
==== Front
eLife
Elife
eLife
eLife
2050-084X
eLife Sciences Publications, Ltd

39207914
92195
10.7554/eLife.92195
version of record
Research Article
Cell Biology
TRIP13 localizes to synapsed chromosomes and functions as a dosage-sensitive regulator of meiosis
Chotiner Jessica Y 1
Leu N Adrian 1
Yang Fang 1
Cossu Isabella G 1
Guan Yongjuan 12
Lin Huijuan 1
Wang P Jeremy https://orcid.org/0000-0003-2311-4089
pwang@vet.upenn.edu
1
1 Department of Biomedical Sciences, University of Pennsylvania School of Veterinary Medicine Philadelphia United States
2 https://ror.org/005edt527 College of Life Sciences, Capital Normal University Beijing China
Yan Wei Reviewing Editor https://ror.org/025j2nd68 The Lundquist Institute United States

Yan Wei Senior Editor https://ror.org/025j2nd68 The Lundquist Institute United States

29 8 2024
2024
12 RP9219508 9 2023
This manuscript was published as a preprint.26 9 2023

This manuscript was published as a reviewed preprint.22 11 2023

The reviewed preprint was revised.07 3 2024

© 2023, Chotiner et al
2023
Chotiner et al
https://creativecommons.org/licenses/by/4.0/ This article is distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use and redistribution provided that the original author and source are credited.

Meiotic progression requires coordinated assembly and disassembly of protein complexes involved in chromosome synapsis and meiotic recombination. Mouse TRIP13 and its ortholog Pch2 are instrumental in remodeling HORMA domain proteins. HORMAD proteins are associated with unsynapsed chromosome axes but depleted from the synaptonemal complex (SC) of synapsed homologs. Here we report that TRIP13 localizes to the synapsed SC in early pachytene spermatocytes and to telomeres throughout meiotic prophase I. Loss of TRIP13 leads to meiotic arrest and thus sterility in both sexes. Trip13-null meiocytes exhibit abnormal persistence of HORMAD1 and HOMRAD2 on synapsed SC and chromosome asynapsis that preferentially affects XY and centromeric ends. These major phenotypes are consistent with reported phenotypes of Trip13 hypomorph alleles. Trip13 heterozygous mice exhibit meiotic defects that are less severe than the Trip13-null mice, showing that TRIP13 is a dosage-sensitive regulator of meiosis. Localization of TRIP13 to the synapsed SC is independent of SC axial element proteins such as REC8 and SYCP2/SYCP3. Terminal FLAG-tagged TRIP13 proteins are functional and recapitulate the localization of native TRIP13 to SC and telomeres. Therefore, the evolutionarily conserved localization of TRIP13/Pch2 to the synapsed chromosomes provides an explanation for dissociation of HORMA domain proteins upon synapsis in diverse organisms.

TRIP13
meiosis
spermatogenesis
fertility
Research organism

Mouse
http://dx.doi.org/10.13039/100009633 Eunice Kennedy Shriver National Institute of Child Health and Human Development T32HD083185 Chotiner Jessica Y http://dx.doi.org/10.13039/100000057 National Institute of General Medical Sciences R35GM153384 Wang P Jeremy The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.Author impact statementMouse TRIP13 localizes to synapsed chromosomal axes and thus exhibits mutually exclusive localization with HORMAD1/HORMAD2, providing a cell biological explanation for dissociation of HORMAD1/2 from chromosomal axes upon synapsis.
publishing-routeprc
==== Body
pmcIntroduction

Meiosis is a specialized cell division program that generates haploid gametes from diploid germ cells. During meiotic prophase I, homologous chromosomes undergo paring, synapsis, and recombination (Handel and Schimenti, 2010; Zickler and Kleckner, 2015). Chromosome synapsis requires the formation of the synaptonemal complex (SC). The SC is a proteinaceous structure comprising two lateral/axial elements, transverse filaments, and a central element (Page and Hawley, 2004). Meiotic recombination begins with the generation of DNA double-strand breaks (DSBs) and ends with the crossover formation through repair of DSBs (Hunter, 2015). Chromosome synapsis and meiotic recombination are interdependent in many species, including yeast and mouse. Meiotic recombination not only increases genetic diversity in gametes at the organism level but also is essential for faithful chromosome segregation during the first meiotic cell division. Therefore, defects in meiosis are the leading causes of aneuploidy, birth defect, infertility, and pregnancy loss.

The progression and completion of synapsis and recombination are monitored by a surveillance mechanism called meiotic checkpoint (Roeder and Bailis, 2000). Meiotic checkpoint proteins were extensively studied in yeast. Many meiotic processes are highly conserved, and studies of meiosis in yeast have been foundational for our understanding of mammalian meiosis. In yeast, Pch2, an AAA+ATPase, is a checkpoint protein because it is necessary for pachytene arrest in the absence of the SC protein Zip1 or the meiosis-specific DSB repair protein Dmc1 (Herruzo et al., 2021; San-Segundo and Roeder, 1999). Pch2 is a hexameric ring ATPase and remodels the HORMA (Hop1, Rev7, and MAD2) domain protein Hop1 in a nucleotide-dependent manner (Chen et al., 2014). While Pch2 is mainly located in the nucleolus, Pch2 also localizes to the synapsed SC as foci at the pachytene stage and is essential for removing Hop1 from chromosome axes (Chen et al., 2014; Joshi et al., 2009; San-Segundo and Roeder, 1999). Mechanistically, Pch2 promotes phosphorylation of Hop1, which activates the Mek1 kinase and the subsequent checkpoint cascade (Herruzo et al., 2016; Raina and Vader, 2020).

TRIP13, the mammalian ortholog of yeast Pch2, is essential for the completion of meiotic recombination in mouse (Li and Schimenti, 2007; Roig et al., 2010). Mutations in human TRIP13 predispose to Wilms tumor in children or cause infertility in women (Yost et al., 2017; Zhang et al., 2020). HORMAD1 and HORMAD2, mammalian meiosis-specific HORMA domain proteins, localize to chromosome axis at leptotene and zygotene stages but are depleted from synapsed chromosomes, except the largely unsynapsed XY chromosomes at the pachytene stage (Cossu et al., 2024; Fukuda et al., 2010; Xu et al., 2019). TRIP13 facilitates removal of HORMAD proteins from synapsed chromosome axis (Roig et al., 2010; Wojtasz et al., 2009). SKP1, an essential component of the SCF (Skp1-Cullin 1-F-box protein) ubiquitin E3 ligase, is required not only for depleting HORMAD1 and HORMAD2 from synapsed chromosome axes but also for restricting the accumulation of HORMAD proteins on unsynapsed axes (Guan et al., 2020; Guan et al., 2022). Therefore, reorganization of HORMA domain proteins on meiotic chromosome axes is regulated by both TRIP13 and SKP1. As a conserved mechanism, Pch2/TRIP13 remodels HORMA domain proteins through engagement of their N-terminal regions (Prince and Martinez-Perez, 2022). MAD2, a spindle assembly checkpoint HORMA domain protein, exists in two fold states: closed and open (Luo et al., 2004; Sironi et al., 2002). In the closed state, the so-called safety belt of the HORMA domain wraps around the HORMAD protein-binding motif ‘closure motif’ in the partner protein and thus traps the partner. In the open state, TRIP13 engagement changes conformation of the HORMA domain, resulting in foldback of the safety belt on the closure motif-binding region and thus release of its partner protein. The safety belt mechanism turns out to be a shared feature of HORMA domain proteins (Kim et al., 2014; West et al., 2019; West et al., 2018; Ye et al., 2017).

Unlike yeast Pch2, TRIP13 does not appear to function in the meiotic checkpoint in mouse (Pacheco et al., 2015). Interestingly, HORMAD2 functions as a meiotic checkpoint protein for surveillance of meiotic defects in female meiosis (Kogo et al., 2012a; Rinaldi et al., 2017; Wojtasz et al., 2012). HORMAD2-deficient males are sterile but females are fertile. HORMAD2 deficiency rescues the oocyte loss in Spo11-null or Trip13 mutant females but not in Dmc1-null females, suggesting that HORMAD2 is a component of the meiotic checkpoint in females. HORMAD1 is required for fertility in both sexes (Kogo et al., 2012b; Shin et al., 2010; Stanzione et al., 2016). Both HORMAD1 and HORMAD2 localize prominently to the XY chromosome axes in pachytene spermatocytes and regulate meiotic sex chromatin inactivation (Kogo et al., 2012a; Shin et al., 2010; Wojtasz et al., 2012).

Studies of mice with hypomorphic Trip13 mutations show that TRIP13 is required for meiotic progression (Li and Schimenti, 2007; Roig et al., 2010). Two different hypomorphic Trip13 mouse lines have been studied: one ‘moderate’ allele that exhibited defective meiotic recombination and one ‘severe’ allele that displayed defects in meiotic recombination and chromosome synapsis. The variance in phenotype between the hypomorphic mouse lines indicates that even partial depletion of Trip13 can interrupt meiosis. We sought to further investigate the meiotic function of TRIP13. By immunofluorescence, we found that TRIP13 localized to the SC in early pachytene spermatocytes and to telomeres throughout meiotic prophase I. The TRIP13 localization pattern on meiotic chromosomes was further confirmed by the analysis of FLAG-tagged TRIP13 in two knockin mouse lines. To determine the effect of complete loss of TRIP13, we characterized Trip13-null mice. While the Trip13-null phenotype was largely comparable to the phenotype of the severe Trip13 hypomorphic allele, we found that TRIP13 is a dosage-sensitive regulator of meiosis. Finally, our results show that the localization of TRIP13 to the SC is independent of axial element proteins.

Results

TRIP13 localizes to meiotic chromosomes in prophase I spermatocytes

We assessed the expression of TRIP13 in a panel of adult mouse tissues. TRIP13 was primarily expressed in testis but detected at low levels in ovary and liver (Figure 1A). In the testis, TRIP13 was prominent in the cytoplasm of primary spermatocytes, especially leptotene and zygotene cells (Figure 1B). Given the expression of TRIP13 in spermatocytes, we examined its localization on meiotic chromosomes by immunostaining of surface spread nuclei of prophase I spermatocytes (Figure 1C). Previously, TRIP13 was reported to localize to telomeres in spermatocytes (Gómez-H et al., 2019). Indeed, we found that TRIP13 localized to telomeres from leptotene to diplotene cells (Figure 1C). Strikingly, we found that, in addition to telomeres, TRIP13 localized to the SC in early pachytene spermatocytes but disappeared from the SC in the mid to late pachytene spermatocytes (Figure 1C). The SC consists of two lateral elements and one central element. The central region comprises the transverse filament protein SYCP1 and central element proteins, which appear upon synapsis. Given the novel localization of TRIP13 to the SC, we performed confocal immunofluorescent microscopy with super-resolution deconvolution to determine the location of TRIP13 within the SC. In contrast to the lateral element marker SYCP3, TRIP13 localized to the SC central region (Figure 1D). We examined the localization of TRIP13 in oocytes. TRIP13 localized strongly to meiotic telomeres in all stages of prophase I, but not as filaments on the SC (Figure 1—figure supplement 1). These findings are consistent with the genetic requirement of TRIP13 in meiosis in both sexes (Li and Schimenti, 2007; Roig et al., 2010).

Figure 1. TRIP13 localizes to the synaptonemal complex and telomeres in spermatocytes.

(A) Western blot analysis of TRIP13 in adult mouse tissues. Heart and skeletal muscle lack ACTB. (B) Immunofluorescence of TRIP13 in sections of 3-month-old wild type and Trip13-/- testes. Lep, leptotene; Zyg, zygotene; Pac, pachytene; eS, elongating spermatids; ES, elongated spermatids. (C) Immunofluorescence of TRIP13 in spread nuclei of spermatocytes from wild type P20 testes. (D) Super-resolution localization of TRIP13 to the central element (CE) but not lateral element (LE) of the synaptonemal complex at early pachytene stage. The enlarged view of the boxed chromosome is shown at the bottom.

Figure 1—source data 1. Original files of the full raw unedited western blots in Figure 1A.

Figure 1—figure supplement 1. Immunofluorescent analysis of TRIP13 in spread nuclei of oocytes from embryonic day 16.5 (E16.5) and E18.5 female embryos.

Scale bars, 10 µm.

Global loss of Trip13 causes meiotic arrest

Two previous studies utilizing two Trip13 hypomorphic (gene trap) alleles, one moderate and one severe, revealed a role for TRIP13 in meiotic recombination (Li and Schimenti, 2007; Roig et al., 2010). However, while the Trip13 moderate allele showed mostly intact chromosomal synapsis, the severe allele displayed chromosomal unsynapsis preferentially at chromosome ends (Li and Schimenti, 2007; Roig et al., 2010). Upon close examination, we also found unsynapsed ends in spermatocytes with the moderate Trip13 mutant (Guan et al., 2020). To rigorously ascertain the role of TRIP13 in meiosis, we generated Trip13-null mutants using frozen sperm from Trip13+/- males with a knockout allele from the International Mouse Phenotyping Consortium. The mouse Trip13 gene consists of 13 exons. This new Trip13 mutant allele harbors a deletion of a 24 kb region including all 13 exons and thus is expected to be null. We verified this deletion by PCR and sequencing. Interbreeding of Trip13+/- mice produced fewer Trip13-/- offspring than expected: Trip13+/+, 80; Trip13+/-, 220; Trip13-/-, 51 (χ2 = 27, p=0.0001). The body weight of 2–3-month-old males was not significantly different between wild type (24.3 ± 2.8 g, n = 5) and Trip13-/- mice (22.8 ± 1.7 g, n = 5, p=0.3, Student’s t-test). The Trip13-/- testis was much smaller than Trip13+/- testis (Figure 2A). Western blot analysis showed that TRIP13 was present in reduced abundance in Trip13+/- testis and not detected in Trip13-/- testis, demonstrating that this mutant allele is null (Figure 2B). The abundance of SYCP3, a component of the SC, was also reduced in Trip13-/- testis, suggesting a partial depletion of meiotic cells (Figure 2B). The testis weight of adult Trip13-/- males was reduced by 74% in comparison with the wild type males (Figure 2C). Adult Trip13-/- males lacked sperm in the epididymis (Figure 2D). Histological analysis showed that while spermatocytes in all stages of meiosis were present in adult Trip13+/+ and Trip13+/- testes, Trip13-/- testis displayed complete meiotic arrest, evidenced by the presence of early spermatocytes and a lack of secondary spermatocytes, round spermatids, and mature sperm (Figure 2E). Trip13-/- females were also sterile. The adult Trip13-/- ovary was very small and showed a complete loss of oocytes (Figure 2—figure supplement 1). These observations are similar to the meiotic arrest phenotype observed in the hypomorphic Trip13 mouse mutants (Li and Schimenti, 2007; Roig et al., 2010).

Figure 2. Loss of Trip13 leads to meiotic arrest in males.

(A) Image of testes from 2- to 3-month-old mice. (B) Western blot analysis of TRIP13 in P21 testes. SYCP3 serves as a meiosis-specific marker. ACTB serves as a loading control. (C) Testis to body weight ratio of 2–3-month-old mice. n = 3 males. Statistics, one-way ANOVA. (D) Sperm count of 2–3-month-old Trip13+/+ and Trip13+/- males. n = 3 males. Statistics, one-way ANOVA. (E) Histological analysis of 2-month-old testes. Sertoli, Sertoli cell; Zyg, zygotene; Pa-like, pachytene-like; Dip, diplotene; eS, elongating spermatids.

Figure 2—source data 1. Original files of the full raw unedited western blots in Figure 2B.

Figure 2—figure supplement 1. Histological analysis of ovaries from adult (8-week) wild type and Trip13-/- females.

Scale bars, 200 µm.

Defects in chromosomal synapsis in Trip13-deficient spermatocytes

We investigated the effect of Trip13 deficiency on meiotic progression. The transverse filament/central element protein SYCP1 and the lateral element protein SYCP3 were used to determine the stage of prophase I spermatocytes. While the P20 wild type testis contained spermatocytes from leptotene through diplotene stages, about half of the Trip13-/- spermatocytes were in the early pachytene stage and no cells were found at later stages of prophase I, showing meiotic blockade at the early pachytene stage in Trip13-/- testes (Figure 3A). The early pachytene-like spermatocytes from Trip13-/- testes contained unsynapsed chromosomal ends (Figure 3B). Mouse centromeres are telocentric. Co-staining with the centromere marker CREST showed that 94% of unsynapsed ends were centromeric ends (Figure 4A). While XY chromosomes were synapsed at the pseudoautosomal regions and thus were connected in wild type and Trip13+/- pachytene spermatocytes, they were separate in Trip13-/- pachytene-like spermatocytes (Figure 3B and C). We found that SYCE1, a component of the SC central element, localized to the synapsed SC but not to unsynapsed regions in Trip13-/- pachytene-like cells (Figure 3C). Confocal microscopy with super-resolution deconvolution confirmed that many homologous chromosomes in Trip13-/- spermatocytes had split ends and some had regions of interstitial asynapsis (Figure 3D). We quantified these meiotic defects in spermatocytes: chromosomal asynapsis (Figure 3E), the number of asynapsed ends (Figure 3F), and the extent of XY asynapsis (Figure 3G). Previous studies also reported synaptic defects in spermatocytes from Trip13 hypomorph mutants (Li and Schimenti, 2007; Roig et al., 2010). Here we found that global loss of Trip13 caused similar defects in autosomal synapsis but a more severe defect in sex chromosome synapsis.

Figure 3. Trip13 is required for chromosomal synapsis in males.

(A) Composition of prophase I spermatocytes in P20 testes. Three males per genotype were analyzed by nuclear spread analysis. Total number of spermatocytes counted: Trip13+/+, 1038 cells; Trip13+/-, 803 cells; Trip13-/-, 406 cells. (B) Immunofluorescence of SYCP1 and SYCP3 in spread nuclei of pachytene spermatocytes from P20 testes. (C) Immunofluorescence of SYCE1 and SYCP3 in spread nuclei of pachytene spermatocytes from P20 testes. (D) Super-resolution confocal microscopy of a Trip13-/- spermatocyte from P20 testis. Immunostaining was performed for SYCP1 and SYCP3. Arrowheads indicate end asynapsis. Arrow indicates interstitial asynapsis. (E) Percentage of early pachytene cells from P19-20 testes with asynapsed chromosomes across three genotypes. (F) Number of homologous chromosomes with end asynapsis per cell in P19-20 testes. (G) Percentage of early pachytene cells from P20 testes with asynapsed XY chromosomes per mouse. The p-values are indicated in graphs. Statistics (E–G), one-way ANOVA.

Figure 4. Normal localization of centromere and telomere markers in Trip13-deficient spermatocytes from juvenile mice.

(A–D) Immunofluorescent analysis of centromere and telomere markers in Trip13+/+ and Trip13-/- pachytene spermatocytes: CREST (A), CENPC (B), TRF1 (C), and MAJIN (D). SYCP3 labels the lateral elements of the synaptonemal complex. Scale bars, 10 µm.

Figure 4—figure supplement 1. Immunofluorescent analysis of REC114 in spread nuclei of spermatocytes from P28 wild type (Trip13+/+) and Trip13-/- testes.

Wild type, early pachytene; Trip13-/-, pachytene-like. REC114 foci are indicated by arrows. Scale bar, 10 μm.

TRIP13 is a dosage-sensitive regulator of meiosis

Although Trip13+/- males were fertile, their testis weight and sperm count were significantly reduced in comparison with wild type (Figure 2C and D). The percentage of spermatocytes with defects in synapsis was higher in Trip13+/- males than wild type (Figure 3E). In addition, the percentage of spermatocytes with asynapsed XY chromosomes was significantly higher in Trip13+/- males than wild type (Figure 3G). As defects in synapsis can activate the meiotic checkpoint and thus apoptosis of affected spermatocytes, the increased synaptic defects likely caused the decrease in sperm output in Trip13+/- males. These results demonstrate that TRIP13 regulates meiosis in a dosage-dependent manner.

Telomere and centromere proteins localize normally in Trip13-deficient spermatocytes

TRIP13 localizes to telomeres and loss of TRIP13 causes peri-centromeric/telomeric asynapsis. Therefore, we asked whether telomere or centromere proteins were affected in Trip13-/- spermatocytes. Chromosome spreads were immunostained for two centromere markers, CREST and CENPC (Figure 4A and B). CENPC is essential for recruiting kinetochore proteins to the centromere (Klare et al., 2015; Kwon et al., 2007). CREST and CENPC still localized to centromeres in Trip13-/- spermatocytes. Because many Trip13-/- spermatocytes had split ends, two CREST or two CENPC foci were observed at the split ends. To assess the telomere, spermatocytes were immunostained for TRF1 and MAJIN (Figure 4C and D). In meiotic cells, telomeres contain canonical telomere proteins such as TRF1/TRF2 and a meiosis-specific complex (MAJIN, TERB1, TERB2, and SUN1) (Shibuya et al., 2015). TRF1 is a telomere protein expressed in both somatic and germ cells (Karlseder et al., 2003; Long et al., 2017; Shibuya et al., 2014). MAJIN is a component of the meiosis-specific telomere complex that is important for telomere attachment to the inner nuclear membrane (Shibuya et al., 2015). Both TRF1 and MAJIN localized to telomeres in Trip13-/- spermatocytes (Figure 4C and D). As expected, two TRF1 or two MAJIN foci were observed at split ends of chromosomes in Trip13-/- spermatocytes (Figure 4C and D). ANKRD31 and REC114 interact with each other and both localize to the pseudoautosomal region (PAR) of XY chromosomes in early pachytene spermatocytes to ensure XY recombination (Boekhout et al., 2019; Papanikos et al., 2019). In addition to two foci on autosomes, REC114 localized as one focus on the PAR in wild type pachytene spermatocytes. REC114 still formed foci (one per chromosome) on the unsynapsed X and Y chromosomes in Trip13-/- pachytene-like spermatocytes (Figure 4—figure supplement 1). Taken together, these results suggest that TRIP13 is not required for recruitment of these centromere or telomere proteins.

TRIP13 is required to evict HORMAD1 and HORMAD2 from synapsed autosomes

In wild type meiotic cells, HORMAD1 and HORMAD2 localize to unsynapsed and desynapsed chromosomes (Fukuda et al., 2010; Kogo et al., 2012a; Shin et al., 2010; Wojtasz et al., 2012). Thus, HORMAD1 and HORMAD2 localized to the largely unsynapsed XY but not to synapsed autosomal SCs in wild type cells (Figure 5A and B). TRIP13 is essential for removing meiotic HORMADs from the chromosome axes, a function that is conserved in yeast, worms, and mammals (Wojtasz et al., 2009). We confirmed that HORMAD1 and HORMAD2 remained on the synapsed autosomes in Trip13-/- pachytene cells (Figure 5A and B). HORMAD1 and HORMAD2 localize to the interior of the lateral elements in the SC (Xu et al., 2019). Confocal microscopy with super-resolution deconvolution revealed that HORMAD1 and HORMAD2 localized to the lateral elements of the synapsed autosomes in Trip13-/- spermatocytes (Figure 5C and D). These results were consistent with accumulation of HORMAD1/2 in Trip13 hypomorphic mutant spermatocytes (Roig et al., 2010; Wojtasz et al., 2009). Our analysis of Trip13-null mutant confirmed that TRIP13 is essential for HORMAD1/2 removal from the synapsed SCs.

Figure 5. HORMAD1 and HORMAD2 accumulate on the lateral elements of synapsed autosomes in Trip13-/- spermatocytes from juvenile (P19-21) mice.

(A, B) Immunofluorescence of HORMAD1 (A) and HORMAD2 (B) in pachytene spermatocytes. (C, D) Super-resolution imaging of HORMAD1 and HORMAD2 in zygotene and pachytene spermatocytes. Enlarged views of the boxed chromosomes are shown below. Scale bars: 10 µm (A, B), 5 µm (C, D).

Localization of TRIP13 to SC is independent of axial element components

TRIP13 localizes to the SC in early pachytene spermatocytes. We sought to address what proteins might recruit TRIP13 to the SC. We examined the role of HORMAD1, REC8, SYCP2, and SKP1 in TRIP13 localization in spermatocytes using respective knockout mice (Figure 6). We first examined the localization of TRIP13 in Hormad1-/- spermatocytes. Hormad1-/- spermatocytes exhibit limited synapsis (Daniel et al., 2011; Kogo et al., 2012b; Shin et al., 2010). In both wild type and Hormad1-/- cells, TRIP13 localized to the synapsed regions and to the telomeres (Figure 6A). This result shows that HORMAD1 is not required for localization of TRIP13 to the SC.

Figure 6. Localization of TRIP13 to the synaptonemal complex (SC) is independent of individual axial element components.

(A) Immunofluorescent analysis of TRIP13 in Hormad1-/- spermatocytes from 2-month-old mice. (B) Immunofluorescent analysis of TRIP13 in Rec8-/- spermatocytes from 2-month-old mice. (C) Immunofluorescent analysis of TRIP13 in Sycp2-/- spermatocytes from 2-month-old mice. (D) Immunofluorescent analysis of TRIP13 in Skp1cKO spermatocytes from 2-month-old mice. Scale bars, 10 µm.

REC8, a meiosis-specific cohesin, promotes synapsis between homologs and inhibits synapsis between sister chromatids (Xu et al., 2005). In the absence of REC8, synapsis occurs between sister chromatids rather than homologous chromosomes as previously shown by super-resolution imaging (Guan et al., 2020). In Rec8-/- spermatocytes, TRIP13 localized to synapsed sister chromatids (Figure 6B). To further probe TRIP13 recruitment to the SC, a mouse line expressing a truncated SYCP2 was used (Yang et al., 2006). SYCP2 and SYCP3 are essential components of the axial/lateral elements of the SC and interact with each other. The mutant used in this study (referred to as Sycp2-/-) expresses a truncated SYCP2 protein that lacks the C-terminal coiled-coil domain necessary for binding to SYCP3. Thus, SYCP3 failed to localize to the axial elements and formed aggregates in Sycp2-/- spermatocytes (Figure 6C). Nevertheless, Sycp2-/- spermatocytes formed short stretches of synapsis as previously demonstrated by electron microscopy and SYCP1 immunofluorescence (Yang et al., 2006). TRIP13 localized as filaments in Sycp2-/- spermatocytes, strongly suggesting that its localization is independent of SYCP3 and the C-terminus of SYCP2 (Figure 6C).

Previous work has shown that SKP1, a key component of the SKP1, Cullin, F-box (SCF) complex E3 ligase, is important for HORMAD removal and chromosomal synapsis (Guan et al., 2020; Guan et al., 2022). SKP1 localizes to synapsed regions in meiotic germ cells and specifically to the lateral elements in the SC (Guan et al., 2020). We found that TRIP13 still localized to the synapsed regions in Skp1cKO (conditional knockout) spermatocytes (Figure 6D). Taken together, these results show that the SC localization of TRIP13 is independent of HORMAD1, REC8, SYCP2, SYCP3, and SKP1, which all localize to the SC lateral elements. Such a finding is consistent with the localization of TRIP13 to the SC central region (Figure 1D).

FLAG-tagged TRIP13 proteins are functional

In order to investigate the mechanism of TRIP13 recruitment to the SC, we generated 3×FLAG-TRIP13 (N-terminal tag) and TRIP13−3×FLAG (C-terminal tag) mice through the CRISPR/Cas9-medidated genome editing approach (Figure 7—figure supplement 1). Two different types of tagged mice were generated in case one fusion protein was not functional. Both alleles were transmitted through the germline of the founder mice. Western blot showed that TRIP13 existed in two isoforms in wild type (non-tagged) testis (Figure 7A). The major TRIP13 isoform was 50 kDa. The minor isoform was slightly larger than 50 kDa. Western blot analysis showed that the FLAG-tagged TRIP13 fusion proteins were present in both FLAG-tagged testes. Both FLAG-tagged TRIP13 fusion proteins also existed in two isoforms in the homozygous testes, suggesting that they corresponded to the two wild type isoforms. The 3×FLAG-TRIP13 proteins were apparently slightly larger, possibly due to the linker in the N-terminally tagged proteins. The nature and physiological significance of these two isoforms were not clear, but could be due to alternative splicing or post-translational modification. Immunofluorescence analysis using anti-FLAG antibody showed that the FLAG-tagged TRIP13 proteins, like wild type TRIP13, localized to both telomeres and SC in pachytene spermatocytes from both FLAG/FLAG homozygous testes (Figure 7B). Importantly, both N- and C-terminally tagged homozygous mice were fertile. These results demonstrate that both N- and C-terminal tagged TRIP13 proteins localize normally and are functional.

Figure 7. FLAG-tagged TRIP13 proteins localize correctly and are functional.

(A) Western blot analysis of tagged and untagged TRIP13 proteins in testes from P20 wild type (no tag), heterozygous-tagged, and homozygous-tagged males. (B) Immunofluorescence of FLAG-tagged TRIP13 in pachytene spermatocytes from P20 homozygous testes. N-terminal tag, 3×FLAG-Trip13; C-terminal tag, Trip13−3×FLAG. Scale bar, 10 μm. (C) A schematic illustration of TRIP13, SKP1, HORMAD1/2, and the synaptonemal complex. Relative locations of TRIP13 and SKP1 within the synaptonemal complex (SC) are depicted. HORAMD1/2 are retained in synapsed regions in Trip13-deficient or Skp1-deficient spermatocytes.

Figure 7—source data 1. Original files of the full raw unedited western blots in Figure 7B.

Figure 7—figure supplement 1. Generation of two Trip13 FLAG-tagged mouse lines.

(A) Illustration of the Trip13 gene structure with the 3×FLAG tag at the N terminus. The guide RNA sequence is underlined in green. The single-strand DNA (ssDNA) oligo template (200 nt) contains the 3×FLAG-encoding sequence. The PAM site is underlined in purple. One base in the PAM site is mutated in the ssDNA oligo template to prevent cutting of the template strand (in purple). The position of 3×FLAG in-frame insertion is designated (^) and occurs just after the endogenous start codon. Filled bars, coding regions; Open bars, 5′ or 3′ UTRs. (B) Illustration of the Trip13 gene structure with the 3×FLAG tag at the C terminus. The PAM cut site and guide RNA were on the reverse strand, but for clarity, the forward strand sequence is shown. The 3×FLAG was inserted just before the endogenous stop codon.

To identify TRIP13-associated proteins in testis, we performed immunoprecipitation (IP) using 3×FLAG-TRIP13, TRIP13−3×FLAG, and wild type (no tag) testicular protein extracts with anti-FLAG monoclonal antibody. The immunoprecipitated proteins were eluted with FLAG peptides and subjected to mass spectrometry for protein identification. As expected, TRIP13 had more peptides in tagged TRIP13 IP than wild type (Table 1). HORMAD2, a known TRIP13 substrate protein, was also enriched in tagged TRIP13 IP (Table 1). Intriguingly, a large number of RNA-binding proteins involved in RNA splicing were highly enriched in tagged TRIP13 IP: DDX46, PUF60, RBM25, RBM39, U2AF1, U2AF2, and SRSF11 (Table 1). The biological relevance of these RNA-binding proteins to TRIP13 function remains unknown. We cannot exclude the possibility that the identification of these RNA splicing factors could be immunoprecipitation artifacts.

Table 1. List of proteins from testis identified by co-immunoprecipitation and mass spectrometry.

Protein	Number of peptides in anti-FLAG IP	MW (kDa)	
	3×FLAG-TRIP13 testis	TRIP13−3×FLAG testis	Wild type testis		
TRIP13	28	36	4	51	
HORMAD2	21	10	7	39	
DDX46	32	6	0	117	
PUF60	24	14	0	59	
RBM25	19	3	2	100	
RBM39	20	10	1	59	
U2AF1	11	4	1	28	
U2AF2	15	9	3	54	
SRSF11	9	4	0	53	
SPATA5	26	27	7	97	
AP3D1	17	6	2	135	
PRPF40A	16	3	0	108	
UGP2	15	3	0	57	

Discussion

TRIP13 and its ortholog Pch2 play an evolutionarily conserved role in the depletion of meiosis-specific HORMA domain proteins from the SC in many species, including yeast, plant, and mouse. In meiocytes, HORMA domain proteins are associated with unsynapsed chromosome axes and become depleted from the SC upon synapsis (Figure 7C). In mice with Trip13 hypomorphic gene trap alleles, HORMAD1 and HORMAD2 persist on the synapsed SCs at the pachytene stage (Wojtasz et al., 2009). In this study, we confirmed the abnormal persistence of HORMAD1 and HORMAD2 in Trip13-null spermatocytes (Figure 7C). In budding yeast, deficiency of Pch2 leads to the accumulation of Hop1 on the SC (Joshi et al., 2009; Subramanian et al., 2016). In Arabidopsis, Pch2 remodels the HORMA domain protein ASY1 (Balboni et al., 2020; Yang et al., 2020). Pch2 has been shown to localize to synapsed SC in budding yeast (Joshi et al., 2009), Caenorhabditis elegans (Deshong et al., 2014; Russo et al., 2023), Arabidopsis (Lambing et al., 2015), and rice (Miao et al., 2013), but not in mice. In mouse meiocytes, TRIP13 was known to localize to telomeres (Gómez-H et al., 2019). In addition to telomeres, we find that TRIP13 localizes to the SC in early pachytene spermatocytes in mice. In particular, TRIP13 localizes as a single filament between the SC lateral elements. Therefore, TRIP13/Pch2 and HORMA domain proteins have mutually exclusive localization patterns on the meiotic chromosome axes, providing an explanation for the depletion of HORMA domain proteins from the synapsed chromosomes in diverse organisms.

The transverse filaments (TFs) are essential for the recruitment of Pch2 to the SC. In a budding yeast Zip1 (encoding the TF component) allele with four amino acid substitutions, Pch2 is absent from the SC (Subramanian et al., 2016). In C. elegans, the TF component SYP-1 is essential for localization of Pch-2 on the paired chromosomes (Deshong et al., 2014). In rice, CRC1 (Pch2 ortholog) and CEP1 (TF protein) localize to the SC in an inter-dependent manner (Miao et al., 2013). In Arabidopsis, ZYP1 (TF component) recruits Pch2 to the SC (Yang et al., 2022). In the yeast two-hybrid assay, rice CRC1 interacts with CEP1, Arabidopsis ZYP1 interacts with Pch2, and mouse SYCP1 (TF protein) interacts with TRIP13 (Miao et al., 2013; Yang et al., 2022). Unlike in other species, loss of SYCP1 (TF protein) in mouse leads to a complete failure in chromosomal synapsis and thus its role in the recruitment of TRIP13 to the synapsed SC cannot be directly addressed (de Vries et al., 2005). Our findings on the localization of mouse TRIP13 to the SC on the sister chromatids in Rec8-deficient spermatocytes and the short SC stretches in Sycp2 mutant spermatocytes demonstrate that TRIP13 recruitment is independent of SC axial element proteins REC8 and SYCP2 but support the possibility that SYCP1 could recruit TRIP13 to the synapsed SC. These findings lead to the following model: the TF protein recruits Pch2/TRIP13 to the SC upon synapsis, which in turn evicts HORMA domain proteins from the synapsed regions (Figure 7C).

Both TRIP13 and SKP1 are required for the removal of HORMA domain proteins from the synapsed SC (Guan et al., 2020; Wojtasz et al., 2009). However, the relationship of TRIP13 and SKP1 is unknown. SKP1 localizes to the synapsed SC more extensively than TRIP13. While TRIP13 is only detected on the synapsed SC in early pachytene spermatocytes (Figure 1), SKP1 localizes to the synapsed SC in zygotene, all stages of pachytene, and diplotene spermatocytes (Guan et al., 2020). The localization of TRIP13 and SKP1 within the SC is different: TRIP13 is on CE/TF regions but SKP1 on LEs. While the global level of TRIP13 is reduced in Skp1-deficient testes, the localization of TRIP13 and SKP1 to the synapsed SC is independent (Figure 6D; Guan et al., 2020). The SCF ubiquitin E3 ligase complex targets HORMAD1 for ubiquitination and degradation in transfected HEK293T cells (Guan et al., 2022). Loss of TRIP13 leads to the accumulation of HORMAD proteins only to the synapsed SC in pachytene cells. In contrast, depletion of SKP1 causes accumulation of HORMA domain proteins, particularly HORMAD1, on both unsynapsed and synapsed chromosome axes from leptotene through diplotene meiocytes. Therefore, TRIP13 and SKP1 might regulate different pools of HORMAD proteins in meiocytes (Figure 7C).

In many organisms, including mouse and human, centromeres are the last regions to synapse (Bisig et al., 2012; Brown et al., 2005; Qiao et al., 2012). The reason for this is unknown, but it might be related to the necessity to suppress deleterious non-homologous recombination at centromere and pericentromeric regions, which consist of minor and major satellite repeats, respectively. The centromere was proposed to exert an inhibitory effect on synapsis in human cells (Brown et al., 2005). The inhibition needs to be relieved to achieve full synapsis since unsynapsis at centromeres is expected to trigger the meiotic checkpoint, leading to meiotic arrest. To date, only two mouse mutants (Skp1 and Trip13) exhibit unsynapsis preferentially at the centromeric end in pachytene-like cells. In addition, only these two mouse mutants display abnormal accumulation of HORMAD proteins on the synapsed SC. Intriguingly, TRIP13 localizes to telomeres in both spermatocytes and oocytes. The centromere is close to one of the telomeres in mouse. Thus, the preferential centromeric end asynapsis in Trip13 or Skp1-deficient meiocytes could be related to the abnormal persistence of HORMAD proteins. However, the underlying molecular mechanism warrants further investigation.

We find that TRIP13 is a dosage-dependent regulator of meiosis. The Trip13+/- mice displayed reduced testis weight, reduced sperm count, and meiotic defects but these defects were less severe than the Trip13-/- mice. The disease phenotypes in humans also appear to be influenced by the TRIP13 dosage (Yost et al., 2017; Zhang et al., 2020). The dosage-dependent phenotypic variation has been reported in other mouse meiotic mutants such as Tex11, Meiob, and Rnf212. TEX11 localizes to meiotic chromosomes as foci and regulates crossover formation and chromosome synapsis (Yang et al., 2008). The TEX11 protein levels correlate with genome-wide recombination rates in mice (Yang et al., 2015). MEIOB, a meiosis-specific ssDNA-binding protein, is essential for meiotic recombination (Luo et al., 2013; Souquet et al., 2013). In mice with different combinations of Meiob alleles, MEIOB protein levels directly correlate with the severity of meiotic defects (Guo et al., 2020). Sequence variants in human RNF212 are associated with variations in genome-wide recombination rates (Chowdhury et al., 2009; Kong et al., 2008). In mouse, RNF212 forms foci on meiotic chromosomes and regulates crossover formation in a dosage-dependent manner (Reynolds et al., 2013). Therefore, dosage sensitivity appears to be a common feature of many regulators of meiosis.

Materials and methods

Key resources table Reagent type (species) or resource	Designation	Source or reference	Identifiers	Additional information	
Gene (Mus musculus)	Trip13	GenBank	Gene ID: 69716		
Genetic reagent (M. musculus)	Trip13 tm1.1(KOMP)Vlcg/JMmucd	MMRCC	MMRRC_050223-UCD		
Genetic reagent (M. musculus)	Hormad1 knockout	PMID:21079677; Shin et al., 2010		Rajkovic lab	
Genetic reagent (M. musculus)	Sycp2 knockout	PMID:16717126; Yang et al., 2006		Wang lab	
Genetic reagent (M. musculus)	Rec8 knockout	PMID:32232159; Guan et al., 2020		Wang lab	
Genetic reagent (M. musculus)	3×FLAG-Trip13	This paper		Wang Lab	
Genetic reagent (M. musculus)	Trip13-3×FLAG	This paper		Wang Lab	
Antibody	Anti-ACTB (mouse monoclonal)	Sigma	Cat# A5441, RRID:AB_476744	WB (1:2000)	
Antibody	Anti-centromere (CREST) (human polyclonal)	Antibodies Incorporated	Cat# 15-234, RRID:AB_2687472	IF (1:500)	
Antibody	Anti-SYCP1 (rabbit polyclonal)	Abcam	Cat# ab15090, RRID:AB_301636	IF (1:300)	
Antibody	Anti-SYCP2 (guinea pig polyclonal)	PMID:16717126	Custom made	IF (1:150)	
Antibody	Anti-SYCP3 (mouse monoclonal)	Abcam	Cat# ab97672, RRID:AB_10678841	IF (1:500)	
Antibody	Anti-SYCP3 (rabbit polyclonal)	ProteinTech Group	Cat# 23024-1-AP, RRID:AB_11232426	IF (1:500), WB (1:2000)	
Antibody	Anti-HORMAD1 (rabbit polyclonal)	ProteinTech Group	Cat# 13917-1-AP, RRID:AB_2120844	IF (1:300)	
Antibody	Anti-HORMAD2 (rabbit polyclonal)	PMID:19851446; Wojtasz et al., 2009	A gift from Toth lab	IF (1:500)	
Antibody	Anti-REC114 (rabbit polyclonal)	PMID:31003867; Boekhout et al., 2019	A gift from Keeney Lab	IF (1:100)	
Antibody	Anti-REC8 (rabbit polyclonal)	Custom made	A gift from Mengcheng Luo lab	IF (1:200)	
Antibody	Anti-FLAG (mouse monoclonal)	Sigma	Cat# F3165, RRID:AB_259529	IF (1:300), WB (1:4000)	
Antibody	Anti-SKP1 (rabbit polyclonal)	Cell Signaling	Cat# 12248S, RRID:AB_2754993	IF (1:200), WB (1:1000)	
Antibody	Anti-TRIP13 (rabbit polyclonal)	ProteinTech Group	Cat# 19602-1-AP	IF (1:150), WB (1:1000)	
Antibody	Anti-SYCE1 (rabbit polyclonal)	Custom made	A gift from Mengcheng Luo lab	IF (1:200), WB (1:1000)	
Antibody	Anti-SYCP1 (mouse monoclonal)	Custom made	A gift from Christer Hoog lab	IF (1:200), WB (1:1000)	
Antibody	Anti-CENP-C (rabbit polyclonal)	PMID:25533956; Kim et al., 2015	A gift from Y. Watanabe lab	IF (1:500)	
Antibody	Anti-TRF1 (mouse monoclonal)	Sigma	Cat# T1948	IF (1:100)	
Antibody	Anti-MAJIN (guinea pig polyclonal)	This paper	Custom made	IF (1:100)	

Materials availability statement

Newly created materials (3×FLAG-Trip13 and Trip13-3×FLAG mice) are freely available, subject to standard institutional material transfer agreement.

Mouse strains

The cryopreserved sperm from Trip13+/- males were obtained from the Mutant Mouse Resource and Research Center at UC Davis (Trip13tm1.1(KOMP)Vlcg/JMmucd, MMRRC_050223-UCD). Genotyping of wild type and knockout Trip13 alleles was performed by separate PCR reactions using tail genomic DNA. Other mutant mouse lines used in this study were previously generated: Hormad1, Sycp2, and Rec8 (Guan et al., 2020; Shin et al., 2010; Yang et al., 2006). Genotyping PCR primer sequences are listed in Table 2.

Table 2. Sequences of genotyping PCR primers, sgRNA, and ssDNA templates.

Genotyping primers				
Allele	Forward	Reverse	Product (bp)	
Trip13 WT	GCCCTTAGCCAAGGTGGAT	TCCTTGCACCCCTAATTGAC	645	
Trip13 KO	ACTTGCTTTAAAAAACCTCCCACA	CAGAAAGCAACTGCTCCCTTCTAGC	731	
Sycp2 WT	AGATGAGGGCATATCACCGA	TAAGCACACTCACCATCTCC	400	
Sycp2 KO	GCATGTTATCAACCTTATCCCT	CCTACCGGTGGATGTGGAATGTGTG	300	
Rec8 WT	AGCAGAGTCGAAGAAGGCCTCTTG	CAGATGGTGGCGAAGCAGCCTGT	426	
Rec8 KO	AGCAGAGTCGAAGAAGGCCTCTTG	TTGCTCAGGGGAATTTGGGTC	212	
Hormad1 WT	TCAAGACCAACCTGGGCTAC	CCATGTGGGTTGTAGGGAGT	196	
Hormad1 KO	TCAAGACCAACCTGGGCTAC	GGGGAACTTCCTGACTAGGG	~400	
3×FLAG-Trip13	CCTACATCGGAGAAGGCTGT	TTCATGTCAGGCTGTTCAGG	WT:348
KI:426	
Trip13-3×FLAG	GCCCCACTAAAGCACAAGTC	ACAGGCTTGAGTCAGGATGG	WT:405
KI:471	
Genome editing				
	Guide RNA	HDR ssDNA	
3×FLAG-Trip13	ATTCCCTCGGCTCCCGGCGG	TCGGAGAAGGCTGTCGCACAGGGCGCAGGGA
GGCGACCGCGGCCTCACTCCGGCGGCATTCC
CTCGGCTCCCGGCGGCAGCGCCATGGGTGAC
TACAAAGACCATGACGGTGATTATAAAGATCATG
ACATCGATTACAAGGATGACGATGACAAGGGAA
GCGGAGACGAGGCGGTGGGCGACCTGAAGCAAGCGCTTCC	
Trip13-3×FLAG	AAGCCATAGATATGGATGTC	AGGGTTTCCTCCAGGCCCTATCTCTGGCAGTGGAC
AAACAGTTTGAGGAGAAAAAGAAACTTTCAGCTTAT
GTTGACTACAAAGACCATGACGGTGATTATAAAGATC
ATGACATCGATTACAAGGATGACGATGACAAGTGATC
CAAGACATCCATATCTATGGCTTTCAATGGACAAGTAGGAGGTGATACCGTCTAC	

Generation of 3×FLAG-Trip13 and Trip13-3×FLAG knockin mouse strains

The 3×FLAG-knockin mouse strains were generated using the CRISPR-Cas9-mediated genome editing approach. To generate N-terminally tagged knockin mice, one single-guide RNA (sgRNA) was designed to target the first exon of the mouse Trip13 (Figure 7—figure supplement 1A). An ssDNA repair template was created using the sequence surrounding the start codon as 5′ and 3′ homology arms. The knockin template itself included the sequence for the 3×FLAG epitope and a three-residue linker sequence. The C-terminally tagged strain was generated similarly (Figure 7—figure supplement 1B). The guide RNA targeted exon 13 containing the stop codon. The ssDNA template contained the FLAG-encoding sequences and homology sequences flanking the insertion site. The sgRNA sequences and ssDNA template sequences are shown in Table 2.

For the sgRNA, the oligo was phosphorylated, annealed, and cloned to PX330 plasmid (Addgene, Waterton, MA). After in vitro transcription with the MEGAshortscript T7 Kit (AM1354, Invitrogen) and purification with the MEGAclear Transcription Clean-Up Kit (AM1908, Invitrogen), a mixture of Cas9 mRNA (100 ng/µl; Trilink, Cat# L-7206 + 0.5 µl of the sgRNA [35 ng/µl] + 100 ng/ul of ssDNA template) was prepared and injected into zygotes. The injected zygotes were cultured in KSOM medium at 37°C in a 5% CO2 incubator until the two-cell stage. The two-cell embryos were transferred into oviducts of 0.5-day post-coitum pseudopregnant ICR foster mothers. Founder mice were bred to wild type mice to obtain germline transmission. The N-terminal 3×FLAG allele and the C-terminal 3×FLAG allele were PCR amplified and sequenced to confirm the insertion. PCR genotyping primers are listed in Table 2.

Production of anti-MAJIN antibodies

The short isoform of mouse MAJIN (amino acids 1–124; XM_036161650.1 and XP_036017543.1) was expressed as a 6xHis-MAJIN recombinant protein in Escherichia coli using the pQE-30 vector. The recombinant protein was affinity purified with the Ni-NTA agarose. Two guinea pigs were immunized at Cocalico Biologicals Inc (Reamstown, PA), resulting in two antisera (UP-GP140 and UP-GP141). Both anti-sera were used for immunofluorescence of nuclear spreads of spermatocytes.

Histological, immunofluorescence, and surface nuclear spread analyses

For histology, testes or ovaries were fixed in Bouin’s solution at room temperature overnight, embedded with paraffin, and sectioned at 8 μm. Sections were stained with hematoxylin and eosin. For immunofluorescence analysis, testes were fixed in 4% paraformaldehyde (in 1× PBS) overnight at 4°C, dehydrated in 30% sucrose (in 1× PBS) overnight, and sectioned at 8 μm in a cryostat. Surface nuclear spread analysis was described before (Peters et al., 1997). Briefly, testicular tubules or ovarian tissues were soaked in hypotonic treatment buffer (30 mM Tris, 50 mM sucrose, 17 mM trisodium citrate dihydrate, 5 mM EDTA, 0.5 mM DTT, 1 mM PMSF). Then the cells were suspended in 100 mM sucrose and spread by physical disruption on PTFE printed slides that were previously soaked with paraformaldehyde solution containing Triton X-100 and sodium borate.

Imaging

Histological images were captured on the Leica DM5500B microscope with a DFC450 digital camera (Leica Microsystems, Wetzlar, Germany). Most immunolabeled chromosome spread images were taken on the Leica DM5500B microscope with an ORCA Flash4.0 digital monochrome camera (Hamamatsu Photonics, Bridgewater, NJ). Confocal microscopy of immunolabeled chromosome spreads was performed on a Leica SP5 II confocal (Leica Microsystems) with an ×100 (1.46 NA) oil immersion objective lens. Images were deconvolved with Huygens Essential deconvolution software (Scientific Volume Imaging B.V., Hilversum, Netherlands).

Western blot analysis

Testes were homogenized in the lysis buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 1% Triton X-100, 0.5% sodium deoxycholate, 5 mM MgCl2, and 1 mM DTT supplemented with 1 mM PMSF). 40 μg of protein samples were resolved by SDS-PAGE, transferred onto PDVF membranes, and immunoblotted with primary antibodies.

Funding Information

This paper was supported by the following grants:

http://dx.doi.org/10.13039/100009633 Eunice Kennedy Shriver National Institute of Child Health and Human Development T32HD083185 to Jessica Y Chotiner.

http://dx.doi.org/10.13039/100000057 National Institute of General Medical Sciences R35GM153384 to P Jeremy Wang.

Acknowledgements

We thank Gordon Ruthel at the PennVet Imaging Core for help with super-resolution microscopy, Hsin Yao Tang and Thomas Beer at Wistar Proteomics Core for help with mass spectrometry, Christer Hoog for SYCP1 antibody, Attila Toth for HORMAD2 antibody, Scott Keeney for anti-REC114 antibody, Mengcheng Luo for REC8 and SYCE1 antibodies, and Yoshinori Watanabe and Takashi Akera for CENP-C antibody.This work was supported by the National Institutes of Health/National Institute of Child Health and Human Development grants T32HD083185 (JYC) and National Institutes of Health/National Institute of General Medical Sciences R35GM153384 (PJW).

Additional information

Competing interests

Author contributions

Ethics

Additional files

MDAR checklist

Data availability

All data generated or analysed during this study are included in the manuscript and supporting files.

10.7554/eLife.92195.3.sa0
eLife assessment
Yan Wei Reviewing Editor The Lundquist Institute United States

Convincing
Important
This important study defined the physiological function of a conserved meiosis factor during murine spermatogenesis. The genetic and cellular biological evidence supporting the conclusion is convincing. This work will be of broad interest to cell biologists, geneticists, and reproductive biologists.

10.7554/eLife.92195.3.sa1
Reviewer #1 (Public Review):
Reviewer
Summary:

TRIP13/Pch2 is a conserved essential regulator of meiotic recombination from yeast to humans. In this manuscript, the authors generated TRIP13 null mice and Flag-tagged TRIP13 knock-in mice to study its role in meiosis. They demonstrate that TRIP13 regulates MORMA domain proteins and is essential for meiotic completion and fertility. The main impact of this manuscript is its clarification of the in vivo function of TRIP13 during mouse meiosis and previously unrecognized role as a dose-sensitive regulator of meiosis.

Strengths:

Two previously reported Trip13 mutations in mice are both hypomorphic alleles with distinct phenotypes, precluding a conclusion on its function. This study for the first time generated the TRIP13 null mice, definitively revealed the function of TRIP13 in meiosis. The authors also show novel localization of TRIP13 at SC and its independence from the axial element components. The finding of dose-sensitive regulation of meiosis by TRIP13 has implication in understanding human meiosis and disease phenotypes.

The results support the main conclusions and advance the understand of meiosis in the germline.

10.7554/eLife.92195.3.sa2
Reviewer #2 (Public Review):
Reviewer
Summary and Strengths:

In this manuscript, Chotiner and colleagues demonstrated the localization of TRIP13 and clarified the phenotypes of Trip13-null mice in mouse meiosis. The meiotic phenotypes of Trip13 have been well characterized using the hypomorph alleles in the literature. However, the null phenotypes have not been examined, and the localization of TRIP13 was not clearly demonstrated. The study fills these important knowledge gaps in the field. The demonstration of TRIP13 localization to SC in mice provides an explanation of how HOMRA domain proteins are evicted from SC in diverse organisms. This conclusion was confirmed in both IF and TRIP13-tagged Tg mice. Further, the phenotypes of Trip13-null mice are very clear. The manuscript is well crafted, and the discussion section is well organized and comprehends the topic in the field. All in all, the manuscript will provide important knowledge in the field of meiosis.

Weaknesses:

The heterozygous phenotypes demonstrate that TRIP13 is a dosage-sensitive regulator of meiosis. In relation to this conclusion, as summarized in the discussion section, other mutants defective in meiotic recombination showed dosage-sensitive phenotypes. However, the authors did not examine meiotic recombination in the Trip13-null mice.

10.7554/eLife.92195.3.sa3
Author response
Chotiner Jessica Y Author University of Pennsylvania Philadelphia United States

Leu Nicolae Adrian Author University of Pennsylvania Philadelphia United States

Yang Fang Author University of Pennsylvania Philadelphia United States

Cossu Isabella G Author University of Pennsylvania School of Veterinary Medicine Philadelphia United States

Guan Yongjuan Author University of Pennsylvania Philadelphia United States

Lin Huijuan Author University of Pennsylvania Philadelphia United States

Wang P Jeremy Author University of Pennsylvania Philadelphia United States

The following is the authors’ response to the original reviews.

Public Reviews:

Reviewer #1 (Public Review):

Summary:

TRIP13/Pch2 is a conserved essential regulator of meiotic recombination from yeast to humans. In this manuscript, the authors generated TRIP13 null mice and Flag-tagged TRIP13 knock-in mice to study its role in meiosis. They demonstrate that TRIP13 regulates MORMA domain proteins and is essential for meiotic completion and fertility. The main impact of this manuscript is its clarification of the in vivo function of TRIP13 during mouse meiosis and its previously unrecognized role as a dose-sensitive regulator of meiosis.

Strengths:

Two previously reported Trip13 mutations in mice are both hypomorphic alleles with distinct phenotypes, precluding a conclusion on its function. This study for the first time generated the TRIP13 null mice, definitively revealing the function of TRIP13 in meiosis. The authors also show the novel localization of TRIP13 at SC and its independence from the axial element components. The finding of dose-sensitive regulation of meiosis by TRIP13 has implications in understanding human meiosis and disease phenotypes.

Weaknesses:

This manuscript would be more impactful if more mechanistic advancements could be made. For example, the authors could follow up with one of the new interactors identified by MS to offer new insight into the molecular function of TRIP13.

We agree that it would be interesting to follow up on new candidate interactors but think that it would be more feasible to follow up on them in future studies.

Reviewer #2 (Public Review):

Summary and Strengths:

In this manuscript, Chotiner and colleagues demonstrated the localization of TRIP13 and clarified the phenotypes of Trip13-null mice in mouse meiosis. The meiotic phenotypes of Trip13 have been well characterized using the hypomorph alleles in the literature. However, the null phenotypes have not been examined, and the localization of TRIP13 was not clearly demonstrated. The study fills these important knowledge gaps in the field. The demonstration of TRIP13 localization to SC in mice provides an explanation of how HOMRA domain proteins are evicted from SC in diverse organisms. This conclusion was confirmed in both IF and TRIP13-tagged Tg mice. Further, the phenotypes of Trip13-null mice are very clear. The manuscript is well crafted, and the discussion section is well organized and comprehends the topic in the field. All in all, the manuscript will provide important knowledge in the field of meiosis.

Weaknesses:

The heterozygous phenotypes demonstrate that TRIP13 is a dosage-sensitive regulator of meiosis. In relation to this conclusion, as summarized in the discussion section, other mutants defective in meiotic recombination showed dosage-sensitive phenotypes. However, the authors did not examine meiotic recombination in the Trip13-null mice.

Meiotic recombination was extensively characterized in Trip13 severe hypomorph mutants in two previous studies: gamma-H2AX, BLM, BRCA1, ATR, RPA, RAD51, DMC1, MLH1 (Li and Schimenti, 2007; Roig et al., 2010). All the meiotic defects in our Trip13-null mice were also present in Trip13 severe hypermorph mutants: meiotic arrest, defects in chromosomal synapsis, asynapsis at chromosomal ends, and accumulation of HORMAD1/2 on the SC axis. Therefore, the defects in meiotic recombination in Trip13-null mice are expected to be similar to those in Trip13 severe hypermorph mutants and thus we did not examine the proteins involved in meiotic recombination in the Trip13-null mutant.

Reviewer #3 (Public Review):

Summary:

The authors perform a thorough examination of the phenotypes of a newly generated Trip13 null allele in mice, noting defects in chromosome synapsis and impact on localization of other key proteins (namely HORMADs) on meiotic chromosomes. The vast majority of data confirms observations of several prior studies of Trip13 alleles (moderate and severe hypomorphs). The original or primary aims of the study aren't clear, but it can be assumed that the authors wanted to better study the role of this protein in evicting HORMADs upon synapsis by studying phenotypes of mutants and better characterizing TRIP13 localization data (which they find localizes to the central element of synapsed chromosomes using a new epitope-tagged allele). Their data confirm prior reports and are consistent with localization data of the orthologous Pch2 protein in many other organisms.

Strengths:

The quality of data is high. Probably the most important data the authors find is that TRIP13 is localized along the CE of synapsed chromosomes. However, this was not unexpected because PCH2 is also similarly localized. Also, the authors use a clear null (deletion allele), whereas prior studies used hypomorphs.

Weaknesses:

There is limited new data; most are confirmatory or expected (i.e., SC localization), and thus the impact of this report is not high. The claim that TRIP13 "functions as a dosage-sensitive regulator of meiosis" is exaggerated in my opinion. Indeed, the authors make the observation that hets have a phenotype, but numerous genes have haploinsufficient phenotypes. In my opinion, it is a leap to extrapolate this to infer that TRIP13 is a "regulator" of meiosis. What is the definition of a meiosis regulator? Is it at the apex of the meiosis process, or is it a crucial cog of any aspect of meiosis?

TRIP13 is not haploinsufficient, as Trip13 heterozygotes were still viable and fertile (albeit with defects in meiosis). TRIP13 is an ATPase and changes the conformation of meiosis-specific proteins such as HORMAD proteins. TRIP13 is essential for meiosis and its mutations cause defects in both meiotic recombination and chromosomal synapsis. Reviewer 1 stated that “TRIP13/Pch2 is a conserved essential regulator of meiotic recombination from yeast to humans”. Therefore, we feel that TRIP13 can be called a regulator of meiosis.

Reviewer #1 (Recommendations For The Authors):

A schematic illustration of SC structure, the components involved, and the main finding, would be helpful for readers to better understand the advancement made by this study.

We have now added a schematic illustration in a new panel - Figure 7C.

Fig. 1B, the stage with diplotene cells should be XII.

The pachytene cells (Pac) were mis-labelled as diplotene cells. Corrected.

Fig. 1C, color mislabeled.

Corrected.

Reviewer #2 (Recommendations For The Authors):

The manuscript will provide important knowledge in the field of meiosis. I support the publication of this study. I have some suggestions to improve and polish the manuscript.

Major points:

(1) The heterozygous phenotypes demonstrate that TRIP13 is a dosage-sensitive regulator of meiosis. In relation to this conclusion, as summarized in the discussion section, other mutants defective in meiotic recombination showed dosage-sensitive phenotypes. Given the function of HORMAD1 in meiotic recombination, it would be informative if the authors could examine how major makers of meiotic recombination behave in Trip13-null meiosis.

Please see our response to Weaknesses from Reviewer #2.

(2) Relating to the above point, the complete lack of synapsis on the sex chromosomes in the Trip13-null meiosis is impressive. This result raises a question as to whether the pathway to designate XY-obligatory crossover (which can be detected with large foci of ANKRD31 and MEI4/REC114 at PAR) is affected or not. It would be interesting to examine whether the ANKRD31 and MEI4/REC114 foci are present on PAR in Trip13-null meiosis.

We have performed immunofluorescent analysis of REC114 in spermatocytes. In Trip13-null pachytene-like spermatocytes, X and Y chromosomes are not synapsed. REC114 still formed one focus each on the unsynapsed X and Y chromosomes. We have added this new data in the Results as a new supplementary figure (Figure 4 -supplement 1).

(3) Figure 4 can be improved if there are quantified data for each phenotype. These phenotypes look nearly complete, but it would be informative to show the penetrance of these phenotypes.

Because some chromosomes have unsynapsed ends, resulting in two centromere or telomere foci, the total number of centromere or telomere foci is always higher in Trip13-null pachytene-like spermatocytes than wild type pachytene spermatocytes. Therefore, we did not count the foci of centromeres and telomeres. Consistently, the centromere and telomere markers localized as expected in both wild type and Trip13-null spermatocytes.

(4) I am not fully convinced by these photos: "synapsed sister chromatids (Figure 6B)" and "Sycp2-/- spermatocytes formed short stretches of synapsis (Figure 6C)". The authors may try confocal microscopy with super-resolution deconvolution as they did for other data.

These have been previously demonstrated. The “synapsed sister chromatids (Figure 6B)” were previously demonstrated by confocal microscopy with super-resolution deconvolution (Guan et al., 2020). The short stretches of synapsis in Sycp2-/- spermatocytes was previously demonstrated by electron microscopy (Tripartite SC structure) and SYCP1 immunofluorescence (Yang et al., 2006). We have revised the text by citing the previous evidence and the publications.

Minor points:

(1) Line 19-21: "Loss of TRIP13 leads to meiotic arrest and thus sterility in both sexes. Trip13-null meiocytes exhibit abnormal persistence of HORMAD1 and HOMRAD2 on synapsed SC". These findings confirm the previously reported phenotypes of the Trip13 hypomorph alleles. This information can be added to the abstract. Otherwise, it sounds like these are totally new findings, as written.

This information is now added to the abstract: “These findings confirm the previously reported phenotypes of the Trip13 hypomorph alleles.”

(2) The introduction section seems too long and contains unnecessary information. Some molecular details that are not touched in the result section can be deleted (e.g., Line 65-73).

We would like to keep the molecular details on the two conformation states, as it provides biochemical background on TRIP13-HORMAD interactions.

(3) Introduction, Line 92. A rationale can be added as to why the authors characterized the Trip13-null allele.

a rationale has been added as follows: “To determine the effect of complete loss of TRIP13, we characterized Trip13-null mice.”

(4) Line 205: Typo "TRRIP13".Corrected.

Reviewer #3 (Recommendations For The Authors):

Just a few recommendations:

(1) In my opinion, the title is an overreach. "Regulator" invokes other concepts such as transcription factors.

Please see our explanation in response to weaknesses from Reviewer #3.

(2) The first sentence of the results deals with TRIP13 expression in only 3 tissues. The authors might look at more comprehensive RNA-seq data from mice and humans.

We examined TRIP13 protein expression in 8 mouse tissues by WB and found that TRIP13 protein was abundant in testis but present at a very low level in ovary and liver (Figure 1A). We feel that readers can easily look up the relative transcript levels of Trip13 in more tissues from mice and humans from NCBI database under “Gene”.

(3) The null allele is semi-lethal. Is body size affected? Were the mice abnormal in any other ways, given that TRIP13 has been implicated in other diseases and processes, and is expressed in other tissues (TRIP13 stands for Thyroid receptor interacting protein).

The body weight of 2-3 month-old males was not significantly different between wild type (24.3±2.8 g, n=5) and Trip13 KO mice (22.8±1.7 g, n=5, p=0.3, Student’s t-Test). We have included the body weight information in the revised manuscript. We didn’t observe abnormal somatic defects in the viable Trip13-null mice, nor did the authors report any in the Trip13 hypomorph mutants in two previous studies (Li and Schimenti, 2007; Roig et al., 2010).

(4) Line 276 : It would be nice to elaborate on the "spatial explanation."

We meant that TRIP13 localizes to SC while HORMAD proteins are removed from SC upon chromosomal synapsis, thus providing a spatial explanation. However, we have now deleted “spatial”.

No competing interests declared.

Conceptualization, Formal analysis, Funding acquisition, Validation, Investigation, Visualization, Methodology, Writing – original draft.

Methodology.

Investigation.

Investigation.

Resources, Investigation.

Resources, Investigation.

Conceptualization, Formal analysis, Supervision, Funding acquisition, Writing – original draft, Project administration, Writing – review and editing.

Mice were maintained and used for experimentation according to the protocol (IACUC 804421) approved by the Institutional Animal Care and Use Committee of the University of Pennsylvania.
==== Refs
References

Balboni M Yang C Komaki S Brun J Schnittger A 2020 COMET Functions as a PCH2 Cofactor in Regulating the HORMA Domain Protein ASY1 Current Biology 30 4113 4127 10.1016/j.cub.2020.07.089 32857973
Bisig CG Guiraldelli MF Kouznetsova A Scherthan H Höög C Dawson DS Pezza RJ 2012 Synaptonemal complex components persist at centromeres and are required for homologous centromere pairing in mouse spermatocytes PLOS Genetics 8 e1002701 10.1371/journal.pgen.1002701 22761579
Boekhout M Karasu ME Wang J Acquaviva L Pratto F Brick K Eng DY Xu J Camerini-Otero RD Patel DJ Keeney S 2019 REC114 Partner ANKRD31 Controls Number, Timing, and Location of Meiotic DNA Breaks Molecular Cell 74 1053 1068 10.1016/j.molcel.2019.03.023 31003867
Brown PW Judis L Chan ER Schwartz S Seftel A Thomas A Hassold TJ 2005 Meiotic synapsis proceeds from a limited number of subtelomeric sites in the human male American Journal of Human Genetics 77 556 566 10.1086/468188 16175502
Chen C Jomaa A Ortega J Alani EE 2014 Pch2 is a hexameric ring ATPase that remodels the chromosome axis protein Hop1 PNAS 111 E44 E53 10.1073/pnas.1310755111 24367111
Chowdhury R Bois PRJ Feingold E Sherman SL Cheung VG 2009 Genetic analysis of variation in human meiotic recombination PLOS Genetics 5 e1000648 10.1371/journal.pgen.1000648 19763160
Cossu IG Leu NA Guan Y Wang PJ 2024 The N-terminal modification of HORMAD2 causes its ectopic persistence on synapsed chromosomes without meiotic blockade Reproduction 167 e230330 10.1530/REP-23-0330 38401263
Daniel K Lange J Hached K Fu J Anastassiadis K Roig I Cooke HJ Stewart AF Wassmann K Jasin M Keeney S Tóth A 2011 Meiotic homologue alignment and its quality surveillance are controlled by mouse HORMAD1 Nature Cell Biology 13 599 610 10.1038/ncb2213 21478856
Deshong AJ Ye AL Lamelza P Bhalla N 2014 A quality control mechanism coordinates meiotic prophase events to promote crossover assurance PLOS Genetics 10 e1004291 10.1371/journal.pgen.1004291 24762417
de Vries FAT de Boer E van den Bosch M Baarends WM Ooms M Yuan L Liu J-G van Zeeland AA Heyting C Pastink A 2005 MouseSycp1functions in synaptonemal complex assembly, meiotic recombination, and XY body formation Genes & Development 19 1376 1389 10.1101/gad.329705 15937223
Fukuda T Daniel K Wojtasz L Toth A Höög C 2010 A novel mammalian HORMA domain-containing protein, HORMAD1, preferentially associates with unsynapsed meiotic chromosomes Experimental Cell Research 316 158 171 10.1016/j.yexcr.2009.08.007 19686734
Gómez-H L Felipe-Medina N Condezo YB Garcia-Valiente R Ramos I Suja JA Barbero JL Roig I Sánchez-Martín M de Rooij DG Llano E Pendas AM 2019 The PSMA8 subunit of the spermatoproteasome is essential for proper meiotic exit and mouse fertility PLOS Genetics 15 e1008316 10.1371/journal.pgen.1008316 31437213
Guan Y Leu NA Ma J Chmátal L Ruthel G Bloom JC Lampson MA Schimenti JC Luo M Wang PJ 2020 SKP1 drives the prophase I to metaphase I transition during male meiosis Science Advances 6 eaaz2129 10.1126/sciadv.aaz2129 32232159
Guan Y Lin H Leu NA Ruthel G Fuchs SY Busino L Luo M Wang PJ 2022 SCF ubiquitin E3 ligase regulates DNA double-strand breaks in early meiotic recombination Nucleic Acids Research 50 5129 5144 10.1093/nar/gkac304 35489071
Guo R Xu Y Leu NA Zhang L Fuchs SY Ye L Wang PJ 2020 The ssDNA-binding protein MEIOB acts as a dosage-sensitive regulator of meiotic recombination Nucleic Acids Research 48 12219 12233 10.1093/nar/gkaa1016 33166385
Handel MA Schimenti JC 2010 Genetics of mammalian meiosis: regulation, dynamics and impact on fertility Nature Reviews. Genetics 11 124 136 10.1038/nrg2723 20051984
Herruzo E Ontoso D González-Arranz S Cavero S Lechuga A San-Segundo PA 2016 The Pch2 AAA+ ATPase promotes phosphorylation of the Hop1 meiotic checkpoint adaptor in response to synaptonemal complex defects Nucleic Acids Research 44 7722 7741 10.1093/nar/gkw506 27257060
Herruzo E Lago-Maciel A Baztán S Santos B Carballo JA San-Segundo PA 2021 Pch2 orchestrates the meiotic recombination checkpoint from the cytoplasm PLOS Genetics 17 e1009560 10.1371/journal.pgen.1009560 34260586
Hunter N 2015 Meiotic recombination: The essence of heredity Cold Spring Harbor Perspectives in Biology 7 a016618 10.1101/cshperspect.a016618 26511629
Joshi N Barot A Jamison C Börner GV 2009 Pch2 links chromosome axis remodeling at future crossover sites and crossover distribution during yeast meiosis PLOS Genetics 5 e1000557 10.1371/journal.pgen.1000557 19629172
Karlseder J Kachatrian L Takai H Mercer K Hingorani S Jacks T de Lange T 2003 Targeted deletion reveals an essential function for the telomere length regulator Trf1 Molecular and Cellular Biology 23 6533 6541 10.1128/MCB.23.18.6533-6541.2003 12944479
Kim Y Rosenberg SC Kugel CL Kostow N Rog O Davydov V Su TY Dernburg AF Corbett KD 2014 The chromosome axis controls meiotic events through a hierarchical assembly of HORMA domain proteins Developmental Cell 31 487 502 10.1016/j.devcel.2014.09.013 25446517
Kim J Ishiguro K Nambu A Akiyoshi B Yokobayashi S Kagami A Ishiguro T Pendas AM Takeda N Sakakibara Y Kitajima TS Tanno Y Sakuno T Watanabe Y 2015 Meikin is a conserved regulator of meiosis-I-specific kinetochore function Nature 517 466 471 10.1038/nature14097 25533956
Klare K Weir JR Basilico F Zimniak T Massimiliano L Ludwigs N Herzog F Musacchio A 2015 CENP-C is a blueprint for constitutive centromere-associated network assembly within human kinetochores The Journal of Cell Biology 210 11 22 10.1083/jcb.201412028 26124289
Kogo H Tsutsumi M Inagaki H Ohye T Kiyonari H Kurahashi H 2012a HORMAD2 is essential for synapsis surveillance during meiotic prophase via the recruitment of ATR activity Genes to Cells 17 897 912 10.1111/gtc.12005 23039116
Kogo H Tsutsumi M Ohye T Inagaki H Abe T Kurahashi H 2012b HORMAD1-dependent checkpoint/surveillance mechanism eliminates asynaptic oocytes Genes to Cells 17 439 454 10.1111/j.1365-2443.2012.01600.x 22530760
Kong A Thorleifsson G Stefansson H Masson G Helgason A Gudbjartsson DF Jonsdottir GM Gudjonsson SA Sverrisson S Thorlacius T Jonasdottir A Hardarson GA Palsson ST Frigge ML Gulcher JR Thorsteinsdottir U Stefansson K 2008 Sequence variants in the RNF212 gene associate with genome-wide recombination rate Science 319 1398 1401 10.1126/science.1152422 18239089
Kwon MS Hori T Okada M Fukagawa T 2007 CENP-C is involved in chromosome segregation, mitotic checkpoint function, and kinetochore assembly Molecular Biology of the Cell 18 2155 2168 10.1091/mbc.e07-01-0045 17392512
Lambing C Osman K Nuntasoontorn K West A Higgins JD Copenhaver GP Yang J Armstrong SJ Mechtler K Roitinger E Franklin FCH 2015 Arabidopsis PCH2 mediates meiotic chromosome remodeling and maturation of crossovers PLOS Genetics 11 e1005372 10.1371/journal.pgen.1005372 26182244
Li XC Schimenti JC 2007 Mouse pachytene checkpoint 2 (trip13) is required for completing meiotic recombination but not synapsis PLOS Genetics 3 e130 10.1371/journal.pgen.0030130 17696610
Long J Huang C Chen Y Zhang Y Shi S Wu L Liu Y Liu C Wu J Lei M 2017 Telomeric TERB1-TRF1 interaction is crucial for male meiosis Nature Structural & Molecular Biology 24 1073 1080 10.1038/nsmb.3496 29083416
Luo X Tang Z Xia G Wassmann K Matsumoto T Rizo J Yu H 2004 The Mad2 spindle checkpoint protein has two distinct natively folded states Nature Structural & Molecular Biology 11 338 345 10.1038/nsmb748 15024386
Luo M Yang F Leu NA Landaiche J Handel MA Benavente R La Salle S Wang PJ 2013 MEIOB exhibits single-stranded DNA-binding and exonuclease activities and is essential for meiotic recombination Nature Communications 4 2788 10.1038/ncomms3788 24240703
Miao C Tang D Zhang H Wang M Li Y Tang S Yu H Gu M Cheng Z 2013 Central region component1, a novel synaptonemal complex component, is essential for meiotic recombination initiation in rice The Plant Cell 25 2998 3009 10.1105/tpc.113.113175 23943860
Pacheco S Marcet-Ortega M Lange J Jasin M Keeney S Roig I 2015 The ATM signaling cascade promotes recombination-dependent pachytene arrest in mouse spermatocytes PLOS Genetics 11 e1005017 10.1371/journal.pgen.1005017 25768017
Page SL Hawley RS 2004 The genetics and molecular biology of the synaptonemal complex Annual Review of Cell and Developmental Biology 20 525 558 10.1146/annurev.cellbio.19.111301.155141 15473851
Papanikos F Clément JAJ Testa E Ravindranathan R Grey C Dereli I Bondarieva A Valerio-Cabrera S Stanzione M Schleiffer A Jansa P Lustyk D Fei JF Adams IR Forejt J Barchi M de Massy B Toth A 2019 Mouse ANKRD31 regulates spatiotemporal patterning of meiotic recombination initiation and ensures recombination between X and Y sex chromosomes Molecular Cell 74 1069 1085 10.1016/j.molcel.2019.03.022 31000436
Peters AH Plug AW van Vugt MJ de Boer P 1997 A drying-down technique for the spreading of mammalian meiocytes from the male and female germline Chromosome Research 5 66 68 10.1023/a:1018445520117 9088645
Prince JP Martinez-Perez E 2022 Functions and Regulation of Meiotic HORMA-Domain Proteins Genes 13 777 10.3390/genes13050777 35627161
Qiao H Chen JK Reynolds A Höög C Paddy M Hunter N 2012 Interplay between synaptonemal complex, homologous recombination, and centromeres during mammalian meiosis PLOS Genetics 8 e1002790 10.1371/journal.pgen.1002790 22761591
Raina VB Vader G 2020 Homeostatic Control of Meiotic Prophase Checkpoint Function by Pch2 and Hop1 Current Biology 30 4413 4424 10.1016/j.cub.2020.08.064 32916108
Reynolds A Qiao H Yang Y Chen JK Jackson N Biswas K Holloway JK Baudat F de Massy B Wang J Höög C Cohen PE Hunter N 2013 RNF212 is a dosage-sensitive regulator of crossing-over during mammalian meiosis Nature Genetics 45 269 278 10.1038/ng.2541 23396135
Rinaldi VD Bolcun-Filas E Kogo H Kurahashi H Schimenti JC 2017 The DNA Damage checkpoint eliminates mouse oocytes with chromosome synapsis failure Molecular Cell 67 1026 1036 10.1016/j.molcel.2017.07.027 28844861
Roeder GS Bailis JM 2000 The pachytene checkpoint Trends in Genetics 16 395 403 10.1016/S0168-9525(00)02080-1 10973068
Roig I Dowdle JA Toth A de Rooij DG Jasin M Keeney S 2010 Mouse TRIP13/PCH2 is required for recombination and normal higher-order chromosome structure during meiosis PLOS Genetics 6 e1001062 10.1371/journal.pgen.1001062 20711356
Russo AE Giacopazzi S Deshong A Menon M Ortiz V Ego KM Corbett KD Bhalla N 2023 The conserved AAA ATPase PCH-2 distributes its regulation of meiotic prophase events through multiple meiotic HORMADs in C. elegans PLOS Genetics 19 e1010708 10.1371/journal.pgen.1010708 37058535
San-Segundo PA Roeder GS 1999 Pch2 links chromatin silencing to meiotic checkpoint control Cell 97 313 324 10.1016/s0092-8674(00)80741-2 10319812
Shibuya H Ishiguro K Watanabe Y 2014 The TRF1-binding protein TERB1 promotes chromosome movement and telomere rigidity in meiosis Nature Cell Biology 16 145 156 10.1038/ncb2896 24413433
Shibuya H Hernández-Hernández A Morimoto A Negishi L Höög C Watanabe Y 2015 MAJIN links telomeric DNA to the nuclear membrane by exchanging telomere cap Cell 163 1252 1266 10.1016/j.cell.2015.10.030 26548954
Shin YH Choi Y Erdin SU Yatsenko SA Kloc M Yang F Wang PJ Meistrich ML Rajkovic A 2010 Hormad1 mutation disrupts synaptonemal complex formation, recombination, and chromosome segregation in mammalian meiosis PLOS Genetics 6 e1001190 10.1371/journal.pgen.1001190 21079677
Sironi L Mapelli M Knapp S De Antoni A Jeang K-T Musacchio A 2002 Crystal structure of the tetrameric Mad1-Mad2 core complex: implications of a “safety belt” binding mechanism for the spindle checkpoint The EMBO Journal 21 2496 2506 10.1093/emboj/21.10.2496 12006501
Souquet B Abby E Hervé R Finsterbusch F Tourpin S Le Bouffant R Duquenne C Messiaen S Martini E Bernardino-Sgherri J Toth A Habert R Livera G 2013 MEIOB targets single-strand DNA and is necessary for meiotic recombination PLOS Genetics 9 e1003784 10.1371/journal.pgen.1003784 24068956
Stanzione M Baumann M Papanikos F Dereli I Lange J Ramlal A Tränkner D Shibuya H de Massy B Watanabe Y Jasin M Keeney S Tóth A 2016 Meiotic DNA break formation requires the unsynapsed chromosome axis-binding protein IHO1 (CCDC36) inmice Nature Cell Biology 18 1208 1220 10.1038/ncb3417 27723721
Subramanian VV MacQueen AJ Vader G Shinohara M Sanchez A Borde V Shinohara A Hochwagen A 2016 Chromosome synapsis alleviates mek1-dependent suppression of meiotic DNA repair PLOS Biology 14 e1002369 10.1371/journal.pbio.1002369 26870961
West AMV Komives EA Corbett KD 2018 Conformational dynamics of the Hop1 HORMA domain reveal a common mechanism with the spindle checkpoint protein Mad2 Nucleic Acids Research 46 279 292 10.1093/nar/gkx1196 29186573
West AM Rosenberg SC Ur SN Lehmer MK Ye Q Hagemann G Caballero I Usón I MacQueen AJ Herzog F Corbett KD 2019 A conserved filamentous assembly underlies the structure of the meiotic chromosome axis eLife 8 e40372 10.7554/eLife.40372 30657449
Wojtasz L Daniel K Roig I Bolcun-Filas E Xu H Boonsanay V Eckmann CR Cooke HJ Jasin M Keeney S McKay MJ Toth A 2009 Mouse HORMAD1 and HORMAD2, two conserved meiotic chromosomal proteins, are depleted from synapsed chromosome axes with the help of TRIP13 AAA-ATPase PLOS Genetics 5 e1000702 10.1371/journal.pgen.1000702 19851446
Wojtasz L Cloutier JM Baumann M Daniel K Varga J Fu J Anastassiadis K Stewart AF Reményi A Turner JMA Tóth A 2012 Meiotic DNA double-strand breaks and chromosome asynapsis in mice are monitored by distinct HORMAD2-independent and -dependent mechanisms Genes & Development 26 958 973 10.1101/gad.187559.112 22549958
Xu H Beasley MD Warren WD van der Horst GTJ McKay MJ 2005 Absence of mouse REC8 cohesin promotes synapsis of sister chromatids in meiosis Developmental Cell 8 949 961 10.1016/j.devcel.2005.03.018 15935783
Xu H Tong Z Ye Q Sun T Hong Z Zhang L Bortnick A Cho S Beuzer P Axelrod J Hu Q Wang M Evans SM Murre C Lu LF Sun S Corbett KD Cang H 2019 Molecular organization of mammalian meiotic chromosome axis revealed by expansion STORM microscopy PNAS 116 18423 18428 10.1073/pnas.1902440116 31444302
Yang F De La Fuente R Leu NA Baumann C McLaughlin KJ Wang PJ 2006 Mouse SYCP2 is required for synaptonemal complex assembly and chromosomal synapsis during male meiosis The Journal of Cell Biology 173 497 507 10.1083/jcb.200603063 16717126
Yang F Gell K van der Heijden GW Eckardt S Leu NA Page DC Benavente R Her C Höög C McLaughlin KJ Wang PJ 2008 Meiotic failure in male mice lacking an X-linked factor Genes & Development 22 682 691 10.1101/gad.1613608 18316482
Yang F Silber S Leu NA Oates RD Marszalek JD Skaletsky H Brown LG Rozen S Page DC Wang PJ 2015 TEX11 is mutated in infertile men with azoospermia and regulates genome-wide recombination rates in mouse EMBO Molecular Medicine 7 1198 1210 10.15252/emmm.201404967 26136358
Yang C Hu B Portheine SM Chuenban P Schnittger A 2020 State changes of the HORMA protein ASY1 are mediated by an interplay between its closure motif and PCH2 Nucleic Acids Research 48 11521 11535 10.1093/nar/gkaa527 32558910
Yang C Sofroni K Hamamura Y Hu B Elbasi HT Balboni M Chu L Stang D Heese M Schnittger A 2022 ZYP1-mediated recruitment of PCH2 to the synaptonemal complex remodels the chromosome axis leading to crossover restriction Nucleic Acids Research 50 12924 12937 10.1093/nar/gkac1160 36504011
Ye Q Kim DH Dereli I Rosenberg SC Hagemann G Herzog F Tóth A Cleveland DW Corbett KD 2017 The AAA+ ATPase TRIP13 remodels HORMA domains through N-terminal engagement and unfolding The EMBO Journal 36 2419 2434 10.15252/embj.201797291 28659378
Yost S de Wolf B Hanks S Zachariou A Marcozzi C Clarke M de Voer R Etemad B Uijttewaal E Ramsay E Wylie H Elliott A Picton S Smith A Smithson S Seal S Ruark E Houge G Pines J Kops GJPL Rahman N 2017 Biallelic TRIP13 mutations predispose to Wilms tumor and chromosome missegregation Nature Genetics 49 1148 1151 10.1038/ng.3883 28553959
Zhang Z Li B Fu J Li R Diao F Li C Chen B Du J Zhou Z Mu J Yan Z Wu L Liu S Wang W Zhao L Dong J He L Liang X Kuang Y Sun X Sang Q Wang L 2020 Bi-allelic missense pathogenic variants in TRIP13 cause female infertility characterized by oocyte maturation arrest American Journal of Human Genetics 107 15 23 10.1016/j.ajhg.2020.05.001 32473092
Zickler D Kleckner N 2015 Recombination, pairing, and synapsis of homologs during meiosis Cold Spring Harbor Perspectives in Biology 7 a016626 10.1101/cshperspect.a016626 25986558
