
==== Front
Evid Based Complement Alternat Med
Evid Based Complement Alternat Med
ECAM
Evidence-based Complementary and Alternative Medicine : eCAM
1741-427X
1741-4288
Hindawi

10.1155/2020/6538156
Research Article
Antiulcerogenic Activity of Li-Zhong Decoction on Duodenal Ulcers Induced by Indomethacin in Rats: Involvement of TLR-2/MyD88 Signaling Pathway
https://orcid.org/0000-0002-6033-1026
Song Houpan 1 2
https://orcid.org/0000-0002-4203-5792
Zeng Meiyan 2
https://orcid.org/0000-0002-3372-6807
Chen Xiaojuan 1 2
https://orcid.org/0000-0001-8353-4478
Chen Xinyi 1 2
https://orcid.org/0000-0002-0458-1733
Peng Jun 3
https://orcid.org/0000-0002-5522-6504
Lin Ye 1 2
https://orcid.org/0000-0003-4470-3448
Yu Rong 2
https://orcid.org/0000-0003-4644-4451
Cai Xiong caix12@qq.com
4
https://orcid.org/0000-0002-9378-1330
Peng Qinghua pqh410007@126.com
1
1Institute of Traditional Chinese Medicine Diagnostics, Hunan University of Chinese Medicine, Changsha, Hunan, China
2College of Traditional Chinese Medicine, Hunan University of Chinese Medicine, Changsha, Hunan, China
3Department of Ophthalmology, the First Affiliated Hospital of Hunan University of Chinese Medicine, Changsha, Hunan, China
4Institute of Innovation and Applied Research, Chinese Medicine, Hunan University of Chinese Medicine, Changsha, Hunan, China
Academic Editor: Vincenzo De Feo

2020
21 1 2020
21 1 2020
2020 65381562 6 2019
4 11 2019
5 12 2019
Copyright © 2020 Houpan Song et al.
2020
This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Background

Administration of nonsteroidal anti-inflammatory drugs (NSAIDs) often causes small intestinal ulcers in patients, but few effective drugs are currently available to manage such serious adverse events of NSAIDs. Li-Zhong decoction (LZD), a well-known traditional Chinese medicine (TCM) formula, is commonly prescribed for treatment of gastrointestinal diseases. The present study aimed to investigate the anti-ulcerogenic activity of LZD on indomethacin- (IND-) induced duodenal ulcer in rats. Mechanistic studies of action of LZD were focused on involvement of TLR-2/MyD88 signaling pathway.

Methods

Fifty male Sprague-Dawley (SD) rats were randomly and evenly divided into five groups: normal control, ulcer control (IND, 25 mg/kg), IND + esomeprazole (ESO, 4.17 mg/kg), and IND + low and high doses of LZD (3.75 and 7.50 g/kg). Macroscopic and histopathological examinations were performed for evaluation of ulcer index (UI), curative index (CI), and microscopic score (MS). Levels of duodenal inflammatory biomarkers and cytoprotective mediators including interleukin-4 (IL-4), IL-10, tumor necrosis factor-α (TNF-α (TNF-

Results

Gross and microscopic examinations of the IND-treated rats revealed severe duodenal hemorrhagic necrosis, inflammatory infiltration, villus destruction, and crypt abscess, while LZD-treated rats manifested these pathological events to a markedly lesser degree. LZD significantly decreased UI and MS, increased CI, preserved the integrity of the villus and crypt, and normalized the tissue architecture of the duodenum of rats. The elevated TNF-α (TNF-

Conclusions

Our data demonstrate that LZD protects the duodenal mucosa from IND-caused lesions, which is at least partially attributable to the interaction of its potential cytoprotective and anti-inflammatory mechanisms together with enhancement of the mucosal immunity through TLR-2/MyD88 signaling pathway.

National Natural Science Foundation of China81703920 81804150 China Postdoctoral Science Foundation2019M662790 Natural Science Foundation of Hunan Province2019JJ50442 2018JJ2293 Hunan Education Department's Science and Research Project17K069 Hunan Provincial Science and Research Project of Chinese Medicine201780 Hunan University2017280 Open-Ended Science Foundation of Institute of Innovation and Applied Research in Chinese Medicine201903 121 Hunan Provincial Training Project for Innovative TalentsNational First-Class Disciple Construction Project of Chinese Medicine2018ZYX20 2018ZYX26
==== Body
1. Introduction

Duodenal ulcer (DU) is one of the major gastrointestinal disorders, which affects annually approximately 10–15% of the population worldwide [1]. DU occurs due to loss of balance between offensive and defensive factors. Several exogenous pathogenic factors including Helicobacter pylori infection, alcohol, nonsteroidal anti-inflammatory drugs (NSAIDs), and stress and several endogenous factors including hydrochloric acid, pepsin, reactive oxygen species (ROS), leukotrienes, and refluxed bile are major causative agents for duodenal mucosal damage and ulceration [2]. DU is a public health problem with high frequency of morbidity and substantial mortality and has become the focus of clinical and basic research studies.

Clinical management of DU includes either enhancing duodenal mucosa defenses or counteracting detrimental factors or a combination of both. Effective drugs currently available have been those which reduce or neutralize gastric acid such as proton pump inhibitors (PPIs, e.g., lansoprazole and omeprazole) and H2-receptor antagonists (H2RAs, e.g., ranitidine and famotidine) as well as antibiotic therapy for Hp eradication. However, the long-term use of these antisecretory agents can cause numerous untoward effects. PPIs are closely associated with the development of parietal cell hyperplasia of the gastric glands. Long-term treatment with H2RA may lead to the development of undesirable effects such as osteoporosis, galactorrhea, gynecomastia, and alteration of the bacterial flora of the gastrointestinal tract. Furthermore, PPIs and H2RAs can induce rapid tolerance during therapeutic process and rebound of hyper gastric acid secretion following withdrawal of drugs, which leads to high recurrence rate of ulcers [3].

These clinical problems occurred in the management of DU has led to the investigation and development of new therapeutic alternatives that demonstrate good effectiveness with fewer adverse effects, as well as therapies for the improvement of the quality of ulcer healing and the prevention of disease relapse. Recently, serious attention has been paid to natural products, owing not only to its favorable safety profile and relatively low cost but also to its attracting efficacy, minimal postprandial untoward effects, and superior compatibility with human body system. With regard to DU therapies, various research studies have shown potential gastroprotective activities of plant-based extracts and TCM formulas, such as Citrus sinensis [1], Melastoma malabathricum [4], Spondias mombin [5], and Xiao Chaihu decoction [6].

Li-Zhong decoction (LZD), formulated with four TCM herbs, i.e., Bai Zhu (Atractylodis macrocephalae rhizoma, AMR) 9 g, Dang Shen (Codonopsis radix, CR) 9 g, Gan Jiang (Zingiberis rhizoma, ZR) 9 g, and Gan Cao (Glycyrrhizae radix et rhizoma, GRR) 9 g, has been commonly prescribed for the treatment of digestive diseases in East Asian countries for over one thousand years. LZD is mostly used for the relief of nausea or vomiting, stomachache, diarrhea or watery stools, and rugitus. Modern studies have demonstrated that extracts or compounds from CR [7–9] or GRR [10–13] possess multiple physiological effects, such as anti-inflammation, antioxidation, gastrointestinal function regulation, and immune function regulation. We have shown that AMR stimulated gastrointestinal epithelial repair through polyamine-mediated Ca2+ and K+ signaling pathways [14–16]. In addition, Chrubasik et al. reported the anti-inflammatory activity and immune-modulatory effects of ZR [17, 18]. In order to further expound the efficacy of LZD as an antiulcerative agent, the current study was undertaken to investigate the gastrointestinal protective effect of LZD against indomethacin- (IND-) induced duodenal ulcers in rats using esomeprazole (ESO) as a reference drug. Clinical parameters for duodenal protection were assessed via lesion area observation and histological examination. The status of production of prostaglandin E2 (PGE2) and inflammation-related cytokines was also detected. Moreover, molecular mechanisms by which LZD exerted its curative effect were clarified via the TLR-2/MyD88 signaling pathway.

2. Materials and Methods

2.1. Reagents and Chemicals

Esomeprazole (Lot. G170815) enteric-coated capsule was purchased from Lummy Pharmaceutical Co., Ltd. (Chongqing, China). Aspirin (Lot. BJ38595) was obtained from Bayer Pharma AG (Leverkusen, Germany). Potent ECL kit (Lot. 75261483), RIPA lysis buffer (Lot. 30228), phosphate buffered saline (PBS, Lot. 1016K022), absolute ethanol solution (Lot. 20170918), and paraformaldehyde (Lot. 20171111) were acquired from Solarbio Life Sciences (Beijing, China). ELISA kits for interleukin-10 (IL-10, Lot. CRE007), interleukin-4 (IL-4, Lot. A30480435), and tumor necrosis factor-α (TNF-α, Lot. 20180824) determination were purchased from 4A Biotech Co., Ltd. (Beijing, China). ELISA kit for prostaglandin E2 (PGE2, Lot. 20180713) was purchased from Jiancheng Bioengineering Institute (Nanjing, China). Hematoxylin (Lot. P4163), eosin (Lot. 150109), and DAB kit (Lot. K176810E) were purchased from Zsbio Commerce Store (Beijing, China). Rabbit anti-TLR-2/HRP conjugated antibody (Lot. AH04173651), rabbit anti-MyD88/HRP conjugated antibody (Lot. AG07205376), mouse anti-β-actin antibody (Lot. AH03275734), goat anti-mouse IgM/HRP antibody (Lot. AG10205838), and goat anti-rabbit IgG/HRP antibody (Lot. AG11091289) were obtained from BIOSS Biotechnology Co., Ltd. (Beijing, China). Total RNA extraction kit (Lot. DCO7KA7242), M-MuLV cDNA synthesis kit (Lot. E112KA7529), and SG Fast qPCR Master Mix (Lot. E620KA8781) were purchased from Sangon Biotech Co., Ltd. (Shanghai, China). Chemicals used in buffers and other solutions were of analytical grade and obtained from regular commercial suppliers.

2.2. Sources and Authentication of Herbs

GRR, the product of a Good Agricultural Practice (GAP) base of Glycyrrhiza uralensis Fisch. in Booksell Mongolian autonomous county of Xinjiang province, was purchased from Xinjiang Kanglong Technology Co., Ltd. CR, the product of a GAP base of Codonopsis pilosula (Franch.) Nannf. in Min county of Gansu province, was purchased from Gansu Jiuzhou Tianrun Traditional Chinese Medicine Industry Co., Ltd. ZR and AMR were obtained from Beijing Tongrentang Co., Ltd. All of these four herbs were authenticated by Dr. Zhi Wang at Hunan University of Chinese Medicine. The authenticated voucher specimens (Voucher 18-04-20 for ZR, Voucher 18-05-21 for AMR, Voucher 18-05-01 for GRR, and Voucher 18-05-12 for CR) are kept at Hunan Provincial Key Laboratory of Diagnostic Research in Chinese Medicine.

2.3. Preparation of LZD

AMR 9 g, CR 9 g, ZR 9 g, and GRR 9 g, which formulated LZD, were crushed into small pieces and mixed evenly, and the mixture was decocted with 100°C distilled water for 2 hr at a ratio of 1 : 8 (w/v). This procedure was repeated twice in a glass flask. The combined water extract was then centrifuged at 10000 ×g for 15 min and filtered through a filter paper. Thereafter, the aqueous extract was concentrated by evaporation under reduced pressure to a final crude drug concentration of 1.5 g/ml. Detailed information on the composition of LZD is provided in Table 1. In order to control the quality and ensure the consistency and stability of LZD, an accurate and practical UPLC method was employed for assurance of quality control of the typical chemicals of the four herbs of LZD extract, atractylenolide III and atractylenolide I for AMR, 6-gingerol and 10-gingerol for ZR, liquiritin and glycyrrhizic acid for GRR, and syringing and lobetyolin for CR. The UPLC chromatograms of the analytical standards and LZD extract are provided in the Supporting information ().

2.4. Selection of Dose of LZD

The doses of aqueous extract of LZD were expressed as gram of the original dry materials per kilogram body weight, and the doses of LZD were ascertained based on the results from the preliminary study. Experimental dose in animal study was calculated according to the guideline for dose conversion between animals and human issued by the US Food and Drug Administration; animal equivalent dose (AED) can be calculated on the basis of body surface area by multiplying the human dose by the correction factor (Km).(1) AED g/kg=human doseg/kg×Km ratio.

The average human body weight is 60 kg, and the Km of rat is 6.25.(2) AED=3660×6.25=3.75g/kg.

In order to scientifically evaluate the effect of LZD on IND-induced duodenal injury in rats and to elucidate the possible mechanisms underlying its protective benefits, two doses of LZD were applied in this study, of which 3.75 g/kg was the low dose and 7.50 g/kg was the high dose.

2.5. Animals

Male Sprague-Dawley (SD) rats weighing 180–200 g were purchased from Hunan Slake Jingda Laboratory Animal Co., Ltd. (Changsha, China). Animals were housed four per cage in rooms of our laboratory animal center maintained at 22 ± 0.5°C with alternating 12-hr light-dark cycles. Food and water were provided ad libitum throughout the experiments. Experimental protocols involving animals and their care were approved by the Institutional Animal Care and Use Committee of Hunan University of Chinese Medicine (License no. 43004700043996) and carried out strictly according to the Guide for the Care and Use of Laboratory Animals of National Institute of Health (NIH) (Bethesda, MD, USA).

2.6. Induction of Duodenal Ulcer

The duodenal mucosal lesions were induced with indomethacin (IND) according to the method described by Bessette et al. [19] with minor modifications. A total of 50 rats were randomly divided into five groups (each group consisting of 10 animals); the treatment schedule was as follows. Group 1 was labeled as normal control (NC), in which rats were treated with 0.9% sodium chloride solution (vehicle, VEH) (1 mL/100 g of body weight). Group 2 was labeled as negative control, in which rats were induced with duodenal ulcer and orally administered with VEH. Group 3 was labeled as positive control; rats with duodenal ulcer in this group received oral dose of 4.17 mg/kg esomeprazole (ESO). Group 4 and 5 were labeled as experimental groups; duodenal ulcer rats in these two groups were treated with 3.75 g/kg and 7.50 g/kg LZD, respectively. To evoke duodenal ulcer, IND was dissolved in 5% NaHCO3 and administered to rats by subcutaneous injection (25 mg/kg body weight) once daily for four consecutive days (days 1–4). The rats in normal control group were injected with the same volume of 5% NaHCO3. After the establishment of DU model, VEH, ESO, and LZD (3.75 and 7.50 g/kg) were orally administrated once daily for three consecutive days (days 5–7). At the end of the treatment (day 8), the rats were sacrificed under anesthesia by cervical dislocation, and the duodenums were rapidly removed for further analysis (Figure 1).

2.7. Evaluation of Duodenal Mucosal Lesions

Duodenums were dissected along the central axis and rinsed with ice-cold normal saline solution to clean away the duodenal content remnants, mucus, and blood clots. The number and the severity of discrete areas of gross damage in the mucosa were examined under a three-fold magnifier and assessed by two pathologists who were unaware of the drug treatment. The ulcer score of the rat duodenum was graded on a 0–5 point scale based on the severity of erosion and formation of hemorrhages according to the modified method described by Cantarella et al. [20] as follows: almost normal, no damage (0), pinpoint erosions (1), lesions < 1 mm length (2), lesions 1-2 mm length (3), lesions 3-4 mm length (4), and lesions > 4 mm length (5). The ulcer score for each rat was calculated as the number of lesions multiplied by their corresponding score. Ulcer index (UI) and curative index (CI) were used to evaluate the degree of ulcer damage. The mean UI and CI were calculated according to the method described by Adefisayo et al. [21] using the following equations. UI = total ulcer score of similarly treated group/number of ulcerated animals of the same group. CI = (UI of negative control group − UI of drug treatment group/UI of negative control group) × 100%.

2.8. Histopathological Evaluation of Duodenal Damage

Duodenal mucosa samples were placed in 4% paraformaldehyde solution for 48 hr, and then fixed samples were washed in PBS buffer (pH 7.4), dehydrated in ascending alcohol concentrations in series (70%, 90%, 95%, and 100%), cleared in xylene, and embedded in paraffin wax. Tissue samples were then sectioned at 5 μm thickness, mounted onto silane-coated slides and air-dried. These sections were then stained with hematoxylin and eosin (H&E) according to the standard histological procedures described previously [22], and H&E stained sections were examined under a light microscope (Moticam pro 205 A, Sweden). Histopathological lesions were examined by an experienced pathologist without knowledge of the treatment groups. The severity of gastric microscopic damage was quantified on a 0–14 scale, each histological section was evaluated for epithelial cell loss (score 0–3), intestinal villus exfoliation (score 0–4), mucosal edema (score 0–4), and presence of inflammatory cell infiltration (score 0–3).

2.9. Evaluation of Prostaglandin E2, Interleukin-10, Interleukin-4, and Tumor Necrosis Factor α Levels in Duodenal Mucosa

The mucosa specimens were scraped from corresponding duodenum tissue layers by using two glass slides maintained cold on ice. The specimens were weighed, minced by surgical scissors, and homogenized in 2 mL ice-cold buffer (0.01 M Tris-HCl, pH 7.4, containing 10 mM sucrose and 0.1 mM EDTA-2Na) per gram of tissue. After that, the homogenate was centrifuged at 12000 rpm at 4°C for 20 min. Following centrifugation, the supernatant was carefully removed from the tube, and aliquots of the obtained supernatant were stored at −20°C until analysis and were used directly for subsequent experimental procedures.

PGE2 level in the duodenal mucosa was measured using the enzyme-linked immunosorbent assay (ELISA) according to the manufacturer's recommendations. In brief, the homogenate (10 μl) was added to a solution system containing four reagents: 40 μl of sample diluent, 100 μl of PGE2 ELISA buffer, 100 μL of chromogenic reagent, and 50 μl of stop solution. After 15 min of reaction at room temperature, absorbance of the mixture was then detected at a wavelength of 450 nm using a UV-VIS Spectro Photometer (UV-1750; Shimadzu corporation, Japan) for 80 s. Results were presented as pg PGE2/g wet tissue.

The duodenal mucosal contents of interleukin-4 (IL-4), interleukin-10 (IL-10), and tumor necrosis factor α (TNF-α) were measured by commercially available ELISA kits according to the manufacturer's recommendations. The absorbance was detected at a wavelength of 450 nm using a microplate reader (Cytation 5, BioTek Instruments, USA). Commercially available IL-4, IL-10, and TNF-α were used as the standards. Levels of IL-4, IL-10, and TNF-α were determined, respectively, by comparing the sample absorbance to a standard curve. All of the experiments were performed in triplicate, and the results were presented as ng of cytokine per g of wet duodenal tissue.

2.10. RNA Extraction, Complementary DNA (cDNA) Synthesis, and Quantitative Real-Time PCR

Total RNA was isolated from duodenal mucosa using ice-cold Total RNA Extractor (Trizol) reagent (Sangon Biotech, Shanghai, China). The quantification and quality of RNA were determined by spectrophotometric analysis with SmartSpec™ Plus (BIO-RAD, USA) and by bioanalyzer capillary electrophoresis system (Agilent 2100, Agilent technologies, Japan), respectively. Complementary DNA was then synthesized using M-MuLV first strand cDNA Synthesis Kit (Sangon Biotech, Shanghai, China) according to the manufacturer's recommendations. Quantitative real-time PCR (qRT-PCR) was conducted in a total volume of 20 μl solution system containing 10 μl of SG qPCR Master Mix (BBI Life Sciences, Shanghai, China), 0.4 μl of forward primer, 0.4 μl of reverse primer, 2 μl of template cDNA, and 7.2 μl of PCR-grade water. Thermal cycling conditions were 3 min at 95°C for enzyme activation followed by 40 cycles of 3 sec at 95°C for denaturation and 30 sec at 60°C for annealing, extension, and data acquisition. Primers were designed using Primer Express software v3.0 (Applied Biosystems, CA, USA) and synthesized by TAKARA BIO INC. (Dalian, China). The relative expression levels of target genes were calculated following the comparative 2−ΔΔCt method. β-Actin was used as house-keeping gene control. All experiments were performed in duplicates, and all specimens were collected in three biological replicates. Table 2 provides a summary of the specific gene transcripts used in this study.

2.11. Immunohistochemical Analysis

Paraffin-embedded rat duodenal tissues with ulcerative lesions were cut into 5 μm thick section slices. The antigen retrieval was carried out by using a microwave oven for 2 min. The slices were cooled down to room temperature. A solution of PBS containing 0.1% Triton and 3% bovine serum albumin (BSA) was used to block the endogenous peroxidase. Immunohistochemical analysis was performed by avidin-biotin complex technique. The sections were incubated with rabbit anti-TLR2 antibody (1 : 100 dilution; Bioss antibodies, Beijing, China) or rabbit anti-MyD88 antibody (1 : 100 dilution; Bioss antibodies, Beijing, China) overnight at 4°C and then with HRP-conjugated goat anti-rabbit secondary antibody (1 : 100 dilution; Bioss antibodies, Beijing, China). After washed with PBS three times, slides were incubated with 0.1% diaminobenzidine and 0.02% hydrogen peroxide (DAB kit), counterstained with hematoxylin, dehydrated with gradient ethanol, and mounted. Negative control sections were incubated with PBS instead of the primary antibody. Sections were examined and photographed by a digital camera connected to a Moticam Pro 205A microscope. Image processing and analysis were accomplished using the Image-Pro Plus software (Media Cybernetics, Maryland, USA).

2.12. Western Blot Analysis

Isolated duodenal mucosal tissues were lysed for 30 min by ice-cold RIPA lysis buffer (Triton X-100 1%, deoxycholate 1%, and SDS 0.1%) in the presence of phenylmethanesulfonyl fluoride (PMSF, 0.1 mM). The homogenate was centrifuged at 10000 rpm for 10 min at 4°C (5810R, Eppendorf, Germany). The protein concentration was estimated by a BCA assay kit (P0010, Beyotime, Shanghai, China). Equal amount of protein (30 μg) was subjected to the SDS-polyacrylamide gel and transferred onto a PVDF membrane. The membrane was blocked with 5% dry milk in Tris-buffered saline and probed with primary antibodies overnight at 4°C. Thereafter, the membrane was washed with TBST followed by incubation with secondary antibodies at room temperature for 2 hr. Primary antibodies used were rabbit anti-TLR2 antibody (bs-1019R, Bioss antibodies, dilution 1 : 100), rabbit anti-MyD88 antibody (bs-1047R, Bioss antibodies, dilution 1 : 100), and mouse anti-beta-actin antibody (bsm-33036M, Bioss antibodies, dilution 1 : 5000). Secondary antibodies applied were goat anti-rabbit IgG/HRP antibody (bs-0295G, Bioss antibodies, dilution 1 : 5000) and rabbit anti-mouse IgM/HRP antibody (bs-0368R, Bioss antibodies, dilution 1:5000). Labeled protein bands were visualized with an enhanced chemiluminescence (ECL) substrate solution on ChemiDoc™ instrument (BIO-RAD, CA, USA) and quantified by Image Lab software (BIO-RAD, CA, USA).

2.13. Statistical Analysis

Data were expressed as the mean ± standard error of the mean (SEM). The differences between means were evaluated by one-way analysis of variance (ANOVA) followed by Dunnett's multiple comparisons test. Statistical analysis was performed using Statistical Package for the Social Sciences (SPSS, version 20.0). Statistical differences with the P value less than 0.05 were considered to be significant.

3. Results

3.1. Protection of Duodenal Mucosa by LZD from Indomethacin-Induced Duodenal Ulcer

Subcutaneous injection of 25 mg/kg IND induced a consistent macroscopic damage in rats which were characterized by dark red and black spots or bands of hemorrhagic lesions on the mucous layer of the duodenum of rats (Figure 2). Treatment with LZD at doses of 3.75 and 7.50 g/kg markedly reduced the duodenal lesions, alleviated petechial hemorrhage, and lowered the UI. Table 3 shows that the UI of the DU model group was 26.88 ± 2.75, while the UI of rats treated with 3.75 and 7.50 g/kg LZD was 3.88 ± 1.56 and 2.25 ± 1.04, respectively. Treatment with LZD at doses of 3.75 and 7.50 g/kg significantly decreased the UI by 85.57 and 91.63%, respectively. Similarly, administration of a reference drug, ESO at the dose of 4.17 mg/kg, protected rats against the ulcerative effect of IND, as evidenced by an increase in the CI amounted to 94.42%.

3.2. Histopathological Evaluation of Duodenal Mucosa

To further support the previous macroscopic results, a histopathological analysis was carried out accordingly. H&E staining of sections from normal control rats showed well-preserved intestinal villi and epithelium, of which the tissue structures were complete and clear, without inflammatory cell infiltration. By contrast, hemorrhages, degeneration of epithelium and glands, vasodilatation of mucous membrane and submucosa, infiltration of inflammatory cells in lamina propria, and more seriously, villus destruction and crypt abscess of the duodenum were observed in rats of the DU model group. Treatment with ESO or LZD (3.75 and 7.50 g/kg) significantly ameliorated the histopathological lesions caused by IND. As shown in Figure 3(a), treatment with ESO or LZD (3.75 and 7.50 g/kg) demonstrated almost no disruption at the epithelium mucosa with the presence of slight edema and the absence of hemorrhage, villus destruction, and recess abscess. ESO and LZD (3.75 and 7.50 g/kg) decreased microscopic score by 364, 205, and 329%, respectively, as compared to the negative control group (9.67 ± 1.63) (Figure 3(b)). Moreover, acute exposure of rats to IND significantly decreased villus height and crypt depth from 364.12 ± 27.83 and 294.49 ± 22.30 in the normal control group to 121.45 ± 24.34 and 100.47 ± 20.86, respectively, in the DU model group. Compared with the DU model group, treatment with LZD (3.75 and 7.50 g/kg) increased the villus height by 137% and 171%, respectively. Levels of crypt depth were also elevated by 132% and 149%, respectively, following LZD treatment, when compared with the model group (Figures 3(c) and 3(d)).

3.3. Effect of LZD on the Cytoprotective Mediator

Since PGE2 is one of the most important cytoprotective mediators in the gastrointestinal tract and plays an essential role in duodenal epithelial defense and repair, we examined the effect of LZD on duodenal PGE2 levels in IND-induced DU model. As shown in Figure 4(a), rats of the DU model group exhibited a significant decrease (42.15%) in duodenal mucosal PGE2 content, as compared to that in the normal control group (60.26 ± 6.48), whereas treatment with either ESO or LZD (3.75 and 7.50 mg/kg) significantly increased duodenal PGE2 content (63.68%, 40.53%, and 59.32%, respectively).

3.4. Effect of LZD on the Inflammatory Markers

The results of the inflammatory markers analysis are shown in Figures 4(b)–4(d). Rats of the DU model group caused a significant increase in duodenal proinflammatory TNF-α level (66.06%), whereas a marked decrease in anti-inflammatory IL-4 and IL-10 levels (47.38% and 40.64%, respectively), as compared to the normal control group. Treatment with either ESO or LZD (3.75 and 7.50 mg/kg) significantly decreased duodenal TNF-α level (35.54%, 25.79%, and 39.09%, respectively) and increased the anti-inflammatory IL-4 (77.87%, 31.22%, and 64.34%, respectively) and IL-10 (76.97%, 48.09%, and 71.16%, respectively) levels of ulcer-bearing duodenal tissue as compared to the DU model groups.

3.5. Effects of LZD on TLR-2 and MyD88 mRNA Expression

To determine the possible role of TLR-2/MyD88 signaling pathway in the regulation of ulcer formation, we investigated the effects of LZD on gene expression of TLR-2 and MyD88 in duodenal ulcer rats induced by IND. As illustrated in Figure 5, induction of duodenal ulcer by IND significantly increased TLR-2 and MyD88 mRNA expression levels. Expression levels of TLR-2 and MyD88 mRNA in the IND-treated rats were 2.1 and 2.2 times of the control values, respectively. Treatment with either ESO or LZD (3.75 and 7.50 g/kg) completely prevented the increased expression levels of TLR-2 and MyD88 mRNA. The expression levels of TLR-2 mRNA in 3.75 and 7.50 g/kg LZD-treated rats were decreased by 37.31% and 46.27%, respectively, when compared with those in rats of the DU model group. Similarly, the mRNA levels of MyD88 in 3.75 and 7.50 g/kg LZD-treated groups were decreased by 38.03% and 46.48%, respectively, when compared with those in rats of the DU model group.

3.6. Effects of LZD on TLR-2 and MyD88 Protein Expression

To further determine the possibility that LZD regulates ulcer repair by altering the TLR-2/MyD88 signaling pathway, we examined the effects of LZD on TLR-2 and MyD88 protein expression in ulcerative rats. The results presented in Figure 6 showed that levels of TLR-2 and MyD88 protein expression in rats of the DU model group were increased by 1.8- and 2.4-fold, respectively, as compared with those in normal control group. The increased levels of TLR-2 and MyD88 protein expression were completely inhibited when rats were treated with either ESO or LZD (3.75 and 7.50 g/kg) for 3 days. Levels of TLR-2 protein were inhibited by 47.6%, 36.1%, and 47.6%, respectively, in IND-treated rats when exposed to ESO and LZD (3.75 and 7.50 g/kg). Levels of MyD88 protein in ESO- and LZD-treated (3.75 and 7.50 g/kg) rats were decreased by 1.9-fold, 1.7-fold, and 1.8-fold, respectively, compared with those in rats of the DU model group.

3.7. Localization of TLR-2 and MyD88 in Tissue Level Expression on IND-Induced Duodenal Ulcer and Protection Generated by LZD

TLR-2 and MyD88 localization was checked in duodenal sections by immunohistochemistry analysis. Overexpressions of TLR-2 and MyD88 were predominantly observed in the epithelial layer in tissues of the DU model rats, whereas reduced expressions of TLR-2 and MyD88 were observed in the epithelial region of tissue sections from rats treated with ESO or LZD (Figure 7(a)). It was evident from phase contrast and immunohistochemistry microscopic analysis that tissues of the DU model rats exhibited greater IOD values of TLR-2- and MyD88-immunopositive cells (45.95 ± 6.35 and 42.20 ± 8.01, respectively) compared to saline-treated normal ones (10.51 ± 2.22 and 11.30 ± 2.53, respectively). However, the IOD values of TLR-2-immunopositive cells showed a significantly lower level in the ESO and LZD (3.75 and 7.50 g/kg) groups compared with the negative control group (P < 0.01). Moreover, the IOD values of MyD88-immunopositive cells also showed a marked reduction in the ESO and LZD (3.75 and 7.50 g/kg) groups compared with those of the DU model group (P < 0.01) (Figures 7(b) and 7(c)). These findings suggested that LZD treatment reduced highly upregulated expression of TLR-2 and MyD88 protein in duodenal tissues after IND administration.

4. Discussion

Duodenal ulcer is a common and frequently occurring disease affecting 10%–15% of population in all geographical regions around the world. The occurrence and recurrence of DU seriously affects the quality of human life [23]. Currently, the prevention and treatment of DU mainly include clinical use of antacids, proton pump inhibitors, and H2 receptor antagonists [24, 25]. Nevertheless, long-term use of these drugs may result in undesirable side effects such as abdominal pain, nausea, sleep deprivation, diarrhea, headache, pneumonia, and osteoporosis-related fracture [26]. Therefore, western medicine has been paying serious attention to Chinese herb prescriptions as an alternative source of medication with high therapeutic potency and lower toxicity in treating DU. Li-Zhong decoction (LZD) is a well-known and commonly prescribed Chinese herbal formulation for treatment of various gastrointestinal diseases, which has been used in China for over one thousand years.

To investigate the protective effect of LZD on gastrointestinal tract, a IND-induced duodenal ulcer model in rats was established, which is commonly and classically used in the search for gastroprotective natural medicines [27, 28]. IND causes the duodenal damage by suppressing the prostaglandin biosynthesis, decreasing the mucus production, and reducing the blood circulation within the mucosa [29, 30]. Acute exposure of the duodenal mucosa of rats to IND results in severe lesions similar to those emerging in patients with duodenal ulcers. Accordingly, it was evident that IND administration to rats caused macroscopic damages to duodenal tissue, such as loss of normal color, sever edema, and moderate hemorrhage, while treatment with LZD at doses of 3.75 and 7.50 g/kg reduced the size of the duodenal lesions induced by IND.

Moreover, the results of gross examination were further confirmed by histopathological detection of duodenal mucosa in rats of the DU model group. Indeed, the DU model rats presented severe destruction and desquamation of intestinal villi, moderate necrosis and deformation of duodenal glands, mild edema of submucosa layer, and marked cellular infiltration by inflammatory cells. These results revealed the declined ability of the duodenal mucosa to bear the offensive onslaught of IND. Treatment with LZD, however, facilitated speedy damage repair process of the ulcer lesions in the mucosa epithelial layer and protected the duodenal mucosa, thus preventing IND-induced gastrointestinal mucosal injury in rats. Healing of duodenal mucosa was prominently displayed by LZD at doses of 3.75 and 7.50 g/kg, depicting its good ulcer-repairing effects. These effects compared favorably well with ESO (reference drug). Similar results were obtained by Miura et al. [31], who demonstrated that IND injection could induce numerous deep ulcerations to appear in a punctuate pattern; the herb medicine orengedokuto significantly ameliorated the intestinal lesions induced by IND, as evidenced by the markedly decreased size and number of perforations or coalescence of small intestine obtained from orengedokuto-treated animals.

It is well established that PGE2 is beneficial for duodenal ulcer healing wherein it acts as an important agent in gastrointestinal mucosal defense [32]. Furthermore, PGE2 is an efficacious vasodilator which promotes ulcer healing by enhancing the release of mucus and bicarbonate and inhibiting the gastric acid secretion [33]. The elevated gastric PGE2 level could lower the permeability of the epithelium which results in the reduction of acid back diffusion and downregulation of inflammatory mediators, thus promoting duodenal ulcer healing. In the present work, our results showed that exposure to IND evidently decreased duodenal mucosal PGE2 content. This is in line with the findings of Danon and Assouline [34], who also discovered that IND administration led to a significant reduction in PGE2 content in the hypertonic-treated rats. However, in the present study, we found that LZD (3.75 and 7.50 g/kg) significantly prevented the reduction of mucosal PGE2 level induced by IND. Based on these results, it is reasonable to speculate that the elevation of PGE2 evoked by LZD contributes to protection against duodenal ulcer.

When duodenal ulcer is induced by IND or other NSAIDs, the generation of pro- and anti-inflammatory cytokines has been proposed to be a crucial aspect of the pathogenesis and etiology of DU. TNF-α is an important proinflammatory cytokine of the acute inflammation and is closely related to the apoptosis of duodenal mucosal cells that are damaged by various agents [35]. The administration of IND activated the innate immune response and promoted enhanced levels of TNF-α in the duodenal tissue, as evidenced by the TNF-α concentration in the negative control group. However, a remarkable decrease in TNF-α content was observed in the groups treated with 3.75 and 7.50 g/kg LZD. In a study performed by Lu et al. [36], they proved that TNF-α promoter SNPs were novel host factors to determine the gastrointestinal inflammation and risk of peptic ulceration upon H. pylori infection.

Meanwhile, we herein found that levels of anti-inflammatory cytokines IL-4 and IL-10 were dramatically decreased in the duodenum following IND administration, suggesting that inflammatory cell infiltration was present at the lesion site. In contrast, treatment with LZD (3.75 and 7.50 g/kg) markedly increased levels of IL-4 and IL-10. As a result, promotion of the release of anti-inflammatory cytokines may be an important mechanism involved in the protective effect of LZD against IND-induced duodenal ulcer.

Toll-like receptors (TLRs) are a group of surface molecules and transmembrane proteins that function as pattern-recognition receptors for detecting and responding to mucosal offensive factors. So far, at least 11 members of the TLR family have been discovered in mammalian cells [37]. TLRs are mainly expressed on mucosal epithelial cells, endocrine cells, Paneth cells, goblet cells, and specific immune cells of lamina propria [38]. TLRs recognize the harmful compounds in the extracellular domain and subsequently transduce signals through downstream molecule MyD88 to stimulate innate immune responses against damages and infections, thus paving way for successful adaptive immunity [39]. Studies in mice have demonstrated that TLR-2, TLR-4, and TLR-5 regulate intestinal epithelial homeostasis and provide protection from injury, such as that mediated by IND, radiation, and dextran sodium sulphate [40]. In this study, we examined levels of TLR-2 and MyD88 mRNA and protein expression in the duodenal mucosa lesions to investigate whether innate immunity had some association with the treatment and prevention of duodenal ulcer. As depicted in Figures 5 and 6, IND treatment caused overexpressions of TLR-2 and MyD88 in the duodenal mucosa, while treatment with both low-dose (3.75 g/kg) and high-dose (7.50 g/kg) LZD reduced those to near-normal levels. Furthermore, immunohistochemical results showed that duodenal tissue of DU rats displayed very highly expressed TLR-2 and MyD88 in the epithelial layer. By contrast, LZD (3.75 and 7.50 g/kg) treatment protected the duodenal epithelial layer from IND-induced damage and reversed back the expression of TLR-2 and MyD88 to normal levels (Figure 6). These findings suggested that inhibition of TLR-2/MyD88 signaling pathway with LZD was believed to be vital in attenuating the formation of IND-induced duodenal ulcer. These results are in agreement with a previous research which reported that isoflavone, one of the main bioactive components of LZD, inhibited IL-6 and IL-8 production through TLR-2-stimulated monocytes in a dose-dependent manner and thus enhanced gut immunity and protected the host from tissue damage in a mouse model of colitis [41].

Both PGE2 and TNF-α can be controlled by TLR-2/MyD88 signaling pathway, and numerous studies have demonstrated that downregulation of TLR-2/MyD88 signaling pathway [37], promotion of PGE2 secretion [4], and inhibition of TNF-α expression [3, 5] could make important contribution to the suppression of the development of peptic ulcer. In the present study, we observed the marked upregulation of TLR-2, MyD88, and TNF-α in the epithelium and the granulation tissues at the base of the ulcer, compared with normal duodenal tissues without ulcers, which implied that these factors could accelerate ulcer formation. Our results also showed that IND induced depletion of PGE2 generation in the ulcer model group compared to that of the normal control group. LZD administration significantly decreased the expressions of TLR-2, MyD88, and TNF-α and markedly promoted the generation of duodenal mucosal PGE2, compared to the ulcer control group, thus alleviating duodenal ulcer formation and decreasing the size of ulcers. The classical (canonical) TLR-2 signaling pathway includes at least 12 molecular members: TLR-2, MyD88, TRAF6, p-IRAKs, TAK1, p-IKKs, p50, p65, p-ERK, p-p38, p-JNK, and AP-1 [42]. TLR-2 and MyD88 are the two most upstream molecules of TLR-2 signaling pathway. In an effort to clearly clarify the protective mechanism of LZD on duodenal mucosa, we will determine the effect of LZD on the expression of more downstream proteins of TLR-2 signaling cascade in our future experiments.

5. Conclusions

In summary, our study demonstrates that Li-Zhong decoction significantly attenuates the IND-induced duodenal mucosa damage in rats, which is associated with augmentation of PGE2 content, minimization of proinflammatory cytokines, enhancement of anti-inflammatory cytokines, and inhibition of TLR-2/MyD88 signaling pathway. These findings provide an alternative concept to support LZD as a general TCM prescription in clinical practice for prevention and treatment of duodenal ulcer.

Acknowledgments

This work was funded by grants from the National Natural Science Foundation of China (grants nos. 81703920 and 81804150), China Postdoctoral Science Foundation (grant no. 2019M662790), Hunan Provincial Natural Science Foundation (grants nos. 2019JJ50442 and 2018JJ2293), Hunan Education Department's Science and Research Project (grant no. 17K069), Hunan Provincial Science and Research Project of Chinese Medicine (grant no. 201780), Research-Based Learning and Innovative Experiment Program Project for Hunan University Students (grant no. 2017280), Open-Ended Science Foundation of Institute of Innovation and Applied Research in Chinese Medicine (grant no. 201903), 121 Hunan Provincial Training Project for Innovative Talents, and National First-Class Disciple Construction Project of Chinese Medicine (grants nos. 2018ZYX20 and 2018ZYX26).

Data Availability

The data related to this research are available from the corresponding author upon reasonable request.

Conflicts of Interest

The authors declare that there are no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.

Authors' Contributions

Houpan Song and Meiyan Zeng contributed equally to this work. The work presented in this study was carried out through collaboration between all authors. Houpan Song and Meiyan Zeng performed the experiments, collected and analyzed the data, and drafted the manuscript. Xiaojuan Chen, Xinyi Chen, Jun Peng, and Ye Lin participated in the preparation of reagents, materials, and analysis tools. Rong Yu contributed in the research planning and was instrumental in the study design and data analysis. Xiong Cai and Qinghua Peng critically analyzed and discussed the data and revised and edited the final version of the article.

Supplementary Materials

Supplementary Materials Figure 1(s): UPLC chromatograms of analytical standards of syringin, liquiritin, lobetyolin, glycyrrhizic acid, 6-gingerol, atractylenolide III, atractylenolide I, and 10-gingerol (A-H) and LZD sample (I).

Click here for additional data file.

Figure 1 Diagram showing the experimental design and time course of treatment schedules for different groups.

Figure 2 Effect of LZD on the severity of duodenal lesion examined in IND-induced duodenal ulcer model in rats. Blue arrows indicate lesions. (a) Normal Control. (b) Negative control (IND). (c) ESO (4.17 mg/kg). (d) LZD (3.75 g/kg). (e) LZD (7.50 g/kg).

Figure 3 (a) Duodenal histopathology showing the protective effects of LZD on IND-induced histological alteration in rat duodenum. The circles indicate intestinal villi. The dashed circles indicate intestinal crypts. The star indicates infiltration of inflammatory cells. The arrows indicate destruction and desquamation of intestinal villi. (b). Microscopic scores in duodenal tissues of rats of different experimental groups. (c). Histographic representation of villus height change during ulceration and protection. (d). Histographic representation of crypt depth change during ulceration and protection. Vertical bars represent standard errors of the means, n = 6. Asterisks and pound signs indicate significant differences: ∗∗P < 0.01 versus normal control (NC); ##P < 0.01 versus negative control (IND).

Figure 4 Effect of LZD on duodenal mucosal PGE2 (a), IL-4 (b), IL-10 (c), and TNF-α (d) contents measured in IND-induced duodenal ulceration model. IND-induced ulcer rats were treated with either ESO (4.17 mg/kg) or LZD (3.75 and 7.50 g/kg). Results are expressed as mean ± SEM, n = 6. Asterisks and pound signs indicate significant differences: ∗∗P < 0.01 versus normal control (NC); #P < 0.05 and ##P < 0.01 versus negative control (IND).

Figure 5 Effects of LZD on levels of TLR-2 (a) and MyD88 (b) mRNA expression during prevention of IND‐induced duodenal ulceration. Levels of TLR-2 and MyD88 mRNA were determined by qRT-PCR assay. β-Actin mRNA was used as internal control for equal loading. Results are expressed as mean ± SEM, n = 3. Asterisks and pound signs indicate significant differences: ∗∗P < 0.01 versus normal control (NC); ##P < 0.01 versus negative control (IND).

Figure 6 Effects of LZD on levels of TLR-2 and MyD88 protein expression during prevention of IND induced duodenal ulceration. (a) Representative immunoblots for TLR-2 and MyD88 proteins as measured by western blot analysis using specific antibodies. Loading control was monitored by β-actin immunoblotting. Quantitative analysis derived from densitometric scans of western blots of TLR-2 (b) and MyD88 (c) proteins of duodenal mucosa. Results are expressed as mean ± SEM, n = 3. Asterisks and pound signs indicate significant differences: ∗∗P < 0.01 versus normal control (NC); ##P < 0.01 versus negative control (IND).

Figure 7 Localization of TLR-2 and MyD88 in duodenal tissues after IND administration and effect of LZD thereon. (a) Representative pictures showing the immunohistochemical analysis of TLR-2 and MyD88 in sections of duodenal mucosa obtained from rats in normal control, negative control, ESO, and LZD groups. The black arrows denote the immunopositive expression parts of TLR-2 and MyD88. Magnification 200x. (b, c) Quantitative analysis of the immunohistochemical signals as measured by IOD values. Results are expressed as the mean ± SEM (n = 3). Asterisks and pound signs indicate significant differences: ∗∗P < 0.01 versus normal control (NC); ##P < 0.01 versus negative control (IND).

Table 1 Characterization of the herbs included in Li-Zhong decoction (LZD).

Herbs	Percentage composition (%)	Identified compounds	Effects	References	
Atractylodis macrocephalae rhizoma (Bai Zhu)	25.0	Atractylenolide	Gastroprotective effects	[14–16]	
Codonopsis radix (Dang Shen)	25.0	Polysaccharide	Immunomodulatory activities	[7–9]	
Zingiberis rhizoma (Gan Jiang)	25.0	Volatile oil	Anti-inflammatory and gastroprotective effects	[17, 18]	
Glycyrrhizae radix et rhizoma (Gan Cao)	25.0	Triterpenoid, flavonoid, and polysaccharide	Anti-inflammatory, vasodilative, and immunomodulatory effects	[10–13]	

Table 2 List of primers used in qRT-PCR.

Gene	Gene bank code	Primer sequence	Size (bp)	Annealing temperature (°C)	
TLR-2	NM_198769.2	F: TGTCATGTGATGCTGCTGGTGTG	190	63.77	
R: ATTGTGTTGATTCCGCTGGACTCC	190	63.43	
MyD88	NM_198130.1	F: CGACGCCTTCATCTGCTACTGC	182	63.80	
R: CCACCACCATGCGACGACAC	182	63.97	
β-Actin	NM_031144.1	F: TGTCACCAACTGGGACGATA	165	60.00	
R: GGGGTGTTGAAGGTCTCAAA	165	60.00	

Table 3 Effect of the oral treatment with LZD on duodenal lesions induced by IND in rats (n = 10, mean ± SEM).

Treatment	Dose (mg/kg)	Ulcer index (UI)	Curative index (CI, %)	
Normal control	—	0.75 ± 0.71	97.21	
Negative control (IND)	150	26.88 ± 2.75∗∗	0	
ESO	4.17	1.50 ± 0.76##	94.42	
LZD	3750	3.88 ± 1.56##	85.57	
LZD	7500	2.25 ± 1.04##	91.63	
Asterisks and pound signs denote significant differences: ∗∗P < 0.01 versus normal control; ##P < 0.01 versus negative control.
==== Refs
1 Selmi S. Rtibi K. Grami D. Sebai H. Marzouki L. Protective effects of orange (Citrus sinensis L.) peel aqueous extract and hesperidin on oxidative stress and peptic ulcer induced by alcohol in rat Lipids in Health and Disease 2017 16 1 p. 152 10.1186/s12944-017-0546-y 2-s2.0-85027394268 28806973
2 Ganguly K. Maity P. Reiter R. J. Swarnakar S. Effect of melatonin on secreted and induced matrix metalloproteinase-9 and -2 activity during prevention of indomethacin-induced gastric ulcer Journal of Pineal Research 2005 39 3 307 315 10.1111/j.1600-079x.2005.00250.x 2-s2.0-25144509375 16150113
3 de Almeida C. L. F. Brito S. A. de Santana T. I. Spondias purpurea L. (Anacardiaceae): antioxidant and antiulcer activities of the leaf hexane extract Oxidative Medicine and Cellular Longevity 2017 2017 6593073
4 Suhaimy N. W. I. Azmi A. K. N. Mohtarrudin N. Semipurified ethyl acetate partition of methanolic extract of Melastoma malabathricum leaves exerts gastroprotective activity partly via its antioxidant-antisecretory-anti-inflammatory action and synergistic action of several flavonoid-based compounds Oxidative Medicine and Cellular Longevity 2017 2017 6542631
5 Brito S. A. de Almeida C. L. F. de Santana T. I. Antiulcer activity and potential mechanism of action of the leaves of Spondias mombin L Oxidative Medicine and Cellular Longevity 2018 2018 1731459
6 Liu W. Yang M. Chen X. Mechanisms of antiulcer effect of an active ingredient group of modified Xiao Chaihu decoction Evidence-Based Complementary and Alternative Medicine 2018 2018 5498698
7 Gao S.-M. Liu J.-S. Wang M. Traditional uses, phytochemistry, pharmacology and toxicology of Codonopsis: a review Journal of Ethnopharmacology 2018 219 50 70 10.1016/j.jep.2018.02.039 2-s2.0-85044146764 29501674
8 Deng X. Fu Y. Luo S. Polysaccharide from Radix Codonopsis has beneficial effects on the maintenance of T-cell balance in mice Biomedicine & Pharmacotherapy 2019 112 108682 10.1016/j.biopha.2019.108682 2-s2.0-85061639526
9 Fu Y. P. Feng B. Zhu Z. K. The polysaccharides from Codonopsis pilosula modulates the immunity and intestinal microbiota of cyclophosphamide-treated immunosuppressed mice Molecules 2018 23 7 10.3390/molecules23071801 2-s2.0-85055649088
10 Lian K.-X. Zhu X.-Q. Chen J. Liu G. Gu X.-L. Selenylation modification: enhancement of the antioxidant activity of a glycyrrhiza uralensis polysaccharide Glycoconjugate Journal 2018 35 2 243 253 10.1007/s10719-018-9817-8 2-s2.0-85042223867 29464423
11 Ayeka P. A. Bian Y. Githaiga P. M. Zhao Y. The immunomodulatory activities of licorice polysaccharides (Glycyrrhiza uralensis Fisch.) in CT 26 tumor-bearing mice BMC Complementary and Alternative Medicine 2017 17 1 p. 536 10.1186/s12906-017-2030-7 2-s2.0-85038107640 29246138
12 Wang X. X. Liu G. Y. Yang Y. F. Wu X. W. Xu W. Yang X. W. Intestinal absorption of triterpenoids and flavonoids from glycyrrhizae radix et rhizoma in the human Caco-2 monolayer cell model Molecules 2017 22 10 10.3390/molecules22101627 2-s2.0-85030777823
13 Zhang H. P. Zhang D. D. Ke Y. Bian K. The vasodilatory effects of anti-inflammatory herb medications: a comparison study of four botanical extracts Evidence-Based Complementary and Alternative Medicine 2017 2017 1021284
14 Song H.-P. Li R.-L. Chen X. Atractylodes macrocephala Koidz promotes intestinal epithelial restitution via the polyamine-voltage-gated K+ channel pathway Journal of Ethnopharmacology 2014 152 1 163 172 10.1016/j.jep.2013.12.049 2-s2.0-84893842958 24417867
15 Song H.-P. Li R.-L. Zhou C. Cai X. Huang H.-Y. Atractylodes macrocephala Koidz stimulates intestinal epithelial cell migration through a polyamine dependent mechanism Journal of Ethnopharmacology 2015 159 23 35 10.1016/j.jep.2014.10.059 2-s2.0-84912003710 25446597
16 Song H.-P. Hou X.-Q. Li R.-Y. Atractylenolide I stimulates intestinal epithelial repair through polyamine-mediated Ca2+ signaling pathway Phytomedicine 2017 28 27 35 10.1016/j.phymed.2017.03.001 2-s2.0-85015703013 28478810
17 Chrubasik S. Pittler M. H. Roufogalis B. D. Zingiberis rhizoma: a comprehensive review on the ginger effect and efficacy profiles Phytomedicine 2005 12 9 684 701 10.1016/j.phymed.2004.07.009 2-s2.0-23844530273 16194058
18 Jung H. W. Yoon C.-H. Park K. M. Han H. S. Park Y.-K. Hexane fraction of Zingiberis rhizoma crudus extract inhibits the production of nitric oxide and proinflammatory cytokines in LPS-stimulated BV2 microglial cells via the NF-kappaB pathway Food and Chemical Toxicology 2009 47 6 1190 1197 10.1016/j.fct.2009.02.012 2-s2.0-67349236219 19233241
19 Bessette C. Benoit B. Sekkal S. Protective effects of β-casofensin, a bioactive peptide from bovine β-casein, against indomethacin-induced intestinal lesions in rats Molecular Nutrition & Food Research 2016 60 4 823 833 10.1002/mnfr.201500680 2-s2.0-84959314308 26719048
20 Cantarella G. Martinez G. Dibenedetto G. Protective effects of amylin on reserpine-induced gastric damage in the rat Pharmacological Research 2007 56 1 27 34 10.1016/j.phrs.2007.03.001 2-s2.0-34347243568 17412609
21 Adefisayo M. A. Akomolafe R. O. Akinsomisoye O. S. Protective effects of methanol extract of Vernonia amygdalina (del.) leaf on aspirin-induced gastric ulceration and oxidative mucosal damage in a rat model of gastric injury Dose Response 2018 16 3 10.1177/1559325818785087 2-s2.0-85053420965
22 Ortaç D. Cemek M. Karaca T. In vivo anti-ulcerogenic effect of okra (Abelmoschus esculentus) on ethanol-induced acute gastric mucosal lesions Pharmaceutical Biology 2018 56 1 165 175 10.1080/13880209.2018.1442481 2-s2.0-85051635963 29513129
23 Eleje G. U. Ogbunugafor H. A. Emegoakor C. D. Efficacy and safety of Syferol-IHP for the treatment of peptic ulcer disease: a pilot, double-blind randomized trial Clinical and Experimental Gastroenterology 2019 12 21 30 10.2147/ceg.s178179 2-s2.0-85062701716 30679917
24 Zhang J. Ge L. Hill M. Standard-dose proton pump inhibitors in the initial non-eradication treatment of duodenal ulcer: systematic review, network meta-analysis, and cost-effectiveness analysis Frontiers in Pharmacology 2019 9 p. 1512 10.3389/fphar.2018.01512 2-s2.0-85065496823
25 Dahal K. Sharma S. P. Kaur J. Anderson B. J. Singh G. Efficacy and safety of proton pump inhibitors in the long-term aspirin users American Journal of Therapeutics 2017 24 5 e559 e569 10.1097/mjt.0000000000000637 2-s2.0-85029598535 28763306
26 Savarino V. Marabotto E. Zentilin P. Proton pump inhibitors: use and misuse in the clinical setting Expert Review of Clinical Pharmacology 2018 11 11 1123 1134 10.1080/17512433.2018.1531703 2-s2.0-85057244858 30295105
27 Takeuchi K. Amagase K. Roles of cyclooxygenase, prostaglandin E2 and EP receptors in mucosal protection and ulcer healing in the gastrointestinal tract Current Pharmaceutical Design 2018 24 18 2002 2011 10.2174/1381612824666180629111227 2-s2.0-85053628527 29956615
28 Akinbo F. Eze G. Combined effects of medicinal plants on induced upper gastrointestinal tract injury in wistar rats Ethiopian Journal of Health Sciences 2016 26 6 573 580 10.4314/ejhs.v26i6.11 28450774
29 Kim Y. S. Park H. J. Kim H. Song J. Lee D. Gastroprotective effects of paeonia extract mixture HT074 against experimental gastric ulcers in rats Evidence-Based Complementary and Alternative Medicine 2019 2019 3546258
30 Koc K. Cerig S. Ucar S. Gastroprotective effects of oleuropein and thymol on indomethacin-induced gastric ulcer in Sprague-Dawley rats Drug and Chemical Toxicology 2018 10 1 13 10.1080/01480545.2018.1530261 2-s2.0-85057332620
31 Miura N. Fukutake M. Yamamoto M. An herbal medicine orengedokuto prevents indomethacin-induced enteropathy Biological & Pharmaceutical Bulletin 2007 30 3 495 501 10.1248/bpb.30.495 2-s2.0-33847672758 17329845
32 Byeon S. Oh J. Lim J. S. Lee J. S. Kim J. S. Protective effects of Dioscorea batatas flesh and peel extracts against ethanol-induced gastric ulcer in mice Nutrients 2018 10 11 10.3390/nu10111680 2-s2.0-85056265548
33 Sidahmed H. M. A. Vadivelu J. Loke M. F. Anti-ulcerogenic activity of dentatin from clausena excavata Burm.f. against ethanol-induced gastric ulcer in rats: possible role of mucus and anti-oxidant effect Phytomedicine 2019 55 31 39 10.1016/j.phymed.2018.06.036 2-s2.0-85055909843 30668441
34 Danon A. Assouline G. Antiulcer activity of hypertonic solutions in the rat: possible role of prostaglandins European Journal of Pharmacology 1979 58 4 425 431 10.1016/0014-2999(79)90313-3 2-s2.0-0018574446 41725
35 Tamaddonfard E. Erfanparast A. Farshid A. A. Safranal, a constituent of saffron, exerts gastro-protective effects against indomethacin-induced gastric ulcer Life Sciences 2019 224 88 94 10.1016/j.lfs.2019.03.054 2-s2.0-85063290999 30914317
36 Lu C.-C. Sheu B.-S. Chen T.-W. Host TNF-alpha-1031 and -863 promoter single nucleotide polymorphisms determine the risk of benign ulceration after H. pylori infection The American Journal of Gastroenterology 2005 100 6 1274 1282 10.1111/j.1572-0241.2005.40852.x 2-s2.0-21344459039 15929757
37 Wong S. K. Chin K.-Y. Ima-Nirwana S. Toll-like receptor as a molecular link between metabolic syndrome and inflammation: a review Current Drug Targets 2019 20 12 1264 1280 10.2174/1389450120666190405172524 2-s2.0-85071782555 30961493
38 Jin X. Zhang M. Yang Y.-f. Saccharomyces cerevisiae β-glucan-induced SBD-1 expression in ovine ruminal epithelial cells is mediated through the TLR-2-MyD88-NF-κB/MAPK pathway Veterinary Research Communications 2019 43 2 77 89 10.1007/s11259-019-09747-x 2-s2.0-85062984887 30863917
39 Hackam D. J. Sodhi C. P. Toll-like receptor-mediated intestinal inflammatory imbalance in the pathogenesis of necrotizing enterocolitis Cellular and Molecular Gastroenterology and Hepatology 2018 6 2 229 238 10.1016/j.jcmgh.2018.04.001 2-s2.0-85048543797 30105286
40 Brown M. Hughes K. R. Moossavi S. Robins A. Mahida Y. R. Toll-like receptor expression in crypt epithelial cells, putative stem cells and intestinal myofibroblasts isolated from controls and patients with inflammatory bowel disease Clinical & Experimental Immunology 2014 178 1 28 39 10.1111/cei.12381 2-s2.0-84908206016 24828022
41 Morimoto M. Watanabe T. Yamori M. Takebe M. Wakatsuki Y. Isoflavones regulate innate immunity and inhibit experimental colitis Journal of Gastroenterology and Hepatology 2009 24 6 1123 1129 10.1111/j.1440-1746.2008.05714.x 2-s2.0-66549105907 19220665
42 Balka K. R. De Nardo D. Understanding early TLR signaling through the Myddosome Journal of Leukocyte Biology 2018 105 2 339 351 30256449
