eliminate both coronaviruses within 15 s, indicating the potential of steam vapor as a rapid and effective disinfectant against coronaviruses including SARS-CoV-2 on porous surfaces like nylon carpet.

Coronaviruses, such as SARS-CoV-2, are hard to recover from environmental surfaces, with the recovery rate affected by the surface material and recovery methods [25]. For example, Riddell and colleagues [10] recovered viable coronaviruses by repeated pipetting with an approximate 3-log loss from cotton cloth. In addition, other studies also revealed the adverse effect of recovery media, composition of surfactants and elution methods on the recovery rate of coronaviruses [32]. To our knowledge, no study has reported the recovery of coronaviruses from carpet materials. This is possibly attributed to the fact that surfactants and mechanical agitation used for recovery could chemically and physically affect the phospholipid layer and spike proteins on viral envelopes [25]. The envelope structure of coronaviruses plays a critical role in its attaching and entering host cells, hence, any damage to the envelope structure including the phospholipid layer and spike proteins might lead to loss of infectivity [25, 33]. In our study, BCoV and HCoV OC43 were successfully recovered, with less than 1 log10 TCID50 reduction from PET and nylon carpet using the method reported previously for norovirus [22]. However, more HCoV OC43 was lost in recovery than BCoV, suggesting BCoV was more resistant to the recovery method. Additionally, the higher gRNA recovery rates immediately following inoculation suggest the effectiveness of our elution method (Table 1).

HCoV OC43 was less persistent on PET fabrics with > 3 log10 TCID50 reduction after 1 h at 35 °C [34]. A similar result was observed in our study as viable BCoV and HCoV OC43 were rapidly inactivated on PET carpet, reaching the detection limit within one hour. In comparison, both coronaviruses survived longer on nylon carpet with ≤ 2 log10 TCID50 reduction of viable viruses after two hours. Different levels of persistence of these two coronaviruses were also observed on plastic and vinyl surfaces [26]. In contrast, SARS-CoV-2 has been shown to survive longer for 1–7 days at 20–30 °C on cotton cloth, and HCoV OC43 survived for 2 days at room temperature [10, 35]. The correlation between persistence of coronaviruses and surface material and construction could be explained by the fact that coronaviruses were rapidly inactivated on carpet fabric with a faster water absorption [35], which our absorption data also supported (Table 3). Viruses can easily cover the surface of hydrophilic fibers, resulting in larger surface area of exposure to desiccation, whereas the high surface hydrophobicity promotes virus aggregation and concentration to protect viruses within the aggregates [12, 36]. Additionally, the rate of decline for unexposed gRNAs was significantly slower than that of whole gRNAs for both BCoV and HCoV OC43 on PET carpet. This difference was not observed on nylon carpet. Therefore, coronavirus capsids are more likely to be damaged on PET carpet than on nylon carpet, which is more hydrophobic.

Infectivity assays are not always used in studies regarding non-porous and porous environmental surfaces, partially due to the challenges associated with the recovery of viable viruses from surfaces [25, 37, 38]. In our study, the reduction of coronavirus gRNA on PET carpet occurred at a slower rate (< 1 log10 gc h− 1) than did the decline in viral infectivity (> 2.8 log10 TCID50 h− 1) at room temperature. Coronavirus gRNAs are encased within viral capsids, protecting the structure [39]. Environmental factors can facilitate the disruption of viral envelopes and capsids before acting upon the gRNAs. As such, relying solely on gRNA detection may not accurately reflect the persistence of coronavirus and its disinfection efficacy.

Interestingly, we found that unlike infectivity, whole gRNAs of HCoV OC43 degraded slower than BCoV on both PET and nylon carpet (Fig. 2A-B). This is likely due to the capsid protein of HCoV OC43 being more resistant to desiccation. As most coronaviruses only share 43% identity on the structural protein-coding region [40], it is not surprising that the HCoV OC43 capsid is more resistant than BCoV to desiccation but still within the same order of magnitude. Apart from structural proteins, HCoV OC43 shared similar spike proteins with BCoV, particularly both viruses having a deletion within the S1 subunit of the spike protein [41]. While oxidation-sensitive amino acids (i.e., tyrosine, tryptophan, and histidine) are abundant in the receptor binding domain of the spike proteins [42], the spike proteins of HCoV OC43 are more sensitive than BCoV to oxidation [42], resulting in the significant loss of infectivity for HCoV OC43 when drying on PET carpet.

Heat is an important factor for the persistence and disinfection efficacy of viruses. More than 3 log10 TCID50 of MERS-CoV, SARS-CoV, and SARS-CoV-2 were reduced in cell culture medium when exposure to temperatures ≥ 60 °C was as short as 15 min [43–45]. However, such heat inactivation of coronaviruses has been investigated in suspension only. Because BCoV and HCoV OC43 were reduced below the detection limit during a 1-h drying on PET carpet, we investigated the efficacy of steam vapor against both coronaviruses only on nylon carpet. Steam vapor was efficacious against both coronaviruses on nylon carpet, achieving > 3 log10 TCID50/coupon reduction within 15 s (Fig. 3). This robust virucidal activity can be attributed to the potential of steam vapor reaching temperatures as high as 99.44 ± 0.98 °C on carpet, while mechanical forces, like scrubbing without heat could only inactivate a few coronavirus particles. Moreover, steam vapor has been proven to be safer for use on nylon carpets, with minimal impact on carpet properties [46]. However, it’s important to acknowledge that the efficacy of disinfectants including steam vapor could be influenced by other factors [47]. Specifically, fiber construction, including characteristics like looped or pile cut, materials employed, and fiber length, all could affect the performance of steam vapor [22]. Due to the scope of this study, we were unable to comprehensively evaluate these factors or perform a complete kill analysis during steam treatment. This limitation leaves room for further investigation in future research.

Conclusion

In summary, this study examined the persistence of two betacoronaviruses, BCoV and HCoV OC43, on PET and nylon carpet. Our results showed that more viable BCoV was recovered from both carpets than was HCoV OC43. Additionally, viable viruses were rapidly inactivated on PET carpet, but titers remained relatively stable on nylon carpet. Furthermore, we confirmed that steam vapor is an effective disinfectant against both coronaviruses on nylon carpet. This study addressed the critical issue of disinfecting carpet contaminated with coronavirus. These results can be used to inform effective disinfection of human and animal coronavirus on porous materials. Additionally, in the absence of biosafety level-3 facilities, both BCoV and HCoV OC43 can be used to screen disinfectants for efficacy against SARS-CoV-2.

Acknowledgements

We appreciated Drs. Geun Woo Park and Jan Vinjé (Centers for Disease Control and Prevention, GA, USA) for technical guidance on working with coronaviruses and Dr. Kristin Gibson at University of Arkansas for helpful discussion. Any opinions, findings, conclusions, or recommendations expressed in this publication are those of the author(s) and do not necessarily reflect the view of the United States Department of Agriculture-National Institute of Food and Agriculture (USDA-NIFA) and Agency for Healthcare Research and Quality (AHRQ).

Author contributions

J.H. collected the data and wrote the main manuscript text. A.F. acquired funding and reviewed the manuscript. X.J. acquired funding, supervised, and reviewed the manuscript.

Funding

This research was financially supported by grants from the USDA-NIFA grant number 2020-67017-32427 and the AHRQ, grant number 1R01HS025987-01.

Open access funding provided by the Carolinas Consortium.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Abbreviations

BCoV Bovine coronavirus

HCoV OC43 Human coronavirus OC43

MERS-CoV Middle East Respiratory Syndrome coronavirus

SARS-CoV Severe acute respiratory syndrome coronavirus

CDC United States Centers for Disease Control and Prevention

PET Polyethylene terephthalate

DMEM Dulbecco’s Modified Eagle Medium

TCID50 Median tissue culture infectious dose

PBS Phosphate buffer saline

gRNA Genome RNA

RT-qPCR Reverse transcription quantitative polymerase chain reaction

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
==== Refs
References

1. van Doremalen N Bushmaker T Munster VJ Stability of Middle East respiratory syndrome coronavirus (MERS-CoV) under different environmental conditions Euro Surveill 2013 18 20590 24084338
van Doremalen N, Bushmaker T, Munster VJ. Stability of Middle East respiratory syndrome coronavirus (MERS-CoV) under different environmental conditions. Euro Surveill. 2013;18:20590.24084338
2. Lai MYY Cheng PKC Lim WWL Survival of severe acute respiratory syndrome coronavirus Clin Infect Dis 2005 41 e67 71 10.1086/433186 16142653
Lai MYY, Cheng PKC, Lim WWL. Survival of severe acute respiratory syndrome coronavirus. Clin Infect Dis. 2005;41:e67–71.16142653 10.1086/433186
3. World Health Organization. WHO Coronavirus Disease (COVID-19) Pandemic [https://www.who.int/emergencies/diseases/novel-coronavirus-2019. ].
4. Vlasova AN Saif LJ Bovine coronavirus and the associated diseases Front Vet Sci 2021 8 643220 10.3389/fvets.2021.643220 33869323
Vlasova AN, Saif LJ. Bovine coronavirus and the associated diseases. Front Vet Sci. 2021;8:643220.33869323 10.3389/fvets.2021.643220
5. Vijgen L Keyaerts E Moes E Thoelen I Wollants E Lemey P Vandamme AM Van Ranst M Complete genomic sequence of human coronavirus OC43: molecular clock analysis suggests a relatively recent zoonotic coronavirus transmission event J Virol 2005 79 1595 604 10.1128/JVI.79.3.1595-1604.2005 15650185
Vijgen L, Keyaerts E, Moes E, Thoelen I, Wollants E, Lemey P, Vandamme AM, Van Ranst M. Complete genomic sequence of human coronavirus OC43: molecular clock analysis suggests a relatively recent zoonotic coronavirus transmission event. J Virol. 2005;79:1595–604.15650185 10.1128/JVI.79.3.1595-1604.2005
6. Woo PC Lau SK Huang Y Yuen KY Coronavirus diversity, phylogeny and interspecies jumping Exp Biol Med 2009 234 1117 27 10.3181/0903-MR-94
Woo PC, Lau SK, Huang Y, Yuen KY. Coronavirus diversity, phylogeny and interspecies jumping. Exp Biol Med. 2009;234:1117–27.10.3181/0903-MR-94
7. String GM White MR Gute DM Muhlberger E Lantagne DS Selection of a SARS-CoV-2 surrogate for use in surface disinfection efficacy studies with chlorine and antimicrobial surfaces Environ Sci Technol Lett 2021 8 995 1001 10.1021/acs.estlett.1c00593 37566364
String GM, White MR, Gute DM, Muhlberger E, Lantagne DS. Selection of a SARS-CoV-2 surrogate for use in surface disinfection efficacy studies with chlorine and antimicrobial surfaces. Environ Sci Technol Lett. 2021;8:995–1001.37566364 10.1021/acs.estlett.1c00593
8. Sholukh AM Fiore-Gartland A Ford ES Miner MD Hou YJ Tse LV Kaiser H Zhu H Lu J Madarampalli B Evaluation of cell-based and surrogate SARS-CoV-2 neutralization assays J Clin Microbiol 2021 59 e0052721 10.1128/JCM.00527-21 34288726
Sholukh AM, Fiore-Gartland A, Ford ES, Miner MD, Hou YJ, Tse LV, Kaiser H, Zhu H, Lu J, Madarampalli B, et al. Evaluation of cell-based and surrogate SARS-CoV-2 neutralization assays. J Clin Microbiol. 2021;59:e0052721.34288726 10.1128/JCM.00527-21
9. Shragai T Pratt C Castro Georgi J Donnelly MAP Schwartz NG Soto R Chuey M Chu VT Marcenac P Park GW Household characteristics associated with surface contamination of SARS-CoV-2 and frequency of RT-PCR and viral culture positivity-California and Colorado, 2021 PLoS ONE 2022 17 e0274946 10.1371/journal.pone.0274946 36215247
Shragai T, Pratt C, Castro Georgi J, Donnelly MAP, Schwartz NG, Soto R, Chuey M, Chu VT, Marcenac P, Park GW, et al. Household characteristics associated with surface contamination of SARS-CoV-2 and frequency of RT-PCR and viral culture positivity-California and Colorado, 2021. PLoS ONE. 2022;17:e0274946.36215247 10.1371/journal.pone.0274946
10. Riddell S Goldie S Hill A Eagles D Drew TW The effect of temperature on persistence of SARS-CoV-2 on common surfaces Virol J 2020 17 1 7 10.1186/s12985-020-01418-7 31906972
Riddell S, Goldie S, Hill A, Eagles D, Drew TW. The effect of temperature on persistence of SARS-CoV-2 on common surfaces. Virol J. 2020;17:1–7.31906972 10.1186/s12985-020-01418-7
11. Aboubakr HA Sharafeldin TA Goyal SM Stability of SARS-CoV-2 and other coronaviruses in the environment and on common touch surfaces and the influence of climatic conditions: a review Transbound Emerg Dis 2021 68 296 312 10.1111/tbed.13707 32603505
Aboubakr HA, Sharafeldin TA, Goyal SM. Stability of SARS-CoV-2 and other coronaviruses in the environment and on common touch surfaces and the influence of climatic conditions: a review. Transbound Emerg Dis. 2021;68:296–312.32603505 10.1111/tbed.13707
12. Paton S Spencer A Garratt I Thompson KA Dinesh I Aranega-Bou P Stevenson D Clark S Dunning J Bennett A Pottage T Persistence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus and viral RNA in relation to surface type and contamination concentration Appl Environ Microbiol 2021 87 e0052621 10.1128/AEM.00526-21 33962986
Paton S, Spencer A, Garratt I, Thompson KA, Dinesh I, Aranega-Bou P, Stevenson D, Clark S, Dunning J, Bennett A, Pottage T. Persistence of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) virus and viral RNA in relation to surface type and contamination concentration. Appl Environ Microbiol. 2021;87:e0052621.33962986 10.1128/AEM.00526-21
13. Kasloff SB Leung A Strong JE Funk D Cutts T Stability of SARS-CoV-2 on critical personal protective equipment Sci Rep 2021 11 984 10.1038/s41598-020-80098-3 33441775
Kasloff SB, Leung A, Strong JE, Funk D, Cutts T. Stability of SARS-CoV-2 on critical personal protective equipment. Sci Rep. 2021;11:984.33441775 10.1038/s41598-020-80098-3
14. Khare P Marr LC Simulation of vertical concentration gradient of influenza viruses in dust resuspended by walking Indoor Air 2015 25 428 40 10.1111/ina.12156 25208212
Khare P, Marr LC. Simulation of vertical concentration gradient of influenza viruses in dust resuspended by walking. Indoor Air. 2015;25:428–40.25208212 10.1111/ina.12156
15. Nastasi N Renninger N Bope A Cochran SJ Greaves J Haines SR Balasubrahmaniam N Stuart K Panescu J Bibby K Persistence of viable MS2 and Phi6 bacteriophages on carpet and dust Indoor Air 2022 32 e12969 10.1111/ina.12969 34882845
Nastasi N, Renninger N, Bope A, Cochran SJ, Greaves J, Haines SR, Balasubrahmaniam N, Stuart K, Panescu J, Bibby K, et al. Persistence of viable MS2 and Phi6 bacteriophages on carpet and dust. Indoor Air. 2022;32:e12969.34882845 10.1111/ina.12969
16. Harris DD The influence of flooring on environmental stressors: a study of three flooring materials in a hospital HERD 2015 8 9 29 10.1177/1937586715573730 25929469
Harris DD. The influence of flooring on environmental stressors: a study of three flooring materials in a hospital. HERD. 2015;8:9–29.25929469 10.1177/1937586715573730
17. Dixit MK Singh S Lavy S Yan W Floor finish selection in health-care facilities: a systematic literature review Facilities 2019 37 897 918 10.1108/F-03-2018-0042
Dixit MK, Singh S, Lavy S, Yan W. Floor finish selection in health-care facilities: a systematic literature review. Facilities. 2019;37:897–918.10.1108/F-03-2018-0042
18. Roberts JW Clifford WS Glass G Hummer PC Reducing dust, lead, dust mites, bacteria, and fungi in carpets by vacuuming Arch Environ Con Tox 1999 36 477 84 10.1007/PL00022756
Roberts JW, Clifford WS, Glass G, Hummer PC. Reducing dust, lead, dust mites, bacteria, and fungi in carpets by vacuuming. Arch Environ Con Tox. 1999;36:477–84.10.1007/PL00022756
19. Centers for Disease Control and Prevention Guidelines for environmental infection control in health-care facilities: recommendations of CDC and the Healthcare Infection Control Practices Advisory Committee (HICPAC) MMWR Recomm Rep 2003 52 1 6
Centers for Disease Control and Prevention. Guidelines for environmental infection control in health-care facilities: recommendations of CDC and the Healthcare Infection Control Practices Advisory Committee (HICPAC). MMWR Recomm Rep. 2003;52:1–6.
20. Hall AJ Vinjé J Lopman B Park GW Yen C Gregoricus N Parashar U Updated norovirus outbreak management and disease prevention guidelines MMWR Recomm Rep 2011 60 1 18
Hall AJ, Vinjé J, Lopman B, Park GW, Yen C, Gregoricus N, Parashar U. Updated norovirus outbreak management and disease prevention guidelines. MMWR Recomm Rep. 2011;60:1–18.
21. Centers for Disease Control and Prevention. Mpox-Cleaning and disinfecting. Centers for Disease Control and Prevention; 2023.
22. Buckley D Dharmasena M Fraser A Pettigrew C Anderson J Jiang X Efficacy of silver dihydrogen citrate and steam vapor against a human norovirus surrogate, feline calicivirus, in suspension, on glass, and on carpet Appl Environ Microbiol 2018 84 e00233 00218 10.1128/AEM.00233-18 29625987
Buckley D, Dharmasena M, Fraser A, Pettigrew C, Anderson J, Jiang X. Efficacy of silver dihydrogen citrate and steam vapor against a human norovirus surrogate, feline calicivirus, in suspension, on glass, and on carpet. Appl Environ Microbiol. 2018;84:e00233–00218.29625987 10.1128/AEM.00233-18
23. Sun Z-P Yang S-Y Cai X Han W-D Hu G-W Qian Y Wang Y-Y Zhang R Xie Y-H Qu D Survival of SARS-CoV-2 in artificial seawater and on the surface of inanimate materials J Med Virol 2022 94 3982 7 10.1002/jmv.27807 35474579
Sun Z-P, Yang S-Y, Cai X, Han W-D, Hu G-W, Qian Y, Wang Y-Y, Zhang R, Xie Y-H, Qu D. Survival of SARS-CoV-2 in artificial seawater and on the surface of inanimate materials. J Med Virol. 2022;94:3982–7.35474579 10.1002/jmv.27807
24. Tiwari A Phan N Tandukar S Ashoori R Thakali O Mousazadesh M Dehghani MH Sherchan SP Persistence and occurrence of SARS-CoV-2 in water and wastewater environments: a review of the current literature Environ Sci Pollut Res 2022 29 85658 68 10.1007/s11356-021-16919-3
Tiwari A, Phan N, Tandukar S, Ashoori R, Thakali O, Mousazadesh M, Dehghani MH, Sherchan SP. Persistence and occurrence of SARS-CoV-2 in water and wastewater environments: a review of the current literature. Environ Sci Pollut Res. 2022;29:85658–68.10.1007/s11356-021-16919-3
25. Welch SR Davies KA Buczkowski H Hettiarachchi N Green N Arnold U Jones M Hannah MJ Evans R Burton C Analysis of inactivation of SARS-CoV-2 by specimen transport media, nucleic acid extraction reagents, detergents, and fixatives J Clin Microbiol 2020 58 10 1128 10.1128/JCM.01713-20
Welch SR, Davies KA, Buczkowski H, Hettiarachchi N, Green N, Arnold U, Jones M, Hannah MJ, Evans R, Burton C, et al. Analysis of inactivation of SARS-CoV-2 by specimen transport media, nucleic acid extraction reagents, detergents, and fixatives. J Clin Microbiol. 2020;58:10–1128.10.1128/JCM.01713-20
26. Park GW, Relja B, Vinje J. Comparison of environmental surface persistence of cultivable coronaviruses as a surrogate for SARS-CoV-2. ASM Microbe 2022 2022.
27. Yoshizawa N Ishihara R Omiya D Ishitsuka M Hirano S Suzuki T Application of a photocatalyst as an inactivator of bovine coronavirus Viruses 2020 12 1372 10.3390/v12121372 33266175
Yoshizawa N, Ishihara R, Omiya D, Ishitsuka M, Hirano S, Suzuki T. Application of a photocatalyst as an inactivator of bovine coronavirus. Viruses. 2020;12:1372.33266175 10.3390/v12121372
28. Lei CF Yang J Hu J Sun XL On the calculation of TCID50 for quantitation of virus infectivity Virol Sin 2021 36 141 4 10.1007/s12250-020-00230-5 32458296
Lei CF, Yang J, Hu J, Sun XL. On the calculation of TCID50 for quantitation of virus infectivity. Virol Sin. 2021;36:141–4.32458296 10.1007/s12250-020-00230-5
29. Kennedy LC Costantini VP Huynh KA Loeb SK Jennings WC Lowry S Mattioli MC Vinje J Boehm AB Persistence of human norovirus (GII) in surface water: Decay rate constants and inactivation mechanisms Environ Sci Technol 2023 57 3671 9 10.1021/acs.est.2c09637 36812385
Kennedy LC, Costantini VP, Huynh KA, Loeb SK, Jennings WC, Lowry S, Mattioli MC, Vinje J, Boehm AB. Persistence of human norovirus (GII) in surface water: Decay rate constants and inactivation mechanisms. Environ Sci Technol. 2023;57:3671–9.36812385 10.1021/acs.est.2c09637
30. Environmental Protection Agency. OCSPP 810.2200 disinfectants for use on environmental surfaces, guidance for efficacy testing. Environmental Protection Agency; 2018.
31. Buckley D Fraser A Huang G Jiang X Recovery optimization and survival of the human norovirus surrogates feline calicivirus and murine norovirus on carpet Appl Environ Microbiol 2017 83 e01336 01317 10.1128/AEM.01336-17 28864657
Buckley D, Fraser A, Huang G, Jiang X. Recovery optimization and survival of the human norovirus surrogates feline calicivirus and murine norovirus on carpet. Appl Environ Microbiol. 2017;83:e01336–01317.28864657 10.1128/AEM.01336-17
32. Owen L Shivkumar M Cross RBM Laird K Porous surfaces: stability and recovery of coronaviruses Interface Focus 2021 12 20210039 10.1098/rsfs.2021.0039 34956608
Owen L, Shivkumar M, Cross RBM, Laird K. Porous surfaces: stability and recovery of coronaviruses. Interface Focus. 2021;12:20210039.34956608 10.1098/rsfs.2021.0039
33. Jackson CB Farzan M Chen B Choe H Mechanisms of SARS-CoV-2 entry into cells Nat Rev Mol Cell Bio 2022 23 3 20 10.1038/s41580-021-00418-x 34611326
Jackson CB, Farzan M, Chen B, Choe H. Mechanisms of SARS-CoV-2 entry into cells. Nat Rev Mol Cell Bio. 2022;23:3–20.34611326 10.1038/s41580-021-00418-x
34. Owen L Shivkumar M Laird K The stability of model human coronaviruses on textiles in the environment and during health care laundering mSphere 2021 6 e00316 00321 10.1128/mSphere.00316-21 33910996
Owen L, Shivkumar M, Laird K. The stability of model human coronaviruses on textiles in the environment and during health care laundering. mSphere. 2021;6:e00316–00321.33910996 10.1128/mSphere.00316-21
35. Tracy S Derby C Virjee N Hardwick M Virus inactivation on common indoor contract fabrics Indoor Built Environ 2022 31 1381 92 10.1177/1420326X221084904
Tracy S, Derby C, Virjee N, Hardwick M. Virus inactivation on common indoor contract fabrics. Indoor Built Environ. 2022;31:1381–92.10.1177/1420326X221084904
36. Karunakaran AC Murugkar HV Kumar M Nagarajan S Tosh C Pathak A Rajendrakumar AM Agarwal RK Survivability of highly pathogenic avian influenza virus (H5N1) in naturally preened duck feathers at different temperatures Transbound Emerg Dis 2019 66 1306 13 10.1111/tbed.13148 30861310
Karunakaran AC, Murugkar HV, Kumar M, Nagarajan S, Tosh C, Pathak A, Rajendrakumar AM, Agarwal RK. Survivability of highly pathogenic avian influenza virus (H5N1) in naturally preened duck feathers at different temperatures. Transbound Emerg Dis. 2019;66:1306–13.30861310 10.1111/tbed.13148
37. Marcenac P Park GW Duca LM Lewis NM Dietrich EA Barclay L Tamin A Harcourt JL Thornburg NJ Rispens J Detection of SARS-CoV-2 on surfaces in households of persons with COVID-19 Int J Environ Res Public Health 2021 18 8184 10.3390/ijerph18158184 34360477
Marcenac P, Park GW, Duca LM, Lewis NM, Dietrich EA, Barclay L, Tamin A, Harcourt JL, Thornburg NJ, Rispens J, et al. Detection of SARS-CoV-2 on surfaces in households of persons with COVID-19. Int J Environ Res Public Health. 2021;18:8184.34360477 10.3390/ijerph18158184
38. Liu H Fei CN Chen YL Luo SM Yang T Yang L Liu J Ji XY Wu WS Song J Investigating SARS-CoV-2 persistent contamination in different indoor environments Environ Res 2021 202 111763 10.1016/j.envres.2021.111763 34329634
Liu H, Fei CN, Chen YL, Luo SM, Yang T, Yang L, Liu J, Ji XY, Wu WS, Song J. Investigating SARS-CoV-2 persistent contamination in different indoor environments. Environ Res. 2021;202:111763.34329634 10.1016/j.envres.2021.111763
39. Wang MY Zhao R Gao LJ Gao XF Wang DP Cao JM SARS-CoV-2: structure, biology, and structure-based therapeutics development Front Cell Infect Microb 2020 10 587269 10.3389/fcimb.2020.587269
Wang MY, Zhao R, Gao LJ, Gao XF, Wang DP, Cao JM. SARS-CoV-2: structure, biology, and structure-based therapeutics development. Front Cell Infect Microb. 2020;10:587269.10.3389/fcimb.2020.587269
40. Chen Y Liu QY Guo DY Emerging coronaviruses: genome structure, replication, and pathogenesis J Med Virol 2020 92 418 23 10.1002/jmv.25681 31967327
Chen Y, Liu QY, Guo DY. Emerging coronaviruses: genome structure, replication, and pathogenesis. J Med Virol. 2020;92:418–23.31967327 10.1002/jmv.25681
41. Brandao PE Gregori F Richtzenhain LJ Rosales CAR Villarreal LYB Jerez JA Molecular analysis of Brazilian strains of bovine coronavirus (BCoV) reveals a deletion within the hypervariable region of the S1 subunit of the spike glycoprotein also found in human coronavirus OC43 Arch Virol 2006 151 1735 48 10.1007/s00705-006-0752-9 16583154
Brandao PE, Gregori F, Richtzenhain LJ, Rosales CAR, Villarreal LYB, Jerez JA. Molecular analysis of Brazilian strains of bovine coronavirus (BCoV) reveals a deletion within the hypervariable region of the S1 subunit of the spike glycoprotein also found in human coronavirus OC43. Arch Virol. 2006;151:1735–48.16583154 10.1007/s00705-006-0752-9
42. Qin HB Qiu HJ He ST Hong BX Liu K Lou FX Li MC Hu P Kong XH Song YJ Efficient disinfection of SARS-CoV-2-like coronavirus, pseudotyped SARS-CoV-2 and other coronaviruses using cold plasma induces spike protein damage J Hazard Mater 2022 430 128441 10.1016/j.jhazmat.2022.128414
Qin HB, Qiu HJ, He ST, Hong BX, Liu K, Lou FX, Li MC, Hu P, Kong XH, Song YJ, et al. Efficient disinfection of SARS-CoV-2-like coronavirus, pseudotyped SARS-CoV-2 and other coronaviruses using cold plasma induces spike protein damage. J Hazard Mater. 2022;430:128441.10.1016/j.jhazmat.2022.128414
43. Darnell MER Subbarao K Feinstone SM Taylor DR Inactivation of the coronavirus that induces severe acute respiratory syndrome, SARS-CoV J Virol Methods 2004 121 85 91 10.1016/j.jviromet.2004.06.006 15350737
Darnell MER, Subbarao K, Feinstone SM, Taylor DR. Inactivation of the coronavirus that induces severe acute respiratory syndrome, SARS-CoV. J Virol Methods. 2004;121:85–91.15350737 10.1016/j.jviromet.2004.06.006
44. Leclercq I Batejat C Burguiere AM Manuguerra JC Heat inactivation of the Middle East respiratory syndrome coronavirus Influenza Other Resp 2014 8 585 6 10.1111/irv.12261
Leclercq I, Batejat C, Burguiere AM, Manuguerra JC. Heat inactivation of the Middle East respiratory syndrome coronavirus. Influenza Other Resp. 2014;8:585–6.10.1111/irv.12261
45. Batejat C Grassin Q Manuguerra JC Leclercq I Heat inactivation of the severe acute respiratory syndrome coronavirus 2 J Biosaf Biosecur 2021 3 1 3 10.1016/j.jobb.2020.12.001 33521591
Batejat C, Grassin Q, Manuguerra JC, Leclercq I. Heat inactivation of the severe acute respiratory syndrome coronavirus 2. J Biosaf Biosecur. 2021;3:1–3.33521591 10.1016/j.jobb.2020.12.001
46. Huang J, Fraser A, Jiang X. Efficacy of three EPA-registered antimicrobials and steam against two human norovirus surrogates on nylon carpets with two backing types. Appl Environ Microbiol 2024:e0038424.
47. Haines SR Adams RI Boor BE Bruton TA Downey J Ferro AR Gall E Green BJ Hegarty B Horner E Ten questions concerning the implications of carpet on indoor chemistry and microbiology Build Environ 2019 170 1 16 32055099
Haines SR, Adams RI, Boor BE, Bruton TA, Downey J, Ferro AR, Gall E, Green BJ, Hegarty B, Horner E, et al. Ten questions concerning the implications of carpet on indoor chemistry and microbiology. Build Environ. 2019;170:1–16.32055099
