
==== Front
Anim Biosci
Anim Biosci
Animal Bioscience
2765-0189
2765-0235
Animal Bioscience

38665078
10.5713/ab.23.0445
ab-23-0445
Article
Nonruminant Nutrition and Feed Processing
Effects of dietary supplementation of vitamin A on the tibia quality of goslings
https://orcid.org/0000-0002-1024-1225
Xiao Xia 12
https://orcid.org/0000-0002-8043-6458
Yang Haiming 1
https://orcid.org/0000-0002-3315-8993
Wan Xiaoli 1
https://orcid.org/0000-0003-1680-3863
Wang Zhiyue 13*
1 College of Animal Science and Technology, Yangzhou University, Yangzhou, Jiangsu 225009, China
2 Jiangsu Coastal Area Institute of Agricultural Science, Yancheng, Jiangsu 224002, China
3 Joint International Research Laboratory of Agriculture and Agri-Product Safety of Ministry of Education of China, Yangzhou University, Yangzhou, Jiangsu 225009, China
* Corresponding Author: Zhiyue Wang, Tel: +86-514-87979045, E-mail: dkwzy@263.net
9 2024
25 4 2024
37 9 16031613
25 10 2023
25 1 2024
20 3 2024
Copyright © 2024 by Animal Bioscience
2024
https://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Objective

This study was conducted to evaluate the effect of dietary supplementation of vitamin A (VA) on the tibial growth, calcium (Ca) and phosphorus (P) metabolism, VA, and vitamin D (VD) deposition, and associated gene expression in goslings.

Methods

A total of 180 healthy, 1-day-old male goslings were randomly divided into 3 treatment groups (0, 9,000, and 15,000 IU VA/kg), with 6 replicates containing 10 goslings each. They were weighed and sampled on days 14, 28, 42, 56, and 70.

Results

No addition of VA reduced VA content in the serum and liver of goslings, and supplementation of 15,000 IU/kg VA increased VA content from day 14 (p<0.05). The trend of VA concentration in the serum and liver was in line with the relative mRNA expression of retinoic acid receptor β in the jejunal mucosa. In both no addition of VA and supplementation of 15,000 IU/kg VA reduced 25-hydroxycholecalciferol (25-OH-VD3) content in the serum and VD content in the liver (p<0.05). From day 28, no addition of VA or supplementation of 15,000 IU/kg VA had a negative effect on tibia length, strength, and Ca, P, and ash content in goslings (p<0.05). Tibia P content was lower in the supplementation of 15,000 IU/kg VA group than in the no addition of VA group (p<0.05). No addition of VA or supplementation of 15,000 IU/kg VA had the most effect on early serum parathyroid hormone (PTH) levels in goslings (p<0.05). The effect of no addition of VA on the bone Gla protein (BGP) content of goslings started from day 14 (p<0.05). The relative mRNA expression of bone Gla-protein (BGLAP) and bone morphogenetic protein 4 (BMP4) in the liver and jejunal mucosa was decreased by either no addition of VA or supplementation of 15,000 IU/kg VA (p<0.05).

Conclusion

Both no addition of VA and supplementation of 15,000 IU/kg VA affected the mineralization process of the bone, and ultimately reduced tibial quality.

Calcium
Gosling
Phosphorus
Tibia
Vitamin A
==== Body
pmcINTRODUCTION

Bone health has been a longstanding concern in the realm of poultry farming. The most common and harmful illnesses influencing poultry productivity are still metabolic diseases, especially skeletal dysfunction. Locomotor deficiencies arising from such maladies greatly increase the cost of output and carcass processing [1]. It’s interesting to note that while the performance of poultry production has gradually improved due to advancements in genetic breeding, nutrition, and feed science as well as the use of sophisticated technologies, stress resistance has greatly decreased and the frequency of leg illness has grown [2]. The poultry industry has suffered significant losses as a result of the sharp rise in leg disease and the mortality rate [3]. Even if things have improved thanks to genetic breeding and other techniques, poultry leg disease still poses a serious threat to the industry’s further growth. Therefore, researchers continue to focus on studying the etiology, mechanisms, and preventive measures of poultry leg disease from multiple perspectives.

Vitamin A (VA) is a fat-soluble nutrient that promotes the metabolism of substances in the body. VA and retinoic acid derivatives are considered morphological factors in bone formation [4]. Appropriate levels of VA maintain the body’s bone health, and too much or too little VA can have a negative impact on bone growth. According to the definition of the World Health Organization (WHO), a serum VA level of less than 0.7 μmol/L (20 μg/dL) is considered a VA deficiency [5]. However, certain investigators have proposed that a risk of VA insufficiency also exists at VA levels below 1.05 μmol/L [5]. In poultry, recognized symptoms of VA deficiency include stunted growth, ruffled feathers, weakness, dry eyes, impaired egg production, low immunity, and reduced resistance to certain poultry diseases [6]. The marginal deficiency of VA, which is more prevalent in current production, affects growth and development, lower resistance to disease, and other aspects of livestock and poultry significantly but does not manifest clear clinical deficiency signs. In order to boost immunity and achieve greater performance, VA is frequently overdosed during manufacture. The limits of VA overdose are unclear, as different animal species have different levels of tolerance. The National Research Council (NRC, 1994) states that the maximum tolerance for VA in broilers and growing laying hens is 15,000 IU/kg [7]. According to Yan et al [8], dietary VA levels significantly affect the metabolism of phosphorus (P) and calcium (Ca) in broilers. A dietary VA level of 45,000 IU/kg was found to cause a decrease in tibia Ca deposition, an increase in P deposition, and a decrease in tibia mineralization, indicating an excess of VA. The Ca and P metabolisms of broilers were also adversely affected at a dietary VA level of 15,000 IU/kg, indicating a critical excess of VA [8].

The deficiency or excess of VA in the diet can cause a disruption of Ca and P metabolism, impeded bone growth and development, and the appearance of the symptoms of bone deformity [9]. In mice, dry bone weight, ash content, and bone mineralization decreased as the intake of all-trans-retinoic acid increased [10]. According to Conaway et al [11], consuming too much VA is linked to a decrease in bone density in people, which can cause osteoporosis and a higher risk of fractures. It is known that there is a dosage impact between VA and vitamin D (VD), which could be harmful to the body’s bones [12]. Some studies have hypothesized that VA may have an antagonistic effect on VD because it can either compete with VD for absorption at the small intestinal mucosa, causing interference with normal VD absorption and metabolism, or it can partially damage VD before the digested material reaches the site of absorption [13,14]. Moreover, retinoid X receptor (RXR) proteins are necessary for the molecular synthesis of heterodimers by both VA and VD to initiate transcriptional activity [15,16]. If large doses of VA are given in animals in which 9-cis retinoic acid can innervate or utilize many of the available RXR proteins, the effects of VD may be inhibited [13]. It’s possible that VA affects VD absorption and metabolism, which in turn affects bone health and Ca and P metabolism. Further research is necessary to determine the precise mechanism.

The NRC (1994) recommended VA requirement for geese is 1,500 IU/kg [7]. However, it has been shown that the addition of 9,000 IU/kg VA to the diet of 0 to 28 d goslings can meet their growth and development requirements. Additionally, no addition of VA or the addition of 15,000 IU/kg VA is harmful to the growth and development of goslings, and there is an antagonistic relationship between VA and VD [17]. Based on the growth performance and tibia characteristics of goslings, it is recommended that the best dietary VA supplementation for 0 to 28 d goslings should be 9,000 IU/kg [17]. Studies on the effects of VA deficiency and excess on bone metabolism have mainly focused on humans and rats, with fewer studies and inconsistent results in poultry. Thus, this study examined the effects of dietary supplementation of VA in the diets on VA and VD deposition, tibia growth, Ca and P metabolism, and related gene expression in the goslings at different ages to investigate the effects of VA on the tibia quality in poultry and the regulatory pathways. The outcomes of this study will serve as a reference for the prudent application of VA in the production of geese, as well as the experimental and theoretical foundation for the early prevention and treatment of animal legs through dietary management.

MATERIALS AND METHODS

Ethics statement

Under Approval No. SYXK [Su] IACUC 2016-0020, all experimental procedures involving animal manipulation were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the Yangzhou University Animal Experiments Ethics Committee (Yangzhou, China).

Experimental design and diets

The experiment was conducted at Gaoyou Modern Agricultural Farm in Yangzhou, China. A total of 180 healthy male one-day-old Jiangnan White goslings with similar body weights (BWs) (101.3±5.7 g) were produced by the same flock of geese. The goslings were randomized to 3 dietary treatments (6 replicates×10 goslings), and the test period lasted 70 days.

The corn-soybean meal basal diets were formulated to meet the nutritional requirements of goslings according to the NRC (1994) recommendations [7] and prior research results [18,19], except for VA (Table 1). The experimental diets were formulated using the corn-soybean meal basal diet supplemented with 0, 9,000, and 15,000 IU/kg VA. Vitamin A was added as retinyl acetate (1×106 IU/g), purchased from Diesman Vitamin Co., Ltd. (Shanghai, China). Different contents of VA were prepared into premix and then mixed with other feed materials. The concentrations of VA in the various diets were analyzed and found to be 1,225, 10,348, and 16,434 IU/kg during the period of 1 to 28 days, respectively. Similarly, over the period of 29 to 70 days, the concentrations were 1,205, 10,325, and 16,418 IU/kg, respectively. These measurements were conducted using the method of Liang et al [20].

All goslings were reared in plastic wire-floor pens (1.5 m ×1.8 m) equipped with nipple drinkers and a feed trough. Birds had ad libitum access to feed and water and were raised under experimental conditions to minimize stress during the rearing period. The room temperature was 26°C ±3°C. The goslings were subjected to 23 h of light exposure per day from 1 to 14 days and 18 h per day from 15 to 28 days. The birds were subjected to natural daylight for a duration of 29 to 70 days. Specific feeding management steps are described by Xiao et al [21].

Blood and tissue sampling

Goslings were weighed on days 14, 28, 42, 56, and 70 after a 6-h period of fasting. The feed intake was recorded for each replicate to calculate the average daily gain (ADG) and average daily feed intake (ADFI). The feed/gain ratio (F/G) was calculated as the ratio between ADFI and ADG in each replicate. Then, 1 gosling with average BW was selected from each replicate. Vacuum tubes and stainless-steel blood collection needles were used to collect 2 mL of blood from the wing vein. The blood was allowed to clot at 37°C for 2 h. The serum was separated by centrifugation at 2,000×g for 10 min using a Cence DL-5M low-speed frozen centrifuge (Hunan Xiangyi Laboratory Instrument Development Co., Ltd., Changsha, China). After blood collection, the goslings were sacrificed by cervical dislocation and exsanguinated. About 500 mg of liver tissue was promptly extracted and transferred to cryopreservation tubes. The tubes were snap-frozen with liquid nitrogen and then stored in a refrigerator at −80°C for mRNA extraction and VA and VD content analysis.

About 10 cm of the middle part of the jejunum was cut off, and the chyme was drained and washed with normal saline. The inner surface mucosa of the intestinal tract was gently scraped with sterilized slides, put into RNase-free tubes, snap-frozen in liquid nitrogen, and then transferred to a −80°C refrigerator for storage. In addition, the left tibia of the gosling was separated, and the attached tissue was removed and stored in a plastic bag at −20°C to determine tibia strength and mineral element content.

Serum sample analysis

An enzyme-linked immunosorbent assay was used to determine the values of VA and 25-hydroxycholecalciferol (25-OH-VD3) in gosling serum. The kits were purchased from Jiangsu Kete Biotechnology Co., Ltd. (Yancheng, China) and Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The liver concentrations of VA and VD were analyzed with high-performance liquid chromatography (HPLC), following the methodology described by Liang et al [20]. For parathyroid hormone (PTH) and bone Gla protein (BGP) in serum, ELISA kits purchased from Beijing North Biotechnology Research Institute Co., Ltd. (Beijing, China) were used in strict accordance with their operating manual. Serum concentrations of Ca and P were measured using a Beckman LX-20 automatic biochemical analyzer (Beckman Coulter, Inc., Fullerton, CA, USA). Serum Ca and P were assayed by the ion electrode method.

Bone sample analysis

The tibia length was measured using a vernier caliper (500-703-20 CD-P20S; Mitutoyo Precision Instruments Co., Ltd., Japan) as the distance from the proximal section to the position between the third and fourth toes. The tibia circumference was calculated by wrapping cotton thread around the middle of the tibia for 1 turn and measuring the length of the thread with a straightedge. The tibiae were cleaned of surrounding muscles and soft tissues and measured the strength by a dual column universal testing system (In-stron3367; Instron Corporation, Norwood, MA, USA). The determination procedures were performed according to the protocol outlined by Guo et al [22]. The blade perpendicularly hit the tibia at its midpoint at a test speed of 5 mm/s for 30 mm. The tibia was positioned on the bracket at the same bending degree, and the upper pressure was loaded at a uniform speed until the tibia was broken. The bending load (Newton, N) at the moment of fracture was recorded. Bone fragments from breaking strength determination were oven-dried at 65°C for 24 h. They were then defatted with ether for 7 d. After this, the bone fragments were again oven-dried at 65°C for 24 h to determine dry defatted bone weight. The dry tibiae were crushed, ashed on an electric stove, and burned in a muffle furnace at 550°C for 12 h (SX2-4-10; Shanghai Gengfa Pharmaceutical Equipment Co., Ltd., Shanghai, China). Ash content was calculated as a percentage of the dry fat-free tibia weight. The ash was dissolved with nitric and perchloric acids. According to the procedures of AOAC (1995), the Ca content was determined by titration with ethylene diamine tetraacetie acid (EDTA), and the P was determined via the molybdenum yellow colorimetry method [23]. The ash, Ca, and P contents were expressed based on tibial wet weight.

RNA extraction, reverse transcription, and real-time quantitative polymerase chain reaction

Total RNA was extracted from liver and jejunum mucosa samples using the Trizol reagent from Tiangen Biochemical Technology Co., Ltd. (Beijing, China). The concentration and purity of the total RNA were measured using a NanoDrop ND-1000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) based on the absorbance at 260/280 nm. Following concentration determination, 1.0 μg of total RNA was used to create cDNA utilizing reverse transcription with a reagent kit. The cDNA was diluted, and relative quantitative analysis was performed by 7500 real-time PCR instruments (Applied Biosystems, Foster City, CA, USA). All kits were purchased from Yeasen Biotechnology (Shanghai, China) Co., Ltd. The reaction system consisted of 20 μL, with components including Hieff qPCR SYBR Green Master Mix (Low Rox) 10 μL, forward and reverse primers 0.4 μL each, cDNA template 2 μL, and enzyme-free water 7.2 μL, using β-actin as the reference gene. The reaction conditions include pre-denaturation at 95°C for 5 min, denaturation at 95°C for 10 s, and annealing at 60°C for 30 s, repeated for 40 cycles. After the reaction, the relative expression was calculated by the 2−ΔΔCT method. The primer sequences were constructed based on the mRNA of retinoic acid receptor β (RARB), bone Gla-protein (BGLAP), bone morphogenetic protein 4 (BMP4), and β-actin from geese (Anser Cygnoides domesticus) available in GenBank. All the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd. (Beijing, China). Primer information is presented in Table 2.

Statistical analysis

All obtained data were analyzed using one-way one way analysis in SPSS 26.0 (SPSS, Inc., Chicago, IL, USA). Each replicate served as an experimental unit for all statistical analyses. The results of the data analysis are expressed as the mean value and the pooled standard error of the mean. Differences among the treatment means were determined at p<0.05 by Tukey’s multiple range test. All the graphs were made using GraphPad Prism 8.0.

RESULTS

Growth performance

From day 28, no addition of VA or supplementation of 15,000 IU/kg VA decreased the BW of goslings (p<0.05). There were negative effects of no addition of VA on the BW throughout the experiment, but supplementation of 15,000 IU/kg VA had no significant effect on the BW on days 56 and 70 (p>0.05). No addition of VA decreased the ADG of goslings from 15 to 42 days and increased the F/G of goslings from 15 to 28 days (p<0.05). Supplementation of 15,000 IU/kg VA had no significant effect on ADG and F/G (p>0.05). Xiao et al [21] presented comprehensive data.

Deposition of vitamin A and vitamin D in the liver and serum

The effects of dietary supplementation of VA in gosling diets on VA and VD contents in the liver and serum at different ages are presented in Table 3. It can be seen from the table that dietary VA content had effects on VA and VD contents in the liver and serum (p<0.05). At each time point, the VA content in the serum and liver of the no addition of VA group was lower than that of the supplementation of 9,000 IU/kg VA group, and the VA content in the supplementation of 15,000 IU/kg VA group was higher (p<0.05). At the same time, 25-OH-VD3 in the serum and VD in the liver of the no addition of VA and supplementation of 15,000 IU/kg VA groups were lower than those in the supplementation of 9,000 IU/kg VA group (p<0.05). The serum levels of VA in the supplementation of 9,000 IU/kg VA and 15,000 IU/kg VA groups first increased, then dropped over time, reaching their peak on day 42. The liver VA content in the supplementation of 9,000 IU/kg VA group gradually grew and reached a steady level, but that in the supplementation of 15,000 IU/kg VA group consistently increased. In the no addition of VA group, both serum and liver VA contents decreased gradually. Specifically, compared to the supplementation of 9,000 IU/kg VA group, the serum 25-OH-VD3 content in the no addition of VA group decreased by 19.8% on day 14 (p<0.05), the serum VA and liver VD contents decreased by 85.8% (p<0.05) and 24.0% (p<0.05) on day 42, respectively, and liver VA content decreased by 99.7% on day 70 (p<0.05). The serum and liver VA content in the supplementation of 15,000 IU/kg VA group increased by 16.1% (p<0.05) and 621% (p<0.05) on day 14, the serum 25-OH-VD3 content decreased by 19.3% on day 14 (p<0.05), and the liver VD content decreased by 16.0% on day 56 (p<0.05). These were the moments when the indicator content had the highest increases or decreases.

Tibia index and related indexes of calcium and phosphorus

The effects of dietary supplementation of VA in gosling diets on the tibia index at different ages are shown in Table 4. It can be seen from the table that dietary VA content had effects on tibia length and strength of goslings (p<0.05). All tibia indices rose over time. The effects of no addition of VA on the tibia length and strength of goslings began from day 42 and day 28 to the end of the experiment, respectively (p<0.05). The effects of supplementation of 15,000 IU/kg VA on the tibia length and strength in goslings began from day 28 to the completion of the trial (p<0.05). No addition of VA or supplementation of 15,000 IU/kg VA affected tibia circumference only on day 70 (p = 0.037). Among them, compared to the supplementation of 9,000 IU/kg VA group, the tibia length (p<0.05), circumference (p<0.05), and strength (p< 0.05) in the no addition of VA group decreased by 1.50 cm, 0.39 cm, and 117 N on day 70. These in the supplementation of 15,000 IU/kg VA group resulted in a decrease of 1.10 cm (p<0.05), 0.49 cm (p<0.05), and 111 N (p<0.05) on day 70.

Table 5 displays the effects of dietary supplementation of VA on Ca and P-related indexes at different ages. Dietary VA supplemental levels had no impact on serum Ca and P contents (p>0.05). The serum Ca and P content initially rose and subsequently declined over time, peaking on day 42. The contents of Ca, P, and ash in the tibia increased on day 42 and then remained stable. The tibia Ca, P, and ash contents of goslings were influenced by the dietary VA supplementation (p<0.05). Calcium and P contents in the tibia of the no addition of VA and supplementation of 15,000 IU/kg VA groups decreased from day 28 (p<0.05). Additionally, the ash content of the tibia reduced from day 42 (p<0.05). Among them, compared to the supplementation of 9,000 IU/kg VA group, the Ca content of the tibia in the no addition of VA group decreased by 16.4% on day 28 (p<0.05), the P content of the tibia decreased by 21.3% on day 42 (p<0.05), and the content of ash in the tibia decreased by 15.1% on day 70 (p< 0.05). The Ca content of the tibia in the supplementation of 15,000 IU/kg VA group decreased by 14.0% on day 28 (p< 0.05), the P content of the tibia decreased by 27.8% on day 56 (p<0.05), and the content of ash in the tibia decreased by 17.2% on day 42 (p<0.05). In addition, the content of tibial P in the supplementation of 15,000 IU/kg VA group was lower than that in the no addition of VA group (p<0.05).

Content of parathyroid hormone and bone Gla protein in the serum

Table 6 summarizes the effects of dietary supplementation of VA in gosling diets on PTH and BGP contents at different ages. Dietary VA content influenced PTH and BGP contents in goslings (p<0.05). No addition of VA or supplementation of 15,000 IU/kg VA had an impact on the serum PTH content of goslings in the early stages (p<0.05). The impact diminished over time until it was no longer detectable in the later phases. There was a significant decrease in BGP content in goslings from day 28 to the completion of the trial when no VA was added (p<0.05). Supplementation of 15,000 IU/kg VA did not affect BGP content in goslings (p>0.05). Additionally, compared to the supplementation of 9,000 IU/kg VA group, the content of PTH in the no addition of VA group decreased 46.6% by day 14 (p<0.05), the PTH content increased 24.5% by day 42 (p<0.05), and the content of BGP decreased 26.0% by day 56 (p<0.05). The content of PTH in the supplementation of 15,000 IU/kg VA group decreased 39.2% by day 14 (p<0.05).

Gene expression

As shown in Figure 1, compared to the supplementation of 9,000 IU/kg VA group, no addition of VA down-regulated the relative mRNA expression of RARB in the jejunal mucosa of goslings from day 28 (p<0.05). Conversely, supplementation of 15,000 IU/kg VA up-regulated the relative mRNA expression of RARB in the jejunal mucosa from day 14 (p<0.05).

As shown in Figures 2A and 2B, compared to the supplementation of 9,000 IU/kg VA group, no addition of VA reduced the relative mRNA expression of BGLAP in the liver of goslings from day 14 and decreased the relative mRNA expression of BMP4 in the liver from day 28 (p<0.05). Supplementation of 15,000 IU/kg VA reduced the relative mRNA expression of BGLAP in the liver from day 42, lowered the relative mRNA expression of BMP4 from day 14, and increased the relative mRNA expression of BMP4 on day 70 (p<0.05).

As shown in Figures 2C and 2D, compared to the supplementation of 9,000 IU/kg VA group, no addition of VA decreased the relative mRNA expression of BGLAP in the jejunal mucosa of goslings from day 14. It reduced the relative mRNA expression of BMP4 in the jejunum mucosa from day 42 (p<0.05). Supplementation of 15,000 IU/kg VA decreased the relative mRNA expression of BGLAP in the jejunum mucosa from day 56 and decreased the relative mRNA expression of BMP4 from day 14 (p<0.05).

DISCUSSION

Vitamin A is crucial for maintaining normal bone growth and metabolism. Inadequate or excessive amounts might harm bone growth and development. The amount of VA supplied to the diet is closely linked to the VA levels in the body. Dietary VA content significantly impacts the in vivo metabolism of VA [5,17]. More than 50% to 80% of the body’s VA reserves are in the liver [24]. There was a positive correlation between liver VA concentration and dietary VA concentration. Serum and liver VA levels are commonly used as markers of VA nutritional status in animals. This test showed that no addition of VA decreased VA levels in the serum and liver of goslings, whereas supplementation of 15,000 IU/kg VA increased VA deposition in tissues. It was further verified that the amount of VA added to the diet affected VA deposition in animal tissues. VA was accumulated in the body over time and eventually reached a steady level at a specific age. However, the group of goslings without added VA was unable to obtain sufficient VA from the feed. Consequently, they had to rely on the VA stored in their liver, leading to a gradual depletion of VA in their tissues. Most of the VA ingested by the goslings in the supplementation of 15,000 IU/kg VA group was deposited in the body, resulting in a gradual increase VA accumulation in the tissues over time. Alterations in growth performance may be associated with variations in VA concentration [21].

Rohde and DeLuca [10] found a weak antagonism between VA and VD. Serum 25-(OH)-VD3 concentration is a crucial indicator of VD status in the body [25]. Simultaneously, 25-(OH)-VD3 has a role in the absorption and utilization of Ca and P and is necessary for mineralizing animal bones [25]. This experiment concluded that the amount of VA added to the diet affected the serum 25-(OH)-VD3 and liver VD content. The serum 25-(OH)-VD3 content and liver VD content of the no addition of VA and supplementation of 15,000 IU/kg VA groups in goslings were lower than those of the supplementation of 9,000 IU/kg VA group. It could be connected to the interaction between VA and VD [10,12]. Excessive VA may harm VD molecules or compete with VD for absorption and transport sites in the mucosa of the small intestine before the digested material reaches the site of absorption, resulting in lower VD levels [13,14]. The effect can lead to disturbances in Ca and P metabolism in animals.

Bone growth involves longitudinal development and transverse growth. Longitudinal growth increases bone length, while transverse growth increases bone cross-section and diameter. Bone strength is a key factor in evaluating the bone growth of geese. Vitamin A deficiency can lead to increased organic deposition in animal bones. Excessive VA can cause accelerated bone resorption, bone fragility, and spontaneous bone fractures in animals [11]. Guo et al [22] demonstrated that a shortage in VA reduced tibia diameter in laying hens, and excessive VA did not enhance tibia quality. The study found that neither no addition of VA nor supplementation of 15,000 IU/kg VA had a negative effect on the tibial attributes in goslings. It aligns with the results mentioned before. No addition of VA or supplementation of 15,000 IU/kg VA may be arresting growth by inhibiting the proliferation and hypertrophy of growth plate chondrocytes and reducing matrix synthesis via retinoic acid receptors (RARs) [26]. Osteogenesis within the cartilage was retarded, and the differentiation of osteoblasts was hindered, which ultimately affected the longitudinal growth of the bone [27]. Research has demonstrated that an increase in body size is first indicated by growth in tibia circumference, followed by tibia length [28]. In this trial, the negative effect of no addition of VA or supplementation of 15,000 IU/kg VA on tibia length was earlier in the goslings, probably because the VA ingested by the goslings in the early stages preferentially met the tibia circumference growth.

The contents of Ca and P primarily indicate the bone metabolism of animals, with tibial ash serving as the most direct index reflecting bone quality. Minerals accumulating on the periosteum surface enhanced tibial strength as the individual aged [29]. High levels of VA affect the bone development of poultry, leading to lower bone ash and Ca content, less bone mineralization, and an increased risk of leg disorders [30]. More studies have focused on Ca and P metabolism in mice or broilers in relation to VA deficiency or excess, with excess being the more prevalent issue. Stevens et al [31] showed that dietary supplementation with high levels of VA reduced bone weight and bone ash content in broilers. Mir et al [32] demonstrated that insufficient or excessive VA supplementation in the diet can reduce the bone ash and Ca content in broilers. Several investigations have found that the effect of dietary VA levels in the diet on serum Ca and P levels is negligible. The impact on tibial Ca, P, and ash levels was more noticeable, suggesting that tibial Ca and P metabolism is more sensitive to VA levels [17]. The findings of this test were similar to the above tests. Neither no addition of VA nor supplementation of 15,000 IU/kg VA affected serum Ca and P levels in geese. However, both no addition of VA and supplementation of 15,000 IU/kg VA altered tibial Ca, P, and ash levels in goslings.

Various factors, such as PTH and BGP, can regulate the metabolic utilization and homeostasis of Ca and P in the serum and bones of animals. Parathyroid hormone is essential for maintaining normal Ca, phosphate homeostasis, and bone strength. Plasma Ca ions negatively regulate PTH synthesis and secretion [33]. In this experiment, on days 14 and 28, serum PTH content in the no addition of VA and supplementation of 15,000 IU/kg VA groups was lower than that in the supplementation of 9,000 IU/kg VA group. However, on days 42 and 56, PTH levels increased. Although the serum Ca content had no effect, from the data point of view, it showed a trend opposite to that of PTH content. When VA was deficient or critically excessive, the serum Ca content increased early. It inhibited the synthesis and secretion of PTH [33]. At the same time, the serum Ca content declined at a later stage, stimulating the synthesis and secretion of PTH to ultimately stabilize serum Ca concentration. Therefore, fluctuations in serum PTH levels in response to VA deficiency or excess are an adaptive adjustment of Ca metabolism disorder.

Research on BGP has shown that the BGP concentration in the bloodstream is indicative of osteoblast activity, bone formation rate, and serves as a specific biochemical indicator of bone turnover [34]. Guo et al [27] showed that VA inhibited BGP levels in broiler osteoblast cultures in a secondary dose-dependent manner as VA levels increased. Results indicated that from day 28, serum BGP content in the no addition of VA group was lower than that in the supplementation of 9,000 IU/kg VA group. No addition of VA caused a decrease of BGP content in the serum of goslings, indicating a decrease in osteoblast activity and an inhibition of the bone formation rate in goslings. The negative effects of no addition of VA on bone growth and Ca and P metabolism are associated with reduced osteoblast activity and impaired BGP biosynthesis, which in turn affects bone mineralization processes [27].

Vitamin A is involved in cell growth and differentiation by regulating gene expression through the RAR and RXR pathways [4,35]. Li et al [36] found that the effect of VA intake on the expression of RARs is dose-dependent, with RARβ being crucial for embryonic skeletal development. Previous studies have demonstrated that RARβ is expressed in the developing intestine [37]. This experiment showed that from day 14, no addition of VA led to a decrease in VA content in the liver and serum, as well as a reduction in RARB mRNA expression in the jejunum of goslings. In contrast, supplementation of 15,000 IU/kg VA increased VA content in the serum and liver and up-regulated RARB mRNA expression in the jejunum. Vitamin A deficiency reduced the number of ligands and inhibited RAR expression. Its cascade effect can promote the teratogenic effect of VA deficiency on skeletal development and may even lead to embryonic death [36]. It is possible that no addition of VA or supplementation of 15,000 IU/kg VA could be affecting the bone quality of the goslings by affecting RARB mRNA expression and perhaps causing the death of the goslings [21]. In addition, retinoic acid, a metabolic intermediate of VA, has been found to inhibit BGP and BMP mRNA gene expression as well as bone mineralization [38,39]. Bone morphogenetic protein 4 belongs to the transforming growth factor-β superfamily. The BMP signaling pathway is implicated in tooth development, cell differentiation, and bone formation [40]. The results of this experiment revealed that either no addition of VA or supplementation of 15,000 IU/kg VA down-regulated the relative expression of BGLAP and BMP4 mRNA in tissues. Taken together with the conclusions of Guo et al [27], the adverse effects of no addition of VA or supplementation of 15,000 IU/kg VA on bone quality may be associated with decreased BGLAP and BMP4 gene expression in tissues. Currently, there is a scarcity of study reports in this field, and the precise mechanism of the effect requires additional investigation.

In conclusion, no addition of VA reduced tissue VA and VD deposition in goslings. The mRNA expression of RARB, BGLAP, and BMP4 in tissues was down-regulated, and serum BGP levels was lowered. Ultimately, it affected the mineralization process of the tibia. However, supplementation of 15,000 IU/kg VA increased tissue VA deposition and inhibited tissue VD deposition in goslings. It up-regulated RARB mRNA expression and down-regulated BGLAP and BMP4 mRNA expression in tissues, leading to a deleterious impact on the tibia Ca and P concentrations. The effect of supplementation of 15,000 IU/kg VA was even more remarkable in tibia P level.

Figure 1 Effects of dietary supplementation of vitamin A on the relative mRNA expression levels of RARB in jejunal mucosa of goslings at different ages. Data are represented with the means±standard error of the mean, n = 6. RARB, retinoic acid receptor β. a–c Different letters represent a significant difference (p<0.05).

Figure 2 Effects of dietary supplementation of vitamin A on the relative mRNA expression levels in the goslings at different ages. (A) and (B) respectively represent the mRNA expression of BGLAP and BMP4 in liver; (C) and (D) respectively represent the mRNA expression of BGLAP and BMP4 in jejunum mucosa. Data are represented with the means±standard error of the mean, n = 6. BGLAP, bone gla protein; BMP4, bone morphogenetic protein 4. a–c Different letters represent a significant difference (p<0.05).

Table 1 Composition and nutrient content of the basal diets1)

Items	Growth period	
	
1 to 28 d	29 to 70 d	
Ingredients (%)	
 Corn	63.0	60.7	
 Soybean meal-43%	30.2	24.6	
 Rice husk	3.20	7.70	
 Wheat bran	-	3.30	
 DL-methionine	0.10	0.12	
 Salt	0.30	0.30	
 Limestone	1.10	1.02	
 Calcium hydrogen phosphate	1.10	1.26	
 Vitamin and trace mineral premix2)	1.00	1.00	
Calculated nutrient content3) (%)	
 Metabolizable energy (MJ/kg)	11.34	11.09	
 Dry matter	84	84	
 Ash	3.15	3.94	
 Crude protein	19.0	16.2	
 Crude fat	2.87	2.68	
 Neutral detergent fibre	10.3	10.6	
 Acid detergent fibre	4.85	4.67	
 Calcium	0.83	0.87	
 Total phosphorus	0.56	0.65	
 Available phosphorus	0.32	0.42	
 Lysine	0.99	0.82	
 Methionine	0.42	0.36	
 Vitamin A (IU/kg)	1,225	1,205	
1) No vitamin A added.

2) 1–28 days, provided per kilogram of complete diet (without VA): 3,000 IU vitamin D (rachitasterol), 18 IU vitamin E (D-a-tocopherol), 1.5 mg vitamin K (coagulation vitamin), 0.9 mg vitamin B1 (thiamine), 8 mg vitamin B2 (riboflavin), 3.2 mg vitamin B6 (pyridoxine), 12 μg vitamin B12 (cobalamin), 45 mg nicotinic acid, 11 mg pantothenic acid, 0.65 mg folic acid, 50 μg biotin, 60 mg Fe (ferrous sulfate), 10 mg Cu (copper sulfate), 95 mg Mn (manganese sulfate), 90 mg Zn (zinc sulfate), 0.5 mg I (potassium iodide), and 0.2 mg Se (sodium selenite).

29–70 days, provided per kilogram of complete diet (without VA): 3,000 IU vitamin D (rachitasterol), 18 IU vitamin E (D-a-tocopherol), 1.5 mg vitamin K (coagulation vitamin), 0.6 mg vitamin B1 (thiamine), 6 mg vitamin B2 (riboflavin), 2 mg vitamin B6 (pyridoxine), 10 μg vitamin B12 (cobalamin), 30 mg nicotinic acid, 9 mg pantothenic acid, 0.5 mg folic acid, 40 μg biotin, 60 mg Fe (ferrous sulfate), 10 mg Cu (copper sulfate), 95 mg Mn (manganese sulfate), 90 mg Zn (zinc sulfate), 0.5 mg I (potassium iodide), and 0.2 mg Se (sodium selenite).

3) Vitamin A is the measured value, and the rest are calculated values.

Table 2 Primer sequences of genes

Gene	GenBank ID	Primer sequence (5′ →3′)	Product size (bp)	
BGLAP	XM_013196523.1	F: GCACTGCTCGTCTTGACTCT	206	
		R: CAACGCTCATGCATCTGCTC		
BMP4	XM_013193881.1	F: AACCGAATGCTGATGG	224	
		R: ACGGCTGACTTGCTG		
RARB	XM_013172012.1	F: CCGAAAGAGACGACCCAACA	88	
		R: TGCACCTTTTGCACTGATGC		
β-actin	XM_013174886.1	F: GCACCCAGCACGATGAAAAT	150	
		R: GACAATGGAGGGTCCGGATT		
BGLAP, bone Gla-protein; BMP4, bone morphogenetic protein 4; RARB, retinoic acid receptor β.

Table 3 Effects of dietary supplementation of vitamin A on the serum, liver vitamin A and vitamin D deposition in goslings1)

Items	Vitamin A supplemented concentration (IU/kg)	SEM	p-value	
	
0	9,000	15,000	
Serum vitamin A content (ng/mL)	
 Day 14	107c	112b	130a	2.45	<0.001	
 Day 28	121c	136b	144a	2.38	<0.001	
 Day 42	78.2c	550b	636a	61.0	<0.001	
 Day 56	79.2c	502b	623a	57.4	<0.001	
 Day 70	71.8b	494a	573a	55.0	<0.001	
Serum 25-OH-VD3 content (ng/mL)	
 Day 14	51.1b	63.7a	51.4b	2.04	0.007	
 Day 28	80.0b	93.5a	85.6ab	2.14	0.024	
 Day 42	91.0b	105a	94.3b	1.97	0.004	
 Day 56	93.0b	105a	95.6b	1.75	0.003	
 Day 70	91.6b	105a	95.7b	1.80	0.001	
Liver vitamin A content (mg/kg)	
 Day 14	2.62c	33.0b	238a	25.6	<0.001	
 Day 28	1.07c	206b	411a	40.8	<0.001	
 Day 42	0.960c	293b	467a	47.1	<0.001	
 Day 56	0.890c	317b	511a	51.4	<0.001	
 Day 70	0.810c	318b	543a	54.8	<0.001	
Liver vitamin D content (mg/kg)	
 Day 14	1.15	1.07	1.12	0.024	0.394	
 Day 28	1.29c	1.48a	1.39b	0.021	<0.001	
 Day 42	0.897b	1.18a	1.02b	0.038	0.003	
 Day 56	0.953b	1.19a	1.00b	0.034	0.004	
 Day 70	0.945b	1.23a	1.04b	0.040	0.006	
SEM, standard error of the mean.

1) Each value represents the mean of 6 replicates (n = 6).

a–c Means with different superscripts within the same row indicate a significant difference (p<0.05).

Table 4 Effects of dietary supplementation of vitamin A on the tibia index of goslings1)

Items	Vitamin A supplemented concentration (IU/kg)	SEM	p-value	
	
0	9,000	15,000	
Length (cm)	
 Day 14	7.73	7.45	7.31	0.102	0.248	
 Day 28	8.98ab	9.51a	8.53b	0.156	0.026	
 Day 42	11.2b	11.8a	11.6ab	0.097	0.006	
 Day 56	11.9b	13.0a	12.2b	0.177	0.010	
 Day 70	12.0b	13.5a	12.4b	0.232	0.017	
Circumference (cm)	
 Day 14	3.47	3.43	3.47	0.036	0.920	
 Day 28	4.40	4.43	4.32	0.037	0.446	
 Day 42	5.00	5.23	5.13	0.055	0.233	
 Day 56	5.55	5.42	5.40	0.086	0.761	
 Day 70	5.58b	5.97a	5.48b	0.085	0.037	
Strength (N)	
 Day 14	90.6	91.5	88.7	1.52	0.769	
 Day 28	199b	239a	185b	6.42	<0.001	
 Day 42	453b	560a	481b	17.6	0.025	
 Day 56	685b	797a	725ab	17.7	0.019	
 Day 70	724b	841a	730b	19.0	0.008	
SEM, standard error of the mean.

1) Each value represents the mean of 6 6 replicates (n = 6).

a,b Means with different superscripts within the same row indicate a significant difference (p<0.05).

Table 5 Effects of dietary supplementation of vitamin A on the content of calcium and phosphorus in serum and tibia of goslings1)

Items	Vitamin A supplemented concentration (IU/kg)	SEM	p-value	
	
0	9,000	15,000	
Serum calcium (mmol/L)	
 Day 14	2.28	2.25	2.29	0.030	0.872	
 Day 28	2.16	2.27	2.16	0.028	0.226	
 Day 42	3.49	3.63	3.52	0.052	0.533	
 Day 56	3.46	3.51	3.43	0.058	0.884	
 Day 70	3.34	3.48	3.37	0.063	0.690	
Serum phosphorus (mmol/L)	
 Day 14	2.45	2.53	2.51	0.099	0.945	
 Day 28	1.60	1.62	1.46	0.037	0.141	
 Day 42	2.53	2.65	2.61	0.058	0.698	
 Day 56	2.32	2.57	2.33	0.059	0.128	
 Day 70	2.34	2.61	2.37	0.057	0.098	
Tibia calcium (g/kg)	
 Day 14	89.1	94.6	89.7	1.78	0.401	
 Day 28	91.1b	109a	93.7b	3.21	0.030	
 Day 42	114b	123a	113b	1.87	0.046	
 Day 56	111b	125a	116b	1.86	0.006	
 Day 70	114b	123a	116b	1.44	0.012	
Tibia phosphorus (g/kg)	
 Day 14	37.2	38.9	37.6	0.396	0.186	
 Day 28	44.3b	50.6a	38.3c	1.54	0.001	
 Day 42	42.9b	54.5a	39.6b	1.67	<0.001	
 Day 56	43.2b	54.4a	39.3c	1.62	<0.001	
 Day 70	42.7b	53.4a	39.8c	1.50	<0.001	
Tibia ash (g/100 g)	
 Day 14	21.8	22.8	21.0	0.407	0.207	
 Day 28	22.3	24.7	20.6	0.717	0.052	
 Day 42	24.2b	28.5a	23.6b	0.575	<0.001	
 Day 56	25.0b	28.7a	24.0b	0.524	<0.001	
 Day 70	23.6b	27.8a	23.3b	0.527	<0.001	
SEM, standard error of the mean.

1) Each value represents the mean of 6 6 replicates (n = 6).

a–c Means with different superscripts within the same row indicate a significant difference (p<0.05).

Table 6 Effects of dietary supplementation of vitamin A on the serum parathyroid hormone and bone Gla protein contents in goslings1)

Items	Vitamin A supplemented concentration (IU/kg)	SEM	p-value	
	
0	9,000	15,000	
PTH (pg/mL)	
 Day 14	819b	1,535a	933b	83.6	<0.001	
 Day 28	984b	1,435a	1,094b	58.9	0.001	
 Day 42	1,609a	1,292b	1,328b	48.8	0.017	
 Day 56	1,509a	1,256b	1,346ab	43.4	0.050	
 Day 70	1,438	1,293	1,300	39.4	0.067	
BGP (ng/mL)	
 Day 14	21.4a	18.5b	18.4b	0.568	0.039	
 Day 28	14.7b	18.3a	17.6a	0.474	0.001	
 Day 42	12.6b	16.5a	16.1a	0.533	0.001	
 Day 56	11.1b	15.0a	15.0a	0.544	<0.001	
 Day 70	9.72b	11.7a	10.2ab	0.355	0.045	
SEM, standard error of the mean; PTH, parathyroid hormone; BGP, bone Gla protein.

1) Each value represents the mean of 6 6 replicates (n = 6).

a,b Means with different superscripts within the same row indicate a significant difference (p<0.05).

CONFLICT OF INTEREST

We certify that there is no conflict of interest with any financial organization regarding the material discussed in the manuscript.

FUNDING

This work was financially supported by China Agriculture Research System (CARS-42-11) and Jiangsu Agriculture Industry Technology System (JATS [2023]496), China.
==== Refs
REFERENCES

1 Rath NC Durairaj V Avian bone physiology and poultry bone disorders Scanes CG Dridi S 7th ed Sturkie’s avian physiology Cambridge, MA, USA Academic Press 2022 529 43
2 Yang Q Liu H Wang L Untargeted metabolomics study on the effects of rearing ducks in cages on bone quality Poult Sci 2022 101 101604 10.1016/j.psj.2021.101604 34936950
3 Onbaşılar EE Erdem E Ünal N Tunç AS Kocakaya A Yaranoğlu B Comparison of liver and bone health of two laying hen strains kept in different cage systems Eur Poult Sci 2016 80 123 10.1399/eps.2016.123
4 Green AC Martin TJ Purton LE The role of vitamin A and retinoic acid receptor signaling in post-natal maintenance of bone J Steroid Biochem Mol Biol 2016 155 135 46 10.1016/j.jsbmb.2015.09.036 26435449
5 Pilch SM Analysis of vitamin A data from the health and nutrition examination surveys J Nutr 1987 117 636 40 10.1093/jn/117.4.636 3585513
6 Uni Z Zaiger G Gal-Garber O Pines M Rozenboim I Reifen R Vitamin A deficiency interferes with proliferation and maturation of cells in the chicken small intestine Br Poult Sci 2000 41 410 5 10.1080/713654958 11128381
7 National Research Council (NRC) Nutrient requirements of poultry 9th ed Washington, DC, USA The National Academies Press 1994
8 Yan SM Feng YM Zhang HQ Shi BL Effects of vitamin A and vitamin D on metabolism of calcium and phosphorous in broilers Chin J Anim Nutr 2007 19 218 24
9 Lind T Öhman C Calounova G Excessive dietary intake of vitamin A reduces skull bone thickness in mice PLoS One 2017 12 e0176217 10.1371/journal.pone.0176217 28426756
10 Rohde CM DeLuca H Bone resorption activity of all-trans retinoic acid is independent of vitamin D in rats J Nutr 2003 133 777 83 10.1093/jn/133.3.777 12612152
11 Conaway HH Henning P Lerner UH Vitamin a metabolism, action, and role in skeletal homeostasis Endocr Rev 2013 34 766 97 10.1210/er.2012-1071 23720297
12 Johansson S Melhus H Vitamin A antagonizes calcium response to vitamin D in man J Bone Miner Res 2001 16 1899 905 10.1359/jbmr.2001.16.10.1899 11585356
13 Rohde CM Manatt M Clagett-Dame M DeLuca HF Vitamin A antagonizes the action of vitamin D in rats J Nutr 1999 129 2246 50 10.1093/jn/129.12.2246 10573558
14 Metz AL Walser MM Olson WG The interaction of dietary vitamin A and vitamin D related to skeletal development in the turkey poult J Nutr 1985 115 929 35 10.1093/jn/115.7.929 4009300
15 Daniel DB Vitamin D metabolism, mechanism of action, and clinical applications Chem Biol 2014 21 319 29 10.1016/j.chembiol.2013.12.016 24529992
16 Levin AA Sturzenbecker LJ Kazmer S 9-cis retinoic acid stereoisomer binds and activates the nuclear receptor RXR alpha Nature 1992 355 359 61 10.1038/355359a0 1309942
17 Liang JR Xiao X Yang HM Wang ZY Assessment of vitamin A requirement of gosling in 0–28 d based on growth performance and bone indexes Poult Sci 2021 100 101015 10.1016/j.psj.2021.01.037 33662659
18 Shi SR Wang ZY Yang HM Zhang YY Nitrogen requirement for maintenance in Yangzhou goslings Br Poult Sci 2007 48 205 9 10.1080/00071660701227519 17453813
19 Wang ZY Shi SR Zhou QY Response of growing goslings to dietary methionine from 28 to 70 days of age Br Poult Sci 2010 51 118 21 10.1080/00071660903431406 20390576
20 Liang JR Dai H Yang HM Yang Z Wang ZY The effect of dietary vitamin A supplementation in maternal and its offspring on the early growth performance, liver vitamin A content, and antioxidant index of goslings Poult Sci 2019 98 6849 56 10.3382/ps/pez432 31350994
21 Xiao X Liang JR Yang HM Wan XL Wang ZY Vitamin A deficiency or critical excess has negative effects on the growth performance, slaughter performance, and meat quality of goslings Anim Feed Sci Technol 2021 280 115064 10.1016/j.anifeedsci.2021.115064
22 Guo S Niu J Xv J Interactive effects of vitamins A and K3 on laying performance, egg quality, tibia attributes and antioxidative status of aged Roman Pink laying hens Animal 2021 15 100242 10.1016/j.animal.2021.100242 34091224
23 Association of Official Analytical Chemists (AOAC) Official methods of analysis of AOAC international 16th ed Gaithersburg, MD, USA AOAC International 1995
24 Blomhoff R Green MH Green JB Berg T Norum KR Vitamin A metabolism: new perspectives on absorption, transport, and storage Physiol Rev 1991 71 951 90 10.1152/physrev.1991.71.4.951 1924551
25 Wang J Qiu L Gong H Effect of dietary 25-hydroxycholecalciferol supplementation and high stocking density on performance, egg quality, and tibia quality in laying hens Poult Sci 2020 99 2608 15 10.1016/j.psj.2019.12.054 32359596
26 Kodaka T Takaki H Soeta S Mori R Naito Y Local disappearance of epiphyseal growth plates in rats with hypervitaminosis A J Vet Med Sci 1998 60 815 21 10.1292/jvms.60.815 9713809
27 Guo X Yan S Shi B Feng Y Effect of excessive vitamin A on alkaline phosphatase activity and concentrations of calcium-binding protein and bone Gal-protein in culture medium and CaBP mRNA expression in osteoblasts of broiler chickens Asian-Australas J Anim Sci 2011 24 239 45 10.5713/AJAS.2011.10059
28 Zhang HY Zeng QF Bai SP Study on the morphology and mineralization of the tibia in meat ducks from 1 to 56 d Poult Sci 2019 98 3355 64 10.3382/ps/pez121 30916353
29 Shim MY Karnuah AB Mitchell AD Anthony NB Pesti GM Aggrey SE The effects of growth rate on leg morphology and tibia breaking strength, mineral density, mineral content, and bone ash in broilers Poult Sci 2012 91 1790 5 10.3382/ps.2011-01968 22802169
30 Aburto A Britton WM Effects and interactions of dietary levels of vitamins A and E and cholecalciferol in broiler chickens Poult Sci 1998 775 666 73 10.1093/ps/77.5.666
31 Stevens VI Blair R Riddell C Dietary levels of fat, calcium, and vitamins A and D3 as contributory factors to rickets in poults Poult Sci 1983 62 2073 82 10.3382/ps.0622073 6314310
32 Mir NA Deo C Mandal AB Tyagi PK Effect of feeding different levels of zinc and vitamin A on morphometry and mineralization of tibia bone in broiler chickens Indian J Poult Sci 2014 49 224 7
33 Ferrone F Pepe J Danese VC The relative influence of serum ionized calcium and 25-hydroxyvitamin D in regulating PTH secretion in healthy subjects Bone 2019 125 200 6 10.1016/j.bone.2019.05.029 31129357
34 Ikeda K Tsukui T Tanaka D Maruyama Y Horie-Inoue K Inoue S Conditional expression of human bone Gla protein in osteoblasts causes skeletal abnormality in mice Biochem Biophys Res Commun 2012 424 164 9 10.1016/j.bbrc.2012.06.098 22735266
35 Xu A Zhang N Cao J Post-translational modification of retinoic acid receptor alpha and its roles in tumor cell differentiation Biochem Pharmacol 2020 171 113696 10.1016/j.bcp.2019.113696 31726045
36 Li N Sun S Wang D Suppression of retinoic acid receptors may contribute to embryonic skeleton hypoplasia in maternal rats with chronic vitamin A deficiency J Nutr Biochem 2010 21 710 6 10.1016/j.jnutbio.2009.04.011 19616926
37 Chatterjee S Kapoor A Akiyama JA Enhancer variants synergistically drive dysfunction of a gene regulatory network in Hirschsprung disease Cell 2016 167 355 68 10.1016/j.cell.2016.09.005 27693352
38 Kirimoto A Takagi Y Ohya K Shimokawa H Effects of retinoic acid on the differentiation of chondrogenic progenitor cells, ATDC5 J Med Dent Sci 2005 52 153 62 10.11480/jmds.520301 16350840
39 Wang Y Li WH Li Z Liu W Zhou L Gui JF BMP and RA signaling cooperate to regulate Apolipoprotein C1 expression during embryonic development Gene 2015 554 196 204 10.1016/j.gene.2014.10.047 25445289
40 Yu M Wang H Fan Z BMP4 mutations in tooth agenesis and low bone mass Arch Oral Biol 2019 103 40 6 10.1016/j.archoralbio.2019.05.012 31128441
