
==== Front
Neurochem Res
Neurochem Res
Neurochemical Research
0364-3190
1573-6903
Springer US New York

39060766
4213
10.1007/s11064-024-04213-w
Original Paper
LINC00894 Regulates Cerebral Ischemia/Reperfusion Injury by Stabilizing EIF5 and Facilitating ATF4-Mediated Induction of FGF21 and ACOD1 Expression
Chen Yifei 12
Cui Hengxiang 3
Han Zhuanzhuan 2
Xu Lei 4
Wang Lin 5
Zhang Yuefei 2
Liu Lijun lijunliusz@sina.com

1
1 https://ror.org/02xjrkt08 grid.452666.5 0000 0004 1762 8363 Department of Emergency and Critical Care Medicine, The Second Affiliated Hospital of Soochow University, No.1055, San Xiang Road, Suzhou, Jiangsu 215004 China
2 https://ror.org/03tqb8s11 grid.268415.c Department of Emergency Medicine, The Affiliated Hospital of Yangzhou University, Yangzhou, Jiangsu 225012 China
3 grid.16821.3c 0000 0004 0368 8293 Shanghai Key Laboratory of Psychotic Disorders, Brain Health Institute, Shanghai Mental Health Center, National Center for Mental Disorders, Shanghai Jiao Tong University School of Medicine, Shanghai, 200030 China
4 grid.413389.4 0000 0004 1758 1622 Department of Emergency Medicine, The Affiliated Hospital of Xuzhou Medical University, Xuzhou, Jiangsu 221002 China
5 https://ror.org/03tqb8s11 grid.268415.c Department of Anesthesiology, The Affiliated Hospital of Yangzhou University, Yangzhou, Jiangsu 225012 China
26 7 2024
26 7 2024
2024
49 10 29102925
8 4 2024
12 7 2024
15 7 2024
© The Author(s) 2024
2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
The non-coding RNA LINC00894 modulates tumor proliferation and drug resistance. However, its role in brain is still unclear. Using RNA-pull down combined with mass spectrometry and RNA binding protein immunoprecipitation, EIF5 was identified to interact with LINC00894. Furthermore, LINC00894 knockdown decreased EIF5 protein expression, whereas LINC00894 overexpression increased EIF5 protein expression in SH-SY5Y and BE(2)-M17 (M17) neuroblastoma cells. Additionally, LINC00894 affected the ubiquitination modification of EIF5. Adeno-associated virus (AAV) mediated LINC00894 overexpression in the brain inhibited the expression of activated Caspase-3, while increased EIF5 protein level in rats and mice subjected to transient middle cerebral artery occlusion reperfusion (MCAO/R). Meanwhile, LINC00894 knockdown increased the number of apoptotic cells and expression of activated Caspase-3, and its overexpression decreased them in the oxygen–glucose deprivation and reoxygenation (OGD/R) in vitro models. Further, LINC00894 was revealed to regulated ATF4 protein expression in condition of OGD/R and normoxia. LINC00894 knockdown also decreased the expression of glutamate-cysteine ligase catalytic subunit (GCLC) and ATF4, downregulated glutathione (GSH), and the ratio of GSH to oxidized GSH (GSH: GSSG) in vitro. By using RNA-seq combined with qRT-PCR and immunoblot, we identified that fibroblast growth factor 21 (FGF21) and aconitate decarboxylase 1 (ACOD1), as the ATF4 target genes were regulated by LINC00894 in the MCAO/R model. Finally, we revealed that ATF4 transcriptionally regulated FGF21 and ACOD1 expression; ectopic overexpression of FGF21 or ACOD1 in LINC00894 knockdown cells decreased activated Caspase-3 expression in the OGD/R model. Our results demonstrated that LINC00894 regulated cerebral ischemia injury by stabilizing EIF5 and facilitating EIF5-ATF4-dependent induction of FGF21 and ACOD1.

Supplementary Information

The online version contains supplementary material available at 10.1007/s11064-024-04213-w.

Keywords

LINC00894
Ischemia
Oxygen–glucose deprivation
FGF21
ACOD1
Key Research and Development Project of Yangzhou City, Jiangsu, China.YZ2023150 YZ2023150 YZ2023150 issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Cerebral ischemia–reperfusion (CI/R) injury during a stroke is a complex pathophysiological process, combined with a rapid cascade reaction. This process commonly induces inflammatory cytokine expression and inflammatory cell infiltration, resulting in inflammatory reactions that aggravate cellular damage in the brain [1–3]. The rodent middle cerebral artery occlusion (MCAO) and oxygen–glucose deprivation/reoxygenation (OGD/R) cell models are commonly used to explore neuropathological mechanisms of ischemic stroke [4].

Previous studies have suggested that oxidative stress could be a crucial pathological factor during ischemia/reperfusion injury, and reactive oxygen species (ROS) at high levels may induce neuronal apoptosis [5]. Cerebral ischemia causes a substantial decrease in the level of the endogenous ROS scavenger glutathione (GSH) in tissues. Mammalian GSH is synthesized from glutamate, cysteine, and glycine by γ-glutamyl-cysteine ligase synthetase including γ-GC modifier (GCLM) subunit, γ-GC ligase catalytic (GCLC) subunit, and GSH synthetase (GSS) [6]. GCLC knockout induces glutathione production loss, which may induce oxidative stress; it is strongly associated with the progression of neurodegenerative disorders [7, 8]. The overexpression of GCLC also inhibits cellular apoptosis, leading to the alleviation of inflammation in acute lung injury [9].

Activating transcription factor 4 (ATF4) is a stress-induced transcriptional factor that controls the transcription of genes involved in autophagy, oxidative response, and nutrient sensing [10–12]. Furthermore, ATF4 reportedly regulates GSH biosynthesis and exercise resistance to oxidative stress [13, 14]. Furthermore, activated ATF4 regulates the expression of fibroblast growth factor 21 (FGF21), a metabolic and stress cytokine typically expressed in liver cells under cellular stress and enhanced cellular stress resistance [15–18]. FGF21 can attenuate age-related metabolic and stress disorders. FGF21 serves as a neuroprotectant with cognition-enhancing effects [19]; it can inhibit neuroinflammation following ischemic stroke [20] and maintain blood–brain barrier integrity in an ischemic stroke model [21].

Eukaryotic translation initiation factor 5 (EIF5) interacts with the 40 S initiation complex, facilitating the hydrolysis of bound GTP with simultaneous binding of the 60 S ribosomal subunit to the 40 S initiation complex. The resulting 80 S ribosomal initiation complex participates in peptidyl transfer and chain elongation [22]. EIF5 regulates scanning by the preinitiation complex and translation of GCN4, which is the yeast ATF4 equivalent [23]. Overexpression of EIF5 induces ATF4 expression in yeast and human cells [24]. Under stress, EIF5 could increase ATF4 translation from non-AUG codons [25]. Furthermore, cyst stem cells lacking EIF5 reportedly showed an imbalance in cell proliferation and apoptosis during spermatogenesis [26].

Cis-aconitate decarboxylase (ACOD1) encoded by immunoresponsive gene 1 (Irg1) is an enzyme responsible for the decarboxylation of cis-aconitate from the Krebs cycle in macrophages [27]. It was recently reported that in a MCAO model, the endogenous ACOD1 was protective against cerebral ischemia/reperfusion injury [28]. The mechanism by which ACOD1 catalyzes the production of itaconate to regulate inflammation continues to attract the interest of researchers.

Long non-coding RNAs (lncRNAs) participate in various biological processes such as chromatin and genome architecture remodeling, RNA or protein stabilization, transcription regulation, cell self-renewal and differentiation, and DNA damage response [29–31]. Numerous human lncRNAs have been identified to date; however, less than 3% have been experimentally validated for their functions [32]. Therefore, it is essential to further investigate the biological functions of these endogenous transcripts and their role as signal transducers.

LINC00894 (ENST0000044489) is a non-coding RNA derived from the X chromosome; it regulates the expression of transforming growth factor-beta 2 (TGF-β2) and zinc finger E-box-binding homeobox 1 (ZEB1), which may affect tamoxifen resistance in breast cancer [33]. LINC00894 might have a potential role in the nervous system, because an RNA expression correlation analysis of clinical samples suggested that LINC00894 and EIF5 are co-expressed and may together regulate extracellular matrix receptor signal transduction and long-term potentiation (LTP) dysfunction [34]. LINC00894 may also regulate the expression of G protein-regulated inducer of neurite outgrowth 1 (GPRIN1), which regulates axon growth in hippocampal neurons and synapse formation in brain development [35, 36]. Currently, our understanding of the biological functions of LINC00894 is limited. In this study, we aimed to reveal the role and mechanism of action of LINC00894 in protecting the brain from ischemic injury by identifying its interacting proteins.

Materials and Methods

Cell Culture and Transfection

Immortal cell lines were acquired from the American Type Cell Culture Collection (ATCC) and cultured at 37 °C in a humidifier containing 5% CO2. Both BE(2)-M17 (CRL-2267) being simply referred to as M17 cells and SH-SY5Y (CRL-2266) cell lines were maintained in Opti-MEM (31,985,062; Gibco, Thermo Fisher Scientific, Waltham, MA, USA) containing 5% fetal bovine serum (FBS; Invitrogen, Carlsbad, CA, USA). PC12 cells were maintained in low-glucose Dulbecco’s modified Eagle medium (DMEM) supplemented with 10% heat-inactivated horse serum (Invitrogen) and 5% FBS (Invitrogen); 293T cells were maintained in DMEM (10,569,044; Gibco). Lipofectamine™ 3000 reagent (L3000015; Thermo Fisher Scientific) was used for the transfection of DNA constructs into cells according to the manufacturer’s instructions.

To obtain primary mouse brain fibroblasts (MBFs), the cerebral meninges samples of fetal mice were peeled under a microscope (Leica S8 APO; Wetzlar, Germany). These were then placed in a Petri dish with precooled phosphate-buffered saline (PBS) and digested with 0.25% trypsin at 37 °C for 20 min; the cell suspension was obtained by agitation. The cells were collected via centrifugation at 200–400 × g, and the pellet was resuspended in DMEM containing 10% FBS, 100 units/mL penicillin, and 100 µg/mL streptomycin. Thereafter, approximately 8 × 104/mL cells were seeded in a 3.5-cm Petri dish at 37 °C with 5% CO2. The medium was replaced every other day.

DNA Construct

The full-length DNA (3414 bp) coding LINC00894 (ENST00000449111.5) was amplified using PCR with the following primer pairs: LINC00894-F: 5′-GCGGCTAGCACTTGCCACAAGGAGACGCTG-3′ (Nhe1) and LINC00894-R: 5′-GCGGCGGCCGCTCCAAATAGGCACTAAATCCA-3′ (Not1); the fragment containing the Nhe1 and Not1 cloning sites was cloned into pcDNA3.1. EIF5 (NM_001969.5), ATF4 (NM_001675.4), FGF21 (NM_019113.4), and ACOD1 (NM_001258406.2) overexpression vectors were constructed by cloning the three open reading frames into pcDNA 3.1 vectors. CRISPR reagents were generated to target LINC00894 (designed as LINC00894 gRNA) using the following oligo pairs: LINC00894-gRNA4-F: 5′-CACCGAGGCAGGGTGTGCTGGGTCT-3′ and LINC00894-gRNA4-R: 5′-AAACAGACCCAGCACACCCTGCCTC-3′ (bases in bold typeface are gRNA sequences) and cloned into a lentiviral vector (lentiCRISPR; Addgene plasmid # 52,961). qRT-PCR was used to confirm that LINC00894 expression was silenced by LINC00894 gRNA. The FGF21 promoter DNA was amplified using PCR with the following primers: 5′-GACAAGGAGCGTGACCATTGAAGC-3′ and 5′-ATGGCTCGGGTCCTCAGGTGATCT-3′; ACOD1 promoter DNA was amplified using PCR with the following primers: 5′-CATAAGATGCCACAATTTGGTG-3′ and 5′-CGTTGTAAAGAAGAGGTTCAG-3′; the two promoter DNA fragments were cloned into the pGL4.0 luciferase report vector (Promega, WI, USA) using Gibson assembly cloning kits (E5510S, NEB, MA, USA).

Animals and MCAO/R Model

Healthy adult male Sprague–Dawley rats or male C57BL/6 mice aged 8 weeks were purchased from the Comparative Medicine Center of Yangzhou University, China. All experiments were conducted by following the “Guiding opinions on treating experimental animals” issued by the Ministry of Science and Technology and approved by the Animal Ethics Committee of Yangzhou University (Yangzhou, China; Approval No. 202,311,004 and No. 202,304,026).

Control recombinant adeno-associated virus (AAV) and LINC00894 RNA carrying AAV (pAAV-CMV-PGI-19,090,012-tWPA) were obtained from Heyuan Biotechnology Shanghai Company, China (www.oobio.com.cn). The animals were randomly divided into control and treatment groups, which were administered AAV (AAV-con) and AAV carrying LINC00894 (AAV-LINC00894), respectively. The animal was anesthetized by injecting Zoletil®50 into the abdominal cavity before being fastened to a brain stereotaxic apparatus (RWD Life Science, Shenzhen, China). Then the virus were intracerebroventricularly (icv.) injected into the left lateral ventricle of the animal (rats X: +3.0 mm, Y: +1.0 mm, Z: −3.0 mm; mice X: +1.0 mm, Y: +1.0 mm, Z: −2.0 mm); a dose of 2 µl of LINC00894 virus or control AAV virus (titer 7.72 × 1012) was injected into rats, while 0.8 µl of these virus (titer 7.72 × 1012) was administered to mice. The MCAO/R model was established after a month of virus administration, as previously described [37]. The animal was anesthetized by injecting Zoletil®50 (50 mg/kg) into the abdominal cavity, and the anterior midline skin was incised. Thereafter, the internal carotid artery (ICA), external carotid artery (ECA), and left common carotid artery (CCA) were separated. The distal end of the ECA was ligated, and the ECA and its branches were coagulated near the ligation point. A suture was inserted from the ECA through the CCA bifurcation into the ICA, with the arterial clamp on the ICA loosened and the suture inserted into the intracranial ICA segment. The blood flow was blocked for 1 h and the suture was retrieved for reperfusion for 24 h. Neurological behavioral tests were performed 24 h post-reperfusion. Longa neurological examination scores were used to assess neurological deficit, which was divided into six grades: 0 points, no neurological deficit; 1 point, failure to fully extend left forelimb, mild focal neurological deficit; 2 points, circling to the left, moderate neurological deficit; 3 points, falling to the left, severe focal deficit; 4 points, no spontaneous walking and depressed level of consciousness; 5 points, death. The average score was used to compare the behavior difference between LINC00894 virus or control AAV virus infected animal in MCAO model. At last, the infarct size was determined by staining with 2,3,5-triphenyltetrazolium chloride (TTC, Amresco LLC., 298-96-4) and was analyzed with Image J software (v1.50i).

Oxygen–Glucose Deprivation (OGD/R)

Cells were seeded into a six-well plate at 50% confluence and maintained in culture medium for 24 h before being washed thrice using PBS; they were then maintained in DMEM without glucose under 95% N2 and 5% CO2 for 4–16 h. Following oxygen deprivation treatment, the medium was replaced with a normal expansion medium, and the cells were maintained for another 1 h before the cells were used for further analysis. The DNA transfected cells were used 24 h after transfection for OGD challenge or other experiment.

Apoptosis Detection

Cellular apoptosis was evaluated using fluorescence-activated cell sorting with a PE–Annexin V apoptosis detection kit (cat:559,763, BD Biosciences, San Jose, CA, USA) according to the manufacturer’s instructions. Briefly, cell pellets in each treatment were obtained by centrifugation of the samples at 400 × g before being resuspended in binding buffer at 25 °C at a density of 1 × 106 cell/mL; the cell suspension was incubated with annexin-V–FITC and 7-AAD at 25 °C in the dark for 15 min. The cells were then detected using a flow cytometer (CytoFLEX, Beckman, San Jose, CA, USA), and the percentages of apoptotic cells in each group were analyzed using FlowJo (vX 10.0.7r2).

RNA–Protein Pull-Down and Electrophoretic Mobility Shift Assay (EMSA)

The DNA construct encoding LINC00894 was synthesized and cloned into pcDNA3.1. Sense and antisense LINC00894 were obtained using PCR before being synthesized using the MEGAscript™ T7 Transcription Kit (AM1333; Thermo Fisher Scientific). The total protein extract from SH-SY5Y was incubated with sense and antisense LINC00894 labeled with biotin using the Pierce™ Magnetic RNA-Protein Pull-Down Kit (#20,164; Thermo Fisher Scientific) according to the manufacturer’s instruction. The sense and antisense LINC00894 bound components were analyzed using mass spectrometry, and the unique peptide sequences enriched in the sense LINC00894 group were analyzed using immunoblotting.

To confirm if sense LINC00894 interacted with EIF5, we synthesized LINC00894 using the MEGAscript™ T7 Transcription Kit (AM1333; Thermo Fisher Scientific); approximately 5 pmol/L LINC00894 was labeled using T4 polynucleotide kinase and [γ32-P] ATP. A 30-µL EMSA reaction mixture containing recombinant EIF5, 100 mM KCl, 1 µg poly (dI–dC), 0.033 mm ZnCl2, and ∼40 fmol labeled LINC00894 was incubated on ice for 20 min. Protein–RNA complexes were resolved using 5% polyacrylamide gel electrophoresis (PAGE) without sodium dodecyl sulfate at ∼130 V for 2 h at 4 °C; the gels were then dried, and the protein–RNA complexes were visualized using autoradiography.

RNA Immunoprecipitation Assay

For RNA immunoprecipitation, 1.5 × 107 SH-SY5Y cells were washed thrice with cold PBS and scraped into 1 mL of PBS. The cells were then centrifuged and lysed using RIPA buffer (Merck Millipore, MA, USA). The protein A/G magnetic beads were pre-bound with 6 µg EIF5 antibodies or IgG in immunoprecipitation buffer (140 mM NaCl, 20 mM Tris-HCl pH 7.5, 0.05% TritonX-100) for 2 h before being incubated with 100 µL of cell lysates overnight at 4 °C with agitation. The magnetic beads were washed, and the bound RNA was eluted with 400 µL of elution buffer for 2 h. The eluted RNA was precipitated with ethanol and dissolved in RNase-free water. Enrichment of certain fragments from the IgG control or EIF5 groups was determined using real-time PCR with the following primer pair: sense: 5′-AGCAGACCATGAGAGGGAGT-3′, antisense: 5′-CCTCTAGTGGGCAACCCTTG-3′. The antibodies used in this experiment were as follows: EIF5 (Thermo Fisher Scientific; A301-771 A) and Anti-IgG (Cell Signaling Technology, MA, USA; #2729).

RNA Isolation and qRT-PCR

Cellular total RNA was obtained from cells using the TRIzol reagent (Invitrogen). RNA quality was evaluated using electrophoresis and the ratio of OD 260/OD 280. For cDNA synthesis using reverse transcription with the PrimeScript RT Reagent Kits (Takara Bio, Kusatsu, Japan), 1000 ng of RNA was used. cDNA was used as the template and was amplified in triplicate using qRT-PCR with the CFX Connect Real-Time PCR Detection System (Bio-Rad, CA, USA) and SYBR Premix Ex Taq (Takara Bio) according to the manufacturer’s instructions. All primers used are shown in Table 1. The qRT-PCR cycling conditions were as follows: initial denaturation at 95 °C for 45 s, 95 °C for 35 s, and annealing at 60 °C for 35 s for 40 cycles. The 2−ΔΔCT method, with β-actin as the internal control, was used to determine the relative expression. Fluorescent signals were measured after each primer-annealing step at 60 °C.

Table 1 Primers used in the qRT-PCR

β-Actin-F	GTACGCCAACACAGTGCTG	
β-Actin-R	CGTCATACTCCTGCTTGCTG	
LINC00894-F	AGCAGACCATGAGAGGGAGT	
LINC00894-R	CCTCTAGTGGGCAACCCTTG	
kmo-rat-F	CAATGGCATCGTCGGACACT	
kmo-rat-R	CATTGGGGTAGGACTCCACG	
aox4-rat-F	CTCAACCCCATTTTGGCAGC	
aox4-rat-R	GCGTCACTCAGCATTTGGTC	
acod1-rat-F	AACGGTGTTGCTATTCACTCC	
acod1-rat-R	TTGGCTGCATTGCCGATATG	
fgf21-rat-F	CGAGGCATACCCCATCTCTG	
fgf21-rat-R	ACTGTTCCGTCCTCCCTGAT	
nkx6-3-rat-F	CTACCTTCACAGGCCACCAG	
nkx6-3-rat-R	TCTTCTCGTCGTCCGAGTCT	
atf4-rat-F	TGTTGGCGGGGGACTTAATG	
atf4-rat-R	AAAAGGCATCCTCCTTGCCG	
aqp5-rat-F	CACCATGAAAAAGGAGGTGTGC	
aqp5-rat-R	TGTGTTGTTGTTCAGCGCAT	
tlr5-rat-F	TCCTTCTCTGGCCATAGGCT	
tlr5-rat-R	ACAGTTAGGCGGGTGAAAGG	
il17c-rat-F	GCTAACTCGAAGTGCCAGGT	
il17c-rat-R	GCGGATGAACTCAGTGTGGA	
fosb-rat-F	TGTGAGGACCCCTTGACTCT	
fosb-rat-R	TCAGTCGGGGGTTCAATTCG	
ccr9-rat-F	TGAAGCTGACTGGCGTCTGA	
ccr9-rat-R	AGAGGCGGAAGGAAATGACT	
nox4-rat-F	TGTTGGGCCTAGGATTGTGT	
nox4-rat-R	CACTGAGAAGTTCAGGGCGT	
EIF5-human-F	GCGAGAACATTCCAGAGGTC	
EIF5-human-R	CATAAACCCAACGCTGCTCG	
MALAT-F	AAAGTCCGCCATTTTGCCAC	
MALAT-R	GCTTCATCTCAACCTCCGTCA	
FOXD3-AS1-F	GGTGGAGGAGGCGAGGATG	
FOXD3-AS1-R	AGCGGACAGACAGGGATTGG	
Lnc-OGD1006-F	ACGTGTCTTGAGATGCCAAA	
Lnc-OGD1006-R	TCCTCTCCCTCTTCCTCTCTC	

RNA-Seq

The bulk RNA-seq analysis (contract ID: 80-1220563257) was supported by AZENTA Company, Suzhou, China. The libraries for sequencing were generated from the total RNA of rat brains infected with either AAV-con or AAV-LINC00894. Approximately, 1 µg total RNA was used for library preparation.

The oligo(dT) beads were used to isolate poly(A) mRNA. First-strand cDNA and second-strand cDNA were synthesized using random primers. The purified double-stranded cDNA was then treated to repair both ends, and a dA-tail was added in one reaction, followed by T-A ligation to add adaptors at both ends. Size selection of adaptor-ligated DNA was then performed using DNA clean beads. Each sample was then amplified using PCR with P5 and P7 primers, and the PCR products were validated. Libraries with different indices were multiplexed and loaded on an Illumina HiSeq instrument (Illumina, CA, USA) and sequenced using a 2 × 150 paired-end (PE) configuration according to the manufacturer’s instructions.

Western Blot Analysis

Cells attached in the culture wells were lysed for 30 min at 4 °C with RIPA buffer (Merck Millipore) containing 1 mM sodium orthovanadate, 100 mM NaCl, 2.5 mM Tris-HCl (pH 7.5), 10 µg/mL leupeptin, and 10 µg/mL aprotinin. The supernatant was collected from the cell lysis solution by centrifugation at 13,500 × g for 15 min at 4 °C and the protein concentration was measured using the Lowry protein assay. Thereafter, 15–80 µg protein was separated using PAGE and electro-transferred to a polyvinylidene fluoride membrane. The membrane was blocked by incubation with 5% nonfat milk powder in Tris-buffered saline containing tween 20 (TBST) for 2 h at 25 °C before incubation with primary antibodies at 4 °C overnight. Horseradish peroxidase-conjugated anti-mouse (1:5000; ORIGENE, China) or anti-rabbit immunoglobulin IgG (1:5000; ORIGENE) was used as the secondary antibody, and the membrane was incubated for 2 h at 25 °C. Immunoreactive bands were visualized via enhanced chemiluminescence (ECL; Bio-Rad). For quantification, the ECL signals were digitized using the Image J software (v1.50i). The antibody used were anti-EIF5 antibody (#ab170915, Abcam), anti-β-Actin antibody (#A5441, Sigma-Aldrich), anti-GAPDH antibody (#ab181602, Abcam), monoclonal antibody recognizing Ubiquitin (P4D1) (#3936, CST), Anti-ATF4 (#11,815, CST), Cleaved Caspase-3 Antibody (#9661,CST), Caspase-3 Antibody (#9662,CST), Anti-GCLC antibody (#ab207777, Abcam), Anti-IRG1 antibody (#ab222411, Abcam), Anti-FGF21 antibody (#ab171941, Abcam). All original gel/blot images are provided in Additional File 1.

Luciferase Reporter Assay

Cells were plated in 24-well plates for 24 h and then transfected with luciferase vectors (200 ng) with or without 50 ng of ACOD1 or FGF21 expressing vector (when necessary) using Lipofectamine 3000 Reagent or jetPRIME® (Polyplus Transfection, Strasbourg, France). The phRLMLP Renilla luciferase expression vector was co-transfected at 40 ng for each well to evaluate transfection efficiency. The cells were not lysed until 24 h post-transfection, and luciferase activity was determined using the dual luciferase reporter assay system (Promega, WI, USA). The relative promoter activity was calculated as a normalized firefly/Renilla ratio.

ChIP Assay

BE(2)-M17 neuroblast cell line (M17) cells fixed in formaldehyde were added to the culture medium at a final concentration of 1% and maintained in 10-cm culture plates at 25 °C. The cells were shaken for 10 min before adding glycine (0.125 M). After 10 min, the cells were washed twice with cold PBS, centrifuged at 500 × g, and lysed in SDS lysis buffer containing 1 mM phenylmethylsulfonyl fluoride, 2 mg/mL pepstatin A, and 2 mg/mL aprotinin. Sonication was used to break the DNA into 500–1000 bp fragments. The chromatin was incubated with agarose beads containing control anti-serum or anti-ATF4 antibody (rabbit mAb, CST11815) overnight at 4 °C. The agarose beads were subsequently pelleted and washed once with a low-salt wash buffer, high-salt wash buffer, and LiCl wash buffer, and twice with TE buffer. Thereafter, the DNA bound with agarose beads and antibodies was recovered using phenol/chloroform extraction and ethanol precipitation. The eluted DNA was analyzed using PCR with the PCR products purified and sequenced.

Statistical Analysis

Data are presented as mean ± standard error of the mean. All statistical analyses were conducted using Prism 8 (Version 8.0.1; GraphPad Software, San Diego, CA, USA). Unless otherwise mentioned, Student’s t-tests were used for comparisons, and results with P < 0.05 were considered significant.

Results

LINC00894 Interacted with EIF5

For discovering the proteins that interact with LINC00894, we conducted RNA-pull down experiments and obtained cellular protein components that bond to the in vitro translated sense LINC00894 and antisense LINC00894; then the sense LINC00894 and antisense LINC00894 binding proteins were identified by mass spectrometry (Fig. 1a). According to the abundance of peptide molecular ions, 284 proteins were identified to be bound to LINC00894, with the top 10 being MANF, FKBP3, RFC5, HARS1, DENR, BRIX1, EIF5, PDAP1, EDF1, and DARS2. The identified proteins were used to conduct a Gene Ontology (GO) term enrichment analysis (https://david.ncifcrf.gov/), and these proteins were mainly associated with proteasome, amyotrophic lateral sclerosis, citrate cycle, DNA replication, Parkinson’s disease, spinocerebellar ataxia, prion disease, carbon metabolism, and Huntington disease (Fig. 1b). Mass spectrometry revealed molecular ion peaks of the specific peptides of EIF5 (Fig. 1c). Therefore, we further designed experiments to verify the interaction between LINC00894 and EIF5. RNA immunoprecipitation revealed that EIF5 captured by EIF5 antibodies but not IgG control antibody, significantly enriched more sense LINC00894 than antisense LINC00894 (Fig. 1d). The immunoblot assay confirmed that the in vitro translated sense LINC00894 physically interacted with EIF5 (Fig. 1e). In addition, EIF5 also interacted with LINC00894 in a dose-dependent manner, as determined using EMSA (Fig. 1f). These results demonstrated that LINC00894 could be a participant in cellular metabolism and neuron dysfunction.

Fig. 1 Eukaryotic translation initiation factor 5 (EIF5) was identified to interact with LINC00894. (a) The top 10 proteins corresponding to peptide molecular ions (> 7 amino acid) were identified from cellular components binding to biotin-labeled sense LINC00894 on mass spectrometry analysis. (b) GO term enrichment analysis of the top 284 identified proteins uniquely binding to LINC00894. (c) The cell protein lysate, upon interacting with synthetic LINC00894, exhibited molecular ion peaks characteristic of EIF5, as identified by mass spectrometry. (d) qPCR analysis of LINC00894 in IgG and EIF5 antibody-captured RNA–protein complex in RNA immunoprecipitation(n = 5); sense and anti-sense, in vitro synthesized sense and anti-sense strands of LINC00894, respectively; ***P < 0.001; n.s, no significant difference. (e) The representative immunoblot result showing that the in vitro translated sense LINC00894 exhibited physical interaction with EIF5. (f) Electrophoretic mobility shift assay was conducted using recombinant EIF5 and labeled LINC00894. The results show the interaction of EIF5 with LINC00894 in a dose-dependent manner

LINC00894 and EIF5 Interaction Promoted EIF5 Stabilization

Because in an RNA expression correlation analysis of human samples suggested that LINC00894 and EIF5 are co-expressed and may together regulate long-term potentiation (LTP) dysfunction [34], we decided to investigate the impact of LINC00894 expression levels on EIF5 protein expression. LINC00894 knockdown mediated by CRISPR/Cas9 system [38] did not change the EIF5 mRNA expression but decreased the EIF5 protein level in M17 or SH-SY5Y cells (Fig. 2a, b). In contrast, the overexpression of LINC00894 increased the EIF5 protein level without changing the EIF5 mRNA expression in the two cell lines (Fig. 2c, d).

Fig. 2 LINC00894 and EIF5 interaction promoted EIF5 stabilization. (a–b) The effect of LINC00894 knockdown using CRISPR/Cas9-mediated gene editing on EIF5 mRNA and protein expression in (a) SH-SY5Y and (b) M-17 cells(n = 3). ***, NC vs. gRNA, P < 0.001. ANOVA test was used to compare the difference between indicated groups. (c-d) The effect of LINC00894 overexpression on EIF5 mRNA and protein expression in (c) SH-SY5Y and (d) M-17 cells(n = 3). ***, VC vs. OE, P < 0.001, ANOVA test was used to compare the difference between indicated groups. (e) Immunoblot showing the effect of LINC00894 overexpression on the EIF5 degradation rate in cells with cycloheximide (10 µM)-induced inhibition of de novo protein synthesis(n = 3). ***, OE (green) vs. VC (black) at 8 h, P < 0.001. (f) Immunoprecipitation using EIF5 antibody, followed by immunoblotting using ubiquitin antibody, showed that LINC00894 knockdown increased ubiquitination modification of EIF5, whereas restoring the expression of LINC00894 decreased ubiquitination modification of EIF5. NC, control vector of gene edit; gRNA, gene edit vector targeting LINC00894; VC, empty vector control; OE, LINC00894 overexpression vector; MG132, the peptide-aldehyde proteasome inhibitor carbobenzoxyl-L-leucyl-L-leucyl-L-leucine

The overexpression of LINC00894 substantially decreased the degradation rate and increased the half-life of EIF5 (Fig. 2e). Meanwhile, LINC00894 knockdown increased the ubiquitination modification of EIF5; restoring the expression of LINC00894 decreased the ubiquitination modification of EIF5 (Fig. 2f). Thus, we believed that the binding of LINC00894 to EIF5 promoted EIF5 stabilization by inhibiting the ubiquitination of EIF5.

Ectopic Expression of LINC00894 Protected the Brain Against Injury in MCAO Animals Model

For cells lacking EIF5 display an imbalance in cell proliferation and apoptosis in Drosophila [26], and LINC00894 regulated cellular EIF5 level (Fig. 2) and could participant in neuron dysfunction (Fig. 1), we hypnotized that LINC00894 could regulate cell proliferation and apoptosis in brain. We utilized the middle cerebral artery occlusion reperfusion (MCAO/R) model to investigate whether LINC00894 affects brain tissue damage in a brain ischemia model.

Compared to AAV-con, AAV-LINC00894 significantly reduced the infarct volume at 24 h after MCAO based on 2,3,5-triphenyltetrazolium chloride (TTC) staining (Fig. 3a, b). The longa neurological examination score was used to evaluated the effect LINC00894 overexpression on neurological deficits in the MCAO models (Fig. 3a, b). The Results showed that AAV-LINC00894 significantly reduced the longa scores, indicating the LINC00894 overexpression reduced neurological damage of the rats and mice in the MCAO model.

Fig. 3 Ectopic expression of LINC00894 protects against brain injury in MCAO mice. (a–b) The representative cerebral infarct volume of rats (a) and mice (b) after cerebral ischemia/reperfusion injury via MCAO with TTC staining in control virus (AAV-con) and virus carrying LINC00894 gene (AAV-LINC00894) groups, with statistical results of cerebral infarct volume and neurological behavioral test by longa neurological examination score in each model (n = 5). Infarct volumes were quantified using the Image-Pro-Plus v.6.0 software (right panel). ***, AAV-con vs. AAV-LINC00894, P < 0.001. (c–f) Immunoblot showing the expression of activated caspase-3 and EIF5 in hippocampus and cerebral cortex from rat (c) and mice (e) in the indicated groups (n = 5), respectively, with quantification of relative expression of activated caspase-3 in rat (d) and mice (f). AAV-con, control virus infected tissues; AAV-LINC00894, virus carrying LINC00894 gene infected tissues. AAV-con vs. AAV-LINC00894, *P < 0.05; **P < 0.01; *** P < 0.001

Furthermore, the western blot analysis demonstrated that the ectopic expression of LINC00894 significantly inhibited the expression of activated caspase-3 in the hippocampus and cerebral cortex of rats (Fig. 3c, d) and mice (Fig. 3e, f). These results indicated that LICN00894 inhibited brain cell apoptosis and attenuated brain tissue damage in the MCAO model.

LINC00894 Protected Against OGD-Induced Cell Apoptosis

We further evaluated the effects of OGD on the expression of LINC00894, Malat, FOXD3-AS1, and OGD1006 by qRT-PCR in M-17 and SH-SY5Y cells. The results showed that in both M17 and SH-SY5Y cells, the expression of Malat, FOXD3-AS1, and OGD1006 was significantly increased after 12–16 h of OGD exposure, whereas the expression of LINC00894 was first numerically decreased after 12 h of OGD exposure, but later after 16 h of OGD exposure it was significantly increased, indicating that LINC00894 may be a potential stress response gene (Fig. 4a).

Fig. 4 LINC00894 protects against oxygen–glucose deprivation-induced cell apoptosis. (a) qRT-PCR was used to determine the effect of OGD challenge for the indicated time on the expression of Malat, FOXD3-AS1, and OGD1006 in M-17 and SH-SY5Y cells (n = 3). *** P < 0.001; n.s., no significant difference. (b-e) Representative results of apoptosis analysis in indicated treatment with the gates and regions placed around populations of cells with PE and 7-AAD staining, with the ratio of apoptotic cells quantified in column in M17 cells challenged with 16 h of OGD (b, n = 4; c, n = 3); immunoblots showing the effects of LINC00894 knockdown (d) (n = 4) or overexpression (e) (n = 4) on the expression of activated Caspase-3, with the quantification in column, in M-17 and SH-SY5Y cells; β-actin was used as the loading control; NC, empty gene edit vector lentiCRISPR v2 (Addgene:52,961); gRNA, lentiCRISPR v2 vector carrying U6-gRNA targeting LINC00894; VC, pcDNA3.1 vector; OE, pcDNA3.1 carrying LINC00894 clone. Cl.-Caspase3, Cleaved-Caspase3;

The subsequent experiment conducted using the flow cytometry-based method demonstrated that LINC00894 overexpression significantly inhibited, whereas LINC00894 knockdown significantly promoted, cell apoptosis induced by 16 h of OGD challenge in M17 cells (Fig. 4b, c). The immunoblot analysis further demonstrated that LINC00894 knockdown significantly enhanced, whereas LINC00894 overexpression significantly suppressed, the expression of activated caspase-3 (Fig. 4d, e). The results obtained in these in vitro models indicated that LINC00894 protected against OGD-induced cell apoptosis.

LINC00894-Stabilized EIF5 Increased ATF4 Expression, Affecting Cellular GSH Level

For eukaryotic translation initiation factor 5 is critical for accurate control of translation of GCN4 [23], the yeast ATF4 equivalent [24], we further investigate whether LINC00894 promoting EIF5 stability would affect the ATF4 expression. In the immunoblot assay, the ectopic expression of EIF5 increased the ATF4 expression but not ATF4 mRNA in SH-SY5Y cells under both OGD condition and normal condition (normoxic) (Fig. 5a, b). EIF5 knockdown decreased ATF4 protein expression but not ATF4 mRNA expression in SH-SY5Y and M17 cells under both OGD condition and normal condition (normoxic) (Fig. 5c-f).

Fig. 5 LINC00894 stabilizes ATF4 expression, affecting the cellular glutathione level. (a, b) Immunoblot showed the effect of ectopic expression of LINC00894 on indicated protein expression (left), with representative ATF4 mRNA expression analysis (middle column, n = 3) and quantification of the immunoblots (right column, n = 4) in SH-SY5Y cells under 16 h of OGD challenge (a) or normoxic (b); each treatment in quintuplicate were repeated 4 times with cells collected for analysis (immunoblot) at 24 h of treatment (OGD or normoxic); (c–f) Immunoblot showed the effect of LINC00894 knockdown on indicated protein expression (left), with representative ATF4 mRNA expression analysis (middle column, n = 3) and quantification of the immunoblots (right column, n = 4) in M17 (c, d) and SH-SY5Y (e, f) cells under the condition of OGD challenge (c, e) or normoxic (d, f); each treatment in quintuplicate were repeated 4 times with cells collected for immunoblot at 24 h of treatment (OGD or normoxic); (g) the effect of LINC00894 knockdown on cellular ATF4 protein expression, GSH level, and GSH: GSSG ratio in SH-SY5Y under the condition of OGD challenge for 16 h (n = 3). (h) Overexpression of ATF4 increases CGLC expression at 16 h in OGD-induced SH-SY5Y cells (n = 3). (i) ATF4 knockdown increases CGLC expression in SH-SY5Y cells under normoxia (n = 3). n.s, no significant difference; *P < 0.05; *** P < 0.001

Because ATF4 is involved in promoting protein synthesis and stimulating cellular cystine uptake and glutathione (GSH) synthesis [13, 14]. We further investigated whether LINC00894 knockdown would affect the cellular GSH level. LINC00894 knockdown led to a decrease in cellular ATF4 protein and GSH levels and the GSH: GSSG ratio (Fig. 5g) in SH-SY5Y under OGD conditions. The overexpression of LINC00894 also demonstrated an increase in glutamate-cysteine ligase catalytic subunit (CGLC) expression in OGD-induced SH-SY5Y cells (Fig. 5h), whereas LINC00894 knockdown decreased cellular ATF4 and CGLC protein expression (Fig. 5f). These results demonstrated that LINC00894 stabilized EIF5 and could promote ATF4 translation, resulting in the regulation of CGLC expression and GSH synthesis.

LINC00894 Overexpression Increased ATF4 Target FGF21 and ACOD1 Expression

To investigate the mechanism of LINC00894 protecting against stress induced cells apoptosis in OGD and MCAO model, we started to investigate the LINC00894 potentially regulated ATF4 target genes in brain from MCAO model.

RNA-Seq (GSE268399) was used to compare gene expression differences between AAV-con- and AAV-LINC00894-infected brains. TOP120 genes mostly regulated by LINC00894 in rats brain from MCAO model in RNA-seq assay was shown in ‘Additional File 2’. The GO analysis revealed that LINC00894 mainly regulated genes related to the inflammatory response, transcription regulation (GO:0006357), response to hypoxia (GO:0001666), antigen processing and presentation via MHC class I (GO:0042590), cellular response to corticotropin (GO:0032870), cellular response to hormone stimulus (GO:0032870), cell migration involved in sprouting angiogenesis (GO:0002042), troponin T binding (GO:0031014), and innate immune response (GO:0045087) and circadian rhythm (GO:0007623) (Fig. 6a). The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis (https://david.ncifcrf.gov/) revealed that the LINC00894-regulated genes mainly affected osteoclast differentiation, C5-branched dibasic acid metabolism, acute myeloid leukemia, glutamatergic synapse, phagosome, lipid, and atherosclerosis (Fig. 6b).

Fig. 6 AAV virus-mediated LINC00894 overexpression regulates FGF21 and ACOD1 expression in rat and mouse hippocampus. (a) GO and (b) KEGG analysis of the differentially expressed genes from RNA-seq conducted using AAV-con- (n = 3) and AAV-LINC00894-infected whole brains (n = 3). (c) qPCR was used to detect the expression of ATF4 target genes that differ from those in RNA-seq in PC12 cells subjected to oxygen–glucose deprivation challenge for 12 h (n = 3). The representative result showed that overexpression of LINC00894 increased the protein expression of ATF4, FGF21, and ACOD1 in the hippocampus of the (d) rats(n = 5) and (e) mice (n = 5) in the MCAO model, with quantification of indicated bands in each group from 3 immune blot assay. *** P < 0.001

From the top 120 affected genes regulated by LINC00894 (Additional File 1), we selected kmo, aox4, acod1, fgf21, nkx6-3, atf4, aqp5, tlr5, il17c, fosb, ccr9, and nox4 as the potential ATF4 target genes or those participating in LINC00894-mediated protection against MCAO. Using qRT-PCR, it was determined that the expression of these genes was also regulated by overexpressing LINC00894 in PC12 cells subjected to ODG (Fig. 6c). Furthermore, LINC00894 overexpression increased the protein expression of ATF4, FGF21, and ACOD1 in the hippocampus of MCAO rats and mice (Fig. 6d, e). Based on these findings, we believed that AAV-mediated ectopic expression of LICN00894 could affect FGF21 and ACOD1 expression, through which the protective effect against ischemia-induced brain injury is exercised.

LINC00894-Mediated Protection Against Neuronal OGD Injury Depends on ATF4 Transcriptionally Regulating FGF21 and ACOD1 Expression

Existing findings have shown that ATF4 directly regulates the transcription of FGF21 [16]. We also found that ectopic ATF4 can increase the activity of the FGF21 reporter gene (Fig. 7a), and the ChIP analysis results also indicated that ATF4 directly binds to the transcriptional regulatory region of FGF21 (Fig. 7b). Immunoblotting confirmed that ATF4 knockdown leads to a decrease in FGF21 protein expression in M17 cells and primary hippocampal neurons (Fig. 7c). These results demonstrated the regulation of FGF21 transcription by ATF4. We also investigated whether ATF4 transcriptionally regulated the expression of ACOD1. The results of the luciferase assay showed that ATF4 increased the activity of the ACOD1 luciferase reporter (Fig. 7d). In the ChIP assay, ATF4 was enriched in the ACOD1 promoter (Fig. 7e). The immunoblot assay showed that ATF4 knockdown decreased ACOD1 expression in both M17 and primary hippocampal neurons (Fig. 7f). Thus, ATF4 could transcriptionally regulate ACOD1 expression.

Fig. 7 LINC00894-mediated protection of neuron from OGD depends on ATF4 transcriptionally regulating FGF21 and ACOD1 expression. (a) ATF4 increases the luciferase activity of the FGF21 reporter gene; pGL4.0, empty control vector for luciferase assay; FGF21-Luc, FGF21 luciferase vector (n = 3). (b) Chromatin immunoprecipitation (ChIP) to evaluate the binding of ATF4 to its consensuses (E1, E2, and E3) in the FGF21 promoter (n = 3). (c) The representative result showed the effect of ATF4 knockdown mediated by shRNA on FGF21 expression in M17 (left) and primary fibroblast cells (right). (d) ATF4 increases the luciferase activity of the ACOD1 reporter gene; pGL4.0, empty control vector for luciferase assay(n = 3); ACOD1-Luc, ACOD1 luciferase vector. (e) ChIP was performed to evaluate the binding of ATF4 to its consensuses (site1, site2, and site3) in the ACOD1 promoter(n = 3). (f) The representative result showed the effect of ATF4 knockdown mediated by shRNA on ACOD1 expression in M17 (left) and primary fibroblast cells (right). (g, h) Forced expression of FGF21 or ACOD1 in LINC00894-knockdown M17 cells restored cell viability (g) as assessed using CCK-8(n = 3) and inhibited activated caspase-3 expression (h) as determined in representative western blot assay

We further investigated whether LINC00894-mediated protection of neurons from OGD depended on ATF4, which transcriptionally regulates FGF21 and ACOD1 expression. In the restoration experiment, we found that restoring the expression of FGF21 or ACOD1 in LINC00894-knockdown cells increased cell viability (Fig. 7g) and decreased activated caspase-3 expression in the OGD/R model (Fig. 7h). Thus, we confirmed that LINC00894 is a stress response gene that protects against cerebral ischemic injury by stabilizing EIF5 and facilitating EIF5-ATF4-dependent induction of FGF21 and ACOD1 expression.

Discussion

Approximately 40 million disabilities worldwide are caused by cerebral ischemia annually [39]. Thus, studying the causes and mechanisms of cerebral ischemic stroke is of importance. Although some studies have indicated that LINC00894 may affect LTP function and GPRIN1 expression, shedding light on its potential function in the brain [34, 35], in this study, we demonstrated that this RNA protected the brain from ischemic injury in animal and cell culture models and partially elucidated the molecular mechanisms underlying the role of LINC00894 in this process.

The results of the interactome analysis revealed that LINC00894 may interact with FKBP3, DENR, and DARS2 (Fig. 1a). FKBP3, encoding FKBP25, likely regulates ribosome biogenesis and interacts with the 60 S ribosomal protein L7a; FKBP25 protects endothelial cells against OGD injury [40]. De novo mutations in DENR detected in humans impair its function in mRNA translation and disrupt the migration and terminal branching of cortical neurons [41], DARS2, encoding aspartyl-tRNA synthetase 2, protects against neuroinflammation [42] and regulates the initial stages of mitochondrial protein production [43]. As FKBP3, DENR, DARS2, and EIF5 can regulate protein biosynthesis and bind to LINC00894 in the interactome, we deduced that LINC00894 might regulate protein biosynthesis via interaction with multiple functional molecules; thus, it can exercise neuron protection via other signaling mechanisms.

Animals carrying EIF5G31R-mutant cells reportedly showed low GSH levels, high ROS activity, and H2O2 sensitivity [44]. Cyst stem cells lacking EIF5 display an imbalance in cell proliferation and apoptosis in Drosophila [26]. Consistent with these findings, the cellular EIF5, which was stabilized by LINC00894 in immortal cells (Figs. 4 and 5) and brain tissues (Fig. 3), exhibited protective effects against ischemia (Fig. 3), further demonstrating that EIF5-controlled translation would benefit cellular survival (Figs. 3 and 4). EIF5 stabilized by LINC00894 facilitated GSH synthesis (Fig. 5g) [44], protecting brain cells from oxidative stress, and induced apoptosis during ischemic injury [45]. In addition, the findings of this study are consistent with those of previous studies; furthermore, our findings demonstrated that EIF5 controls the translation of ATF4 (Fig. 5) [23–25]. Combing all these findings we would propose a hypothesis that LINC00894 could regulate ATF4 translation (Fig. 5d) via affecting ubiquitination mediated degradation of EIF5 (Fig. 2e, f).

In this study, we demonstrated that LINC00894 regulates the expression of ATF4 (Figs. 5 and 6) and GCLC and affects the cellular levels of GSH (Fig. 5g–i). Therefore, it is believed that LINC00894 can regulate cellular oxidative stress, thus strengthening our understanding of ATF4 as a stress-responsive gene regulating oxidative stress and GSH synthesis [13, 14]. Furthermore, the expression of FGF21 and ACOD1 via ATF4-mediated transcriptional regulation (Fig. 7a–f) could be modulated by LINC00894, and the protective role of LINC00894 in ischemic injury depends on the levels of intracellular FGF21 and ACOD1 (Fig. 7g, h). These findings indicate that ATF4 directly regulates FGF21 expression in multiple biological contexts and show that ATF4 directly regulates ACOD1 signaling.

By catalyzing itaconate production, ACOD1 regulates oxidative stress and antigen processing and plays dual roles in inflammation [27, 46]. ACOD1-catalyzed itaconate inhibits succinate dehydrogenase activity, resulting in succinate accumulation. Excess succinate inhibits the expression of proinflammatory genes by impairing mitochondrial ROS production; In contrast, ACOD1-mediated ROS production leads to the induction of proinflammatory cytokines [46, 47]. In this study, LINC00894 regulated ACOD1 expression in an ATF4-dependent manner to inhibit ischemia injury-induced cellular apoptosis, indicating that LINC00894-regulated ACOD1 expression could have an anti-inflammatory effect as reported previously [28].

In conclusion, LINC00894 could exert biological effects by interacting with EIF5. Using MCAO and in vitro ischemia models, we showed that LINC00894 stabilized EIF5 to enhance the expression of ATF4, which transcriptionally regulated the expression of FGF21 and ACOD1, thus protecting cells from brain ischemia-induced damage. This study highlights the potential importance of LINC00894 in translation regulation, oxidative stress, and inflammatory responses. The limitation of this study is that we did not fully elucidate the mechanism by which LINC00894 regulates EIF5 ubiquitin degradation, as well as the precise role of ubiquitination of EIF5 in inflammatory responses. Further research is needed to determine which specific cell types in the animal brain are primarily affected by LINC00894 and how it exerts a protective effect on their functionality.

Electronic Supplementary Material

Below is the link to the electronic supplementary material.

Supplementary Material 1: Original gel/blot images. All original gel/blot images corresponding to the manuscript figures.

Supplementary Material 2: Supplementary Table 1. TOP120 genes mostly regulated by LINC00894 in mice brain from MCAO model in RNA-seq assay.

Abbreviations

AAV Adeno-associated virus

ACOD1 Aconitate decarboxylase 1

ATCC American Type Cell Culture Collection

ATF4 Activating transcription factor 4

ChIP Chromatin immunoprecipitation

CI/R Cerebral ischemia–reperfusion

EIF5 Eukaryotic translation initiation factor 5

EMSA Electrophoretic mobility shift assay

FGF21 Fibroblast growth factor 21

GCLC Glutamate-cysteine ligase catalytic subunit

GCLM γ-glutamyl-cysteine ligase synthetase including γ-GC modifier subunit

GO Gene ontology

GSH Glutathione

GSSG Glutathione disulfide

lncRNA Long non-coding RNA

LTP Long-term potentiation

MBF Mouse brain fibroblasts

MCAO/R Middle cerebral artery occlusion reperfusion

OGD/R Oxygen–glucose deprivation and reoxygenation

PBS Phosphate-buffered saline

qRT-PCR Quantitative reverse transcription polymerase chain reaction

ROS Reactive oxygen species

TGF-β2 Transforming growth factor-beta 2

TTC 2,3,5-triphenyltetrazolium chloride

ZEB1 Zinc finger E-box-binding homeobox 1

Acknowledgements

We are grateful to Dr. Hongjie Pan (Shanghai Institute of Planned Parenthood Research) for assistance with EIF5 recombinant protein preparation.

Author Contributions

Conception and design: LL, HC, YC; Methodology: HC, YC; Acquisition of data: HC, YC, ZH, LX, LW, YZ; Analysis and interpretation of data: HC, YC, LL; Writing, review, and revision of the manuscript: HC, YC, LL; Administrative, technical, or material support: HC, YC, LL; Study supervision: HC, LL. All authors read and approved the final manuscript.

Funding

This study was supported by the Key Research and Development Project of Yangzhou City, Jiangsu, China [grant number YZ2023150].

Data Availability

No datasets were generated or analysed during the current study.

Declarations

Ethics Approval and Consent to Participate

All animal experiments were approved by the Animal Ethics Committee of Yangzhou University (Yangzhou, China; Approval No. 202311004 and No. 202304026).

Consent for Publication

Not applicable.

Competing Interests

The authors declare no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Yifei Chen, Hengxiang Cui and Zhuanzhuan Han contributed equally to this work.
==== Refs
References

1. Daniele SG Trummer G Hossmann KA Vrselja Z Benk C Gobeske KT Brain vulnerability and viability after ischaemia Nat Rev Neurosci 2021 22 553 572 10.1038/s41583-021-00488-y 34290397
Daniele SG, Trummer G, Hossmann KA, Vrselja Z, Benk C, Gobeske KT et al (2021) Brain vulnerability and viability after ischaemia. Nat Rev Neurosci 22:553–572. 10.1038/s41583-021-00488-y34290397 10.1038/s41583-021-00488-y
2. Wu M Gu X Ma Z Mitochondrial quality control in cerebral ischemia–reperfusion injury Mol Neurobiol 2021 58 5253 5271 10.1007/s12035-021-02494-8 34275087
Wu M, Gu X, Ma Z (2021) Mitochondrial quality control in cerebral ischemia–reperfusion injury. Mol Neurobiol 58:5253–5271. 10.1007/s12035-021-02494-834275087 10.1007/s12035-021-02494-8
3. Yang K Zeng L Ge A Wang S Zeng J Yuan X A systematic review of the research progress of non-coding RNA in neuroinflammation and immune regulation in cerebral infarction/ischemia-reperfusion injury Front Immunol 2022 13 930171 10.3389/fimmu.2022.930171 36275741
Yang K, Zeng L, Ge A, Wang S, Zeng J, Yuan X et al (2022) A systematic review of the research progress of non-coding RNA in neuroinflammation and immune regulation in cerebral infarction/ischemia-reperfusion injury. Front Immunol 13:930171. 10.3389/fimmu.2022.93017136275741 10.3389/fimmu.2022.930171
4. Bu F Min JW Munshi Y Lai YJ Qi L Urayama A Activation of endothelial ras-related C3 botulinum toxin substrate 1 (Rac1) improves post-stroke recovery and angiogenesis via activating Pak1 in mice Exp Neurol 2019 322 113059 10.1016/j.expneurol.2019.113059 31499064
Bu F, Min JW, Munshi Y, Lai YJ, Qi L, Urayama A et al (2019) Activation of endothelial ras-related C3 botulinum toxin substrate 1 (Rac1) improves post-stroke recovery and angiogenesis via activating Pak1 in mice. Exp Neurol 322:113059. 10.1016/j.expneurol.2019.11305931499064 10.1016/j.expneurol.2019.113059
5. Dambrova M Zuurbier CJ Borutaite V Liepinsh E Makrecka-Kuka M Energy substrate metabolism and mitochondrial oxidative stress in cardiac ischemia/reperfusion injury Free Radic Biol Med 2021 165 24 37 10.1016/j.freeradbiomed.2021.01.036 33484825
Dambrova M, Zuurbier CJ, Borutaite V, Liepinsh E, Makrecka-Kuka M (2021) Energy substrate metabolism and mitochondrial oxidative stress in cardiac ischemia/reperfusion injury. Free Radic Biol Med 165:24–37. 10.1016/j.freeradbiomed.2021.01.03633484825 10.1016/j.freeradbiomed.2021.01.036
6. Lu SC Glutathione synthesis Biochim Biophys Acta 2013 1830 3143 3153 10.1016/j.bbagen.2012.09.008 22995213
Lu SC (2013) Glutathione synthesis. Biochim Biophys Acta 1830:3143–3153. 10.1016/j.bbagen.2012.09.00822995213 10.1016/j.bbagen.2012.09.008
7. Feng W Rosca M Fan Y Hu Y Feng P Lee HG Gclc deficiency in mouse CNS causes mitochondrial damage and neurodegeneration Hum Mol Genet 2017 26 1376 1390 10.1093/hmg/ddx040 28158580
Feng W, Rosca M, Fan Y, Hu Y, Feng P, Lee HG et al (2017) Gclc deficiency in mouse CNS causes mitochondrial damage and neurodegeneration. Hum Mol Genet 26:1376–1390. 10.1093/hmg/ddx04028158580 10.1093/hmg/ddx040
8. Hashimoto S Matsuba Y Takahashi M Kamano N Watamura N Sasaguri H Neuronal glutathione loss leads to neurodegeneration involving gasdermin activation Sci Rep 2023 13 1109 10.1038/s41598-023-27653-w 36670138
Hashimoto S, Matsuba Y, Takahashi M, Kamano N, Watamura N, Sasaguri H et al (2023) Neuronal glutathione loss leads to neurodegeneration involving gasdermin activation. Sci Rep 13:1109. 10.1038/s41598-023-27653-w36670138 10.1038/s41598-023-27653-w
9. Zhang Z Kuang Y Ma K Li Y Liu X Shi Y Gclc overexpression inhibits apoptosis of bone marrow mesenchymal stem cells through the PI3K/AKT/Foxo1 pathway to alleviate inflammation in acute lung injury Int Immunopharmacol 2022 110 109017 10.1016/j.intimp.2022.109017 35792274
Zhang Z, Kuang Y, Ma K, Li Y, Liu X, Shi Y et al (2022) Gclc overexpression inhibits apoptosis of bone marrow mesenchymal stem cells through the PI3K/AKT/Foxo1 pathway to alleviate inflammation in acute lung injury. Int Immunopharmacol 110:109017. 10.1016/j.intimp.2022.10901735792274 10.1016/j.intimp.2022.109017
10. Szewczyk MM Luciani GM Vu V Murison A Dilworth D Barghout SH PRMT5 regulates ATF4 transcript splicing and oxidative stress response Redox Biol 2022 51 102282 10.1016/j.redox.2022.102282 35305370
Szewczyk MM, Luciani GM, Vu V, Murison A, Dilworth D, Barghout SH et al (2022) PRMT5 regulates ATF4 transcript splicing and oxidative stress response. Redox Biol 51:102282. 10.1016/j.redox.2022.10228235305370 10.1016/j.redox.2022.102282
11. Wang X Zhang G Dasgupta S Niewold EL Li C Li Q Atf4 protects the heart from failure by antagonizing oxidative stress Circ Res 2022 131 91 105 10.1161/CIRCRESAHA.122.321050 35574856
Wang X, Zhang G, Dasgupta S, Niewold EL, Li C, Li Q et al (2022) Atf4 protects the heart from failure by antagonizing oxidative stress. Circ Res 131:91–105. 10.1161/CIRCRESAHA.122.32105035574856 10.1161/CIRCRESAHA.122.321050
12. Wortel IMN Van Der Meer LT Kilberg MS Van Leeuwen FN Surviving stress: modulation of atf4-mediated stress responses in normal and malignant cells Trends Endocrinol Metab 2017 28 794 806 10.1016/j.tem.2017.07.003 28797581
Wortel IMN, Van Der Meer LT, Kilberg MS, Van Leeuwen FN (2017) Surviving stress: modulation of atf4-mediated stress responses in normal and malignant cells. Trends Endocrinol Metab 28:794–806. 10.1016/j.tem.2017.07.00328797581 10.1016/j.tem.2017.07.003
13. Harding HP Zhang Y Zeng H Novoa I Lu PD Calfon M An integrated stress response regulates amino acid metabolism and resistance to oxidative stress Mol Cell 2003 11 619 633 10.1016/s1097-2765(03)00105-9 12667446
Harding HP, Zhang Y, Zeng H, Novoa I, Lu PD, Calfon M et al (2003) An integrated stress response regulates amino acid metabolism and resistance to oxidative stress. Mol Cell 11:619–633. 10.1016/s1097-2765(03)00105-912667446 10.1016/s1097-2765(03)00105-9
14. Torrence ME MacArthur MR Hosios AM Valvezan AJ Asara JM Mitchell JR The mTORC1-mediated activation of ATF4 promotes protein and glutathione synthesis downstream of growth signals eLife 2021 10 e63326 10.7554/eLife.63326 33646118
Torrence ME, MacArthur MR, Hosios AM, Valvezan AJ, Asara JM, Mitchell JR et al (2021) The mTORC1-mediated activation of ATF4 promotes protein and glutathione synthesis downstream of growth signals. eLife 10:e63326. 10.7554/eLife.6332633646118 10.7554/eLife.63326
15. Alonge KM Meares GP Hillgartner FB Glucagon and insulin cooperatively stimulate fibroblast growth factor 21 gene transcription by increasing the expression of activating transcription factor 4 J Biol Chem 2017 292 5239 5252 10.1074/jbc.M116.762922 28188284
Alonge KM, Meares GP, Hillgartner FB (2017) Glucagon and insulin cooperatively stimulate fibroblast growth factor 21 gene transcription by increasing the expression of activating transcription factor 4. J Biol Chem 292:5239–5252. 10.1074/jbc.M116.76292228188284 10.1074/jbc.M116.762922
16. De Sousa-Coelho AL Marrero PF Haro D Activating transcription factor 4-dependent induction of FGF21 during amino acid deprivation Biochem J 2012 443 165 171 10.1042/BJ20111748 22233381
De Sousa-Coelho AL, Marrero PF, Haro D (2012) Activating transcription factor 4-dependent induction of FGF21 during amino acid deprivation. Biochem J 443:165–171. 10.1042/BJ2011174822233381 10.1042/BJ20111748
17. Joe Y Kim S Kim HJ Park J Chen Y Park HJ FGF21 induced by carbon monoxide mediates metabolic homeostasis via the PERK/ATF4 pathway FASEB J 2018 32 2630 2643 10.1096/fj.201700709RR 29295856
Joe Y, Kim S, Kim HJ, Park J, Chen Y, Park HJ et al (2018) FGF21 induced by carbon monoxide mediates metabolic homeostasis via the PERK/ATF4 pathway. FASEB J 32:2630–2643. 10.1096/fj.201700709RR29295856 10.1096/fj.201700709RR
18. Salminen A Kaarniranta K Kauppinen A Integrated stress response stimulates FGF21 expression: systemic enhancer of longevity Cell Signal 2017 40 10 21 10.1016/j.cellsig.2017.08.009 28844867
Salminen A, Kaarniranta K, Kauppinen A (2017) Integrated stress response stimulates FGF21 expression: systemic enhancer of longevity. Cell Signal 40:10–21. 10.1016/j.cellsig.2017.08.00928844867 10.1016/j.cellsig.2017.08.009
19. Herrmann JR Kochanek PM Vagni VA Janesko-Feldman K Stezoski J Gorse K FGF21 modulates hippocampal cold-shock proteins and CA2-subregion proteins in neonatal mice with hypoxia–ischemia Pediatr Res 2023 94 1355 1364 10.1038/s41390-023-02652-9 37193753
Herrmann JR, Kochanek PM, Vagni VA, Janesko-Feldman K, Stezoski J, Gorse K et al (2023) FGF21 modulates hippocampal cold-shock proteins and CA2-subregion proteins in neonatal mice with hypoxia–ischemia. Pediatr Res 94:1355–1364. 10.1038/s41390-023-02652-937193753 10.1038/s41390-023-02652-9
20. Wang D Liu F Zhu L Lin P Han F Wang X FGF21 alleviates neuroinflammation following ischemic stroke by modulating the temporal and spatial dynamics of microglia/macrophages J Neuroinflammation 2020 17 257 10.1186/s12974-020-01921-2 32867781
Wang D, Liu F, Zhu L, Lin P, Han F, Wang X et al (2020) FGF21 alleviates neuroinflammation following ischemic stroke by modulating the temporal and spatial dynamics of microglia/macrophages. J Neuroinflammation 17:257. 10.1186/s12974-020-01921-232867781 10.1186/s12974-020-01921-2
21. Do PT Chuang DM Wu CC Huang CZ Chen YH Kang SJ Mesenchymal stem cells overexpressing FGF21 preserve blood-brain barrier integrity in experimental ischemic stroke Transl Stroke Res 2023 10.1007/s12975-023-01196-8 37783839
Do PT, Chuang DM, Wu CC, Huang CZ, Chen YH, Kang SJ et al (2023) Mesenchymal stem cells overexpressing FGF21 preserve blood-brain barrier integrity in experimental ischemic stroke. Transl Stroke Res. 10.1007/s12975-023-01196-837783839 10.1007/s12975-023-01196-8
22. Si K Das K Maitra U Characterization of multiple mRNAs that encode mammalian translation initiation factor 5(eIF-5) J Biol Chem 1996 271 16934 16938 10.1074/jbc.271.28.16934 8663286
Si K, Das K, Maitra U (1996) Characterization of multiple mRNAs that encode mammalian translation initiation factor 5(eIF-5). J Biol Chem 271:16934–16938. 10.1074/jbc.271.28.169348663286 10.1074/jbc.271.28.16934
23. Singh CR Curtis C Yamamoto Y Hall NS Kruse DS He H Eukaryotic translation initiation factor 5 is critical for integrity of the scanning preinitiation complex and accurate control of gcn4 translation Mol Cell Biol 2005 25 5480 5491 10.1128/MCB.25.13.5480-5491.2005 15964804
Singh CR, Curtis C, Yamamoto Y, Hall NS, Kruse DS, He H et al (2005) Eukaryotic translation initiation factor 5 is critical for integrity of the scanning preinitiation complex and accurate control of gcn4 translation. Mol Cell Biol 25:5480–5491. 10.1128/MCB.25.13.5480-5491.200515964804 10.1128/MCB.25.13.5480-5491.2005
24. Kozel C Thompson B Hustak S Moore C Nakashima A Singh CR Overexpression of eIF5 or its protein mimic 5MP perturbs eIF2 function and induces ATF4 translation through delayed re-initiation Nucleic Acids Res 2016 44 8704 8713 10.1093/nar/gkw559 27325740
Kozel C, Thompson B, Hustak S, Moore C, Nakashima A, Singh CR et al (2016) Overexpression of eIF5 or its protein mimic 5MP perturbs eIF2 function and induces ATF4 translation through delayed re-initiation. Nucleic Acids Res 44:8704–8713. 10.1093/nar/gkw55927325740 10.1093/nar/gkw559
25. Tang L Morris J Wan J Moore C Fujita Y Gillaspie S Competition between translation initiation factor eIF5 and its mimic protein 5MP determines non-AUG initiation rate genome-wide Nucleic Acids Res 2017 45 11941 11953 10.1093/nar/gkx808 28981728
Tang L, Morris J, Wan J, Moore C, Fujita Y, Gillaspie S et al (2017) Competition between translation initiation factor eIF5 and its mimic protein 5MP determines non-AUG initiation rate genome-wide. Nucleic Acids Res 45:11941–11953. 10.1093/nar/gkx80828981728 10.1093/nar/gkx808
26. Li Z Wu Y Fu Y Chen X Zhao X Wu X Cyst stem cell lineage eIF5 non-autonomously prevents testicular germ cell tumor formation via eIF1A/eIF2γ-mediated pre-initiation complex Stem Cell Res Ther 2022 13 351 10.1186/s13287-022-03025-5 35883200
Li Z, Wu Y, Fu Y, Chen X, Zhao X, Wu X et al (2022) Cyst stem cell lineage eIF5 non-autonomously prevents testicular germ cell tumor formation via eIF1A/eIF2γ-mediated pre-initiation complex. Stem Cell Res Ther 13:351. 10.1186/s13287-022-03025-535883200 10.1186/s13287-022-03025-5
27. Peace CG O’Neill LAJ The role of itaconate in host defense and inflammation J Clin Invest 2022 132 e148548 10.1172/JCI148548 35040439
Peace CG, O’Neill LAJ (2022) The role of itaconate in host defense and inflammation. J Clin Invest 132:e148548. 10.1172/JCI14854835040439 10.1172/JCI148548
28. Vigil TM Frieler RA Kilpatrick KL Wang MM Mortensen RM Aconitate decarboxylase 1 suppresses cerebral ischemia-reperfusion injury in mice Exp Neurol 2022 347 113902 10.1016/j.expneurol.2021.113902 34699789
Vigil TM, Frieler RA, Kilpatrick KL, Wang MM, Mortensen RM (2022) Aconitate decarboxylase 1 suppresses cerebral ischemia-reperfusion injury in mice. Exp Neurol 347:113902. 10.1016/j.expneurol.2021.11390234699789 10.1016/j.expneurol.2021.113902
29. Ransohoff JD Wei Y Khavari PA The functions and unique features of long intergenic non-coding RNA Nat Rev Mol Cell Biol 2018 19 143 157 10.1038/nrm.2017.104 29138516
Ransohoff JD, Wei Y, Khavari PA (2018) The functions and unique features of long intergenic non-coding RNA. Nat Rev Mol Cell Biol 19:143–157. 10.1038/nrm.2017.10429138516 10.1038/nrm.2017.104
30. Wapinski O Chang HY Long noncoding RNAs and human disease Trends Cell Biol 2011 21 354 361 10.1016/j.tcb.2011.04.001 21550244
Wapinski O, Chang HY (2011) Long noncoding RNAs and human disease. Trends Cell Biol 21:354–361. 10.1016/j.tcb.2011.04.00121550244 10.1016/j.tcb.2011.04.001
31. Yang S Lim KH Kim SH Joo JY Molecular landscape of long noncoding RNAs in brain disorders Mol Psychiatry 2021 26 1060 1074 10.1038/s41380-020-00947-5 33173194
Yang S, Lim KH, Kim SH, Joo JY (2021) Molecular landscape of long noncoding RNAs in brain disorders. Mol Psychiatry 26:1060–1074. 10.1038/s41380-020-00947-533173194 10.1038/s41380-020-00947-5
32. Liu SJ Dang HX Lim DA Feng FY Maher CA Long noncoding RNAs in cancer metastasis Nat Rev Cancer 2021 21 446 460 10.1038/s41568-021-00353-1 33953369
Liu SJ, Dang HX, Lim DA, Feng FY, Maher CA (2021) Long noncoding RNAs in cancer metastasis. Nat Rev Cancer 21:446–460. 10.1038/s41568-021-00353-133953369 10.1038/s41568-021-00353-1
33. Zhang X Wang M Sun H Zhu T Wang X Downregulation of linc00894-002 contributes to tamoxifen resistance by enhancing the TGF-β signaling pathway Biochem (Mosc) 2018 83 603 611 10.1134/S0006297918050139
Zhang X, Wang M, Sun H, Zhu T, Wang X (2018) Downregulation of linc00894-002 contributes to tamoxifen resistance by enhancing the TGF-β signaling pathway. Biochem (Mosc) 83:603–611. 10.1134/S000629791805013910.1134/S0006297918050139
34. Wang ZB Qu J Xie P Yang ZQ Mao CX Zhang Y Integrative analysis of expression profile indicates the ECM receptor and LTP dysfunction in the glioma-related epilepsy BMC Genomics 2022 23 430 10.1186/s12864-022-08665-8 35676651
Wang ZB, Qu J, Xie P, Yang ZQ, Mao CX, Zhang Y et al (2022) Integrative analysis of expression profile indicates the ECM receptor and LTP dysfunction in the glioma-related epilepsy. BMC Genomics 23:430. 10.1186/s12864-022-08665-835676651 10.1186/s12864-022-08665-8
35. Nordman JC Phillips WS Kodama N Clark SG Del Negro CA Kabbani N Axon targeting of the alpha 7 nicotinic receptor in developing hippocampal neurons by Gprin1 regulates growth J Neurochem 2014 129 649 662 10.1111/jnc.12641 24350810
Nordman JC, Phillips WS, Kodama N, Clark SG, Del Negro CA, Kabbani N (2014) Axon targeting of the alpha 7 nicotinic receptor in developing hippocampal neurons by Gprin1 regulates growth. J Neurochem 129:649–662. 10.1111/jnc.1264124350810 10.1111/jnc.12641
36. Zhou Q Li D Zheng H He Z Qian F Wu X A novel lncRNA-miRNA‐mRNA competing endogenous RNA regulatory network in lung adenocarcinoma and kidney renal papillary cell carcinoma Thorac Cancer 2021 12 2526 2536 10.1111/1759-7714.14129 34453499
Zhou Q, Li D, Zheng H, He Z, Qian F, Wu X et al (2021) A novel lncRNA-miRNA‐mRNA competing endogenous RNA regulatory network in lung adenocarcinoma and kidney renal papillary cell carcinoma. Thorac Cancer 12:2526–2536. 10.1111/1759-7714.1412934453499 10.1111/1759-7714.14129
37. Won S Lee JK Stein DG Recombinant tissue plasminogen activator promotes, and progesterone attenuates, microglia/macrophage M1 polarization and recruitment of microglia after MCAO stroke in rats Brain Behav Immun 2015 49 267 279 10.1016/j.bbi.2015.06.007 26093305
Won S, Lee JK, Stein DG (2015) Recombinant tissue plasminogen activator promotes, and progesterone attenuates, microglia/macrophage M1 polarization and recruitment of microglia after MCAO stroke in rats. Brain Behav Immun 49:267–279. 10.1016/j.bbi.2015.06.00726093305 10.1016/j.bbi.2015.06.007
38. Zibitt S Hartford M Lal CCR Interrogating lncRNA functions via CRISPR/Cas systems RNA Biol 2021 18 2097 2106 10.1080/15476286.2021.1899500 33685382
Zibitt S, Hartford M, Lal CCR (2021) Interrogating lncRNA functions via CRISPR/Cas systems. RNA Biol 18:2097–2106. 10.1080/15476286.2021.189950033685382 10.1080/15476286.2021.1899500
39. Zhao M Li F Jian Y Wang X Yang H Wang J Salvianolic acid B regulates macrophage polarization in ischemic/reperfused hearts by inhibiting mTORC1-induced glycolysis Eur J Pharmacol 2020 871 172916 10.1016/j.ejphar.2020.172916 31930970
Zhao M, Li F, Jian Y, Wang X, Yang H, Wang J et al (2020) Salvianolic acid B regulates macrophage polarization in ischemic/reperfused hearts by inhibiting mTORC1-induced glycolysis. Eur J Pharmacol 871:172916. 10.1016/j.ejphar.2020.17291631930970 10.1016/j.ejphar.2020.172916
40. Jiang Q Wu G Yang L Lu YP Liu XX Han F Elucidation of the fkbp25-60s ribosomal protein l7a stress response signaling during ischemic injury Cell Physiol Biochem 2018 47 2018 2030 10.1159/000491470 29969783
Jiang Q, Wu G, Yang L, Lu YP, Liu XX, Han F et al (2018) Elucidation of the fkbp25-60s ribosomal protein l7a stress response signaling during ischemic injury. Cell Physiol Biochem 47:2018–2030. 10.1159/00049147029969783 10.1159/000491470
41. Haas MA Ngo L Li SS Schleich S Qu Z Vanyai HK De novo mutations in denr disrupt neuronal development and link congenital neurological disorders to faulty mrna translation re-initiation Cell Rep 2016 15 2251 2265 10.1016/j.celrep.2016.04.090 27239039
Haas MA, Ngo L, Li SS, Schleich S, Qu Z, Vanyai HK et al (2016) De novo mutations in denr disrupt neuronal development and link congenital neurological disorders to faulty mrna translation re-initiation. Cell Rep 15:2251–2265. 10.1016/j.celrep.2016.04.09027239039 10.1016/j.celrep.2016.04.090
42. Aradjanski M Dogan SA Lotter S Wang S Hermans S Wibom R DARS2 protects against neuroinflammation and apoptotic neuronal loss, but is dispensable for myelin producing cells Hum Mol Genet 2017 26 4181 4189 10.1093/hmg/ddx307 28985337
Aradjanski M, Dogan SA, Lotter S, Wang S, Hermans S, Wibom R et al (2017) DARS2 protects against neuroinflammation and apoptotic neuronal loss, but is dispensable for myelin producing cells. Hum Mol Genet 26:4181–4189. 10.1093/hmg/ddx30728985337 10.1093/hmg/ddx307
43. Fröhlich D Suchowerska AK Voss C He R Wolvetang E Von Jonquieres G Expression pattern of the aspartyl-trna synthetase dars in the human brain Front Mol Neurosci 2018 11 81 10.3389/fnmol.2018.00081 29615866
Fröhlich D, Suchowerska AK, Voss C, He R, Wolvetang E, Von Jonquieres G et al (2018) Expression pattern of the aspartyl-trna synthetase dars in the human brain. Front Mol Neurosci 11:81. 10.3389/fnmol.2018.0008129615866 10.3389/fnmol.2018.00081
44. Ram AK Mallik M Reddy RR Suryawanshi AR Alone PV Altered proteome in translation initiation fidelity defective eIF5G31R mutant causes oxidative stress and DNA damage Sci Rep 2022 12 5033 10.1038/s41598-022-08857-y 35322093
Ram AK, Mallik M, Reddy RR, Suryawanshi AR, Alone PV (2022) Altered proteome in translation initiation fidelity defective eIF5G31R mutant causes oxidative stress and DNA damage. Sci Rep 12:5033. 10.1038/s41598-022-08857-y35322093 10.1038/s41598-022-08857-y
45. Sifringer M Brait D Weichelt U Zimmerman G Endesfelder S Brehmer F Erythropoietin attenuates hyperoxia-induced oxidative stress in the developing rat brain Brain Behav Immun 2010 24 792 799 10.1016/j.bbi.2009.08.010 19729061
Sifringer M, Brait D, Weichelt U, Zimmerman G, Endesfelder S, Brehmer F et al (2010) Erythropoietin attenuates hyperoxia-induced oxidative stress in the developing rat brain. Brain Behav Immun 24:792–799. 10.1016/j.bbi.2009.08.01019729061 10.1016/j.bbi.2009.08.010
46. Wu R Liu J Tang D Kang R The dual role of acod1 in inflammation J Immunol 2023 211 518 526 10.4049/jimmunol.2300101 37549395
Wu R, Liu J, Tang D, Kang R (2023) The dual role of acod1 in inflammation. J Immunol 211:518–526. 10.4049/jimmunol.230010137549395 10.4049/jimmunol.2300101
47. Wu R Chen F Wang N Tang D Kang R ACOD1 in immunometabolism and disease Cell Mol Immunol 2020 17 822 833 10.1038/s41423-020-0489-5 32601305
Wu R, Chen F, Wang N, Tang D, Kang R (2020) ACOD1 in immunometabolism and disease. Cell Mol Immunol 17:822–833. 10.1038/s41423-020-0489-532601305 10.1038/s41423-020-0489-5
