
==== Front
J Mol Neurosci
J Mol Neurosci
Journal of Molecular Neuroscience
0895-8696
1559-1166
Springer US New York

38750341
2223
10.1007/s12031-024-02223-5
Research
Reversibility of Endoplasmic Reticulum Stress Markers During Long-Term Glucose Starvation in Astrocytes
http://orcid.org/0000-0003-3090-6682
Voelz Clara cvoelz@ukaachen.de

1
http://orcid.org/0000-0003-3408-9704
Schaack Lena E. M. 1
http://orcid.org/0000-0002-6031-2298
Kogel Vanessa 1
http://orcid.org/0000-0003-3926-2553
Beyer Cordian 1
http://orcid.org/0000-0002-0110-7980
Seitz Jochen 2
http://orcid.org/0000-0001-5719-5265
Trinh Stefanie 1
1 https://ror.org/04xfq0f34 grid.1957.a 0000 0001 0728 696X Institute of Neuroanatomy, RWTH Aachen University, Aachen, Germany
2 https://ror.org/04mz5ra38 grid.5718.b 0000 0001 2187 5445 Department of Child and Adolescent Psychiatry, Psychosomatics and Psychotherapy, University of Duisburg-Essen, Essen, Germany
16 5 2024
16 5 2024
2024
74 2 5314 12 2023
10 4 2024
© The Author(s) 2024
https://creativecommons.org/licenses/by/4.0/ Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.
Previous studies have demonstrated a brain volume decrease linked to long-term starvation in patients with anorexia nervosa (AN). Food intake is critically diminished in this disorder, leading to one of the highest mortality rates within the psychiatric disease spectrum. As reported in animal models, astrocytes seem to be the most affected cell type in AN. In a recently established primary cell culture model, an elevated unfolded protein response (UPR) was observed in long-term glucose semi-starved astrocytes. A well-functioning protein machinery is essential for every cell, and prolonged UPR will lead to cell death. As a nucleic acid stress-sensing pathway with the activator located in the endoplasmic reticulum, the regulation of the cGAS-STING pathway (cyclic GMP-AMP synthase/stimulator of interferon genes) was additionally investigated in the starvation context. In the current study, a glucose semi-starvation protocol of 15 days, during which cells were supplied with 2 mM glucose in the medium, was prolonged with an additional 6-day long recovery period. Our findings showed that increased UPR mRNA expression was reversible after re-establishing the standard glucose concentration of 25 mM. Furthermore, we were able to verify the presence of cGAS and STING in astrocytes with a characteristic presence of cGAS in the astrocyte nucleus during starvation. A correlation between STING and the glial fibrillary acidic protein (GFAP) could be established, hinting at a conditional presence of STING with a specific astrocyte phenotype.

Graphical Abstract

Supplementary Information

The online version contains supplementary material available at 10.1007/s12031-024-02223-5.

Keywords

Astrocytes
Endoplasmic reticulum stress
Unfolded protein response
Glucose starvation
cGAS-STING pathway
Anorexia nervosa
University Hospital AachenSTART (16/22) Trinh Stefanie Universitätsklinikum RWTH Aachen (8915)Open Access funding enabled and organized by Projekt DEAL.

issue-copyright-statement© Springer Science+Business Media, LLC, part of Springer Nature 2024
==== Body
pmcIntroduction

Anorexia nervosa (AN) is a severe eating disorder characterized by excessive body weight loss due to limited calorie intake. It presents with one of the highest mortality rates and insufficient recovery rates. Aetiology is complex with an involvement of genetic risk factors, and pathophysiology includes psychiatric and metabolic components (Neale & Hudson 2020). Changes are found on the hormonal level (Milos & Hebebrand 2019), as well as in an elevation of inflammatory signals (Specht et al. 2022). Cognitive impairments (Berchio et al. 2023; Seitz et al. 2021) and psychiatric comorbidities such as anxiety, depression, and obsessive-compulsive behaviours (Pruccoli et al. 2023) can occur. In patients with AN, the brain volume decreases due to starvation (Bahnsen et al. 2022; Seitz et al. 2018; Walton et al. 2022). The human brain consists of different cell types with astrocytes as the most abundant. Their functions are versatile: synapse formation, involvement in the blood-brain-barrier, and the metabolic supply of neurons (Allen and Lyons 2018). In animal models for AN, in particular, the astrocyte cell population was affected during the starvation. A decrease in cell count and cell density with a reduced glial fibrillary acidic protein (GFAP) gene expression was detected, potentially due to reduced proliferation rates (Frintrop et al. 2019; Hurley et al. 2022; Reyes-Ortega et al. 2022).

To study the cellular pathophysiology of AN, we established a semi-starvation protocol for primary astrocytes (Kogel et al. 2021). In this model, astrocytes were cultured with reduced glucose concentration in the cell culture medium. They showed a heightened unfolded protein response (UPR) without increased cell mortality. Additionally, an increased expression of pro-inflammatory genes, and a genetic and morphological shift to an activated A1-phenotype were observed. Therefore, the semi-starvation model for astrocytes proved to be a useful tool to look deeper into astrocytic implications in the context of glucose reduction and brain-related alterations in AN.

Accumulation of unfolded and misfolded proteins in the endoplasmic reticulum (ER) leads to an ER stress response and could activate different pathways of the UPR (Kaufman 2002). The UPR is a cellular adaption to restore cell homeostasis but can also lead to autophagy and apoptosis (Hetz 2012; Chipurupalli et al. 2021). There are three major UPR pathways involving the following transcription factors: X-box binding protein 1 (XBP1), activating transcription factor 4 (ATF4), C/EBP homologous protein (CHOP), and activating transcription factor 6 (ATF6) (Chipurupalli et al. 2021; Frakes and Dillin 2017; Hetz 2012) (Fig. 1). These genes had a significantly increased expression during long-term glucose semi-starvation in astrocytes (Kogel et al. 2021). Between the individual transcription factors, an interconnected activation is possible, though it should be noted that a cross-linked activation does not necessarily lead to the activation of another factor. The pathways offer a variety of interactions, depending on specific regulations. The activation of CHOP for example mediates pro-apoptotic gene induction (Rozpedek et al. 2016). Another intracellular pathway involved in sensing and mediating ER stress is the pathway of cGAS (cyclic GMP-AMP synthase) and STING (stimulator of interferon genes). The cGAS-STING pathway is known for its nucleic acid-sensing ability in the cytoplasm, mediated through cGAS (Motwani et al. 2019; Murthy et al. 2020). cGAS in turn activates STING through a second messenger. STING, located in the membrane of the ER, further activates downstream responses and initiates the activation of transcription factors.Fig. 1 Pathways of endoplasmic reticulum (ER) stress. Simplified overview of different pathways involved in ER stress and subsequent UPR. White boxes indicate pathway proteins not under investigation in the present study. Sensors of protein or nucleic acid stress can be found as pathway initiators in the ER membrane. Proteins can undergo splicing or cleavage to be activated, as indicated by a change of box shape. Pathway activation will lead to expression of transcription factors that initiate various pathway responses to restore cell homeostasis or lead to apoptosis. ATF4/6, activating transcription factor 4/6; PERK, protein kinase RNA-like ER kinase; IRE1, Inositol-requiring enzyme type 1; XBP1, x-box binding protein 1; sXBP1, spliced x-box binding protein 1; CHOP, C/EBP homologous protein; IRF3, interferon regulatory factor 3; NF-κB, nuclear factor “kappa-light-chain-enhancer” of activated B cells; cGAS, cyclic GMP-AMP synthase; STING, stimulator of interferon genes

As we have previously studied the effects of long-term glucose semi-starvation on astrocytes, this study aims to investigate the reversibility of starvation effects. After the semi-starvation period, the initial pre-experimental glucose concentration is reintroduced. Furthermore, the involvement of the cGAS-STING pathway in the cellular response to glucose semi-starvation will be elucidated. Astrocytes fulfil multiple functions within the brain and take a crucial part in supporting neurons. Therefore, impaired astrocytic function can lead to disturbances in neuronal function which in turn might contribute to cognitive impairments in patients with AN (Reville et al. 2016).

Methods

Primary Astrocyte Cell Culture

Wistar rat pups (RjHan:WI; Janvier Labs, Hannover, Germany) were used for cell cultures. Animals were kept according to the recommendations of the Federation of European Laboratory Associations (FELASA). Pups were decapitated, and brains were removed. In ice-cold HEPES buffer, the hemispheres were separated, and meninges, diencephalon, and mesencephalon were removed. Tissue was transferred to 10 mL Dulbecco’s modified Eagle medium (DMEM, Thermo Fisher Scientific, MA, USA) supplemented with 10% foetal calf serum (FCS; Thermo Fisher Scientific, MA, USA) and 50 U/mL penicillin and 50 µg/mL streptomycin (Thermo Fisher Scientific, MA, USA). Brain tissue was mechanically homogenized with 10 mL and 1 mL pipette tips and strained through a 70-µm cell strainer. After centrifugation, the supernatant was discarded, and cells resuspended in DMEM with 10% FCS. Cells were cultured in 75 cm2 cell culture flasks pre-coated with poly-L-ornithine (PLO; Sigma-Aldrich, MO, USA). Flasks were kept at 37 °C and 5% CO2. After the preparation, flasks were not moved for 4 days to assure cell adherence to the flask surface. Afterwards, medium was changed twice a week and cells were passaged 2 times (1:2–1:3) until the final passage during which cells were seeded for experiments to the corresponding PLO-coated plates. Before the first passage, non-adherent cell types were eliminated by placing the cell culture flasks in an orbital shaker for 2 h at 37 °C, aspirating the medium and adding new medium to the remaining adherent cells. Astrocyte purity was determined through regular extractions and counting of GFAP-positive cells after immunofluorescence staining to assure an astrocyte purity of 95% or higher.

Experimental Setup

Experimental treatment started 1 day after seeding the cells in standard DMEM (10% FCS). A semi-starvation protocol was previously established to provoke cell stress with a limited amount of cell death (Kogel et al. 2021). In the semi-starvation condition, cells were cultured in medium with 2 mM glucose, while the control condition was treated with a standard amount of 25 mM glucose. In both conditions, FCS was reduced to 0.5% to induce cell cycle synchronization. For the experimental medium, glucose was added to a glucose-free DMEM (Thermo Fisher Scientific, MA, USA) and then sterile filtered. Cells were kept in starvation medium for 15 days. Medium change and sample collection were performed every 3 days (Fig. 2). To test for reversibility of previously observed effects with 2 mM glucose, a recovery period of 6 days was added to the present study. During the recovery period, starting at day 15, both groups were supplied with 25 mM glucose medium.Fig. 2 Experimental study set-up. The investigated cells were primary rat cortical astrocytes. After harvesting, cells were proliferated for several weeks. Cells were seeded for experiments one day before experimental begin. The experimental protocol had a duration of 21 days with medium changed and samples taken every 3 days. In the semi-starvation period from day 0 to day 15, cells in the starvation condition were semi-starved with 2 mM glucose. In the recovery period from day 15 to day 21, cells from the starvation period were cultured with 25 mM glucose. The control condition was continuously cultured with 25 mM glucose. All conditions were cultured with 0.5% FCS. FCS, fetal calf serum; d, day

Cell Viability and Cytotoxicity Analysis

Cells were seeded with eight technical replicates on PLO-coated black 96-well plates with 15,000 cells per well. CellTiter-Blue® Cell Viability (CTB) Assay (Promega, WI, USA, G8081) was used to determine the metabolic activity of the cells. Two biological replicates were employed for this study. According to the manufacturer’s instructions, at the designated sample collection time points (Fig. 2), CellTiter-Blue® reagent was added to the cells and incubated for 2 h at 37 °C. The assay is based on the conversion of the redox dye resazurin into resorufin, a fluorescent end-product. The resulting fluorescence intensity (excitation: 560 nm, emission: 590 nm) was recorded with a Tecan infinite M200 plate reader and processed with the i-control 3.4.2.0 software (Tecan, Männedorf, Switzerland). The CytoTox 96® Non-Radioactive Cytotoxicity (LDH) Assay (Promega, WI, USA, G1782) was used to determine cell cytotoxicity. According to the manufacturer’s instructions, at the designated sample collection time points, CytoTox 96® working solution was added to wells and incubated for 30 min at room temperature. The assay is based on the quantification of extracellular LDH through the directly proportional formation of a dye. Absorbance was recorded at 490 nm with a Tecan infinite M200 plate reader and processed with the i-control 3.4.2.0 software (Tecan, Männedorf, Switzerland).

Immunofluorescence Staining

Cells were seeded on PLO-coated glass coverslips in 24-well plates with 50,000 cells per well. Cells were fixated with 3.7% paraformaldehyde (Carl Roth Karlsruhe, Germany), and cell membranes were permeabilized with 0.2% Triton X-100 (Carl Roth Karlsruhe, Germany). Unspecific binding was blocked with blocking buffer (1% BSA and 2% FCS in PBS) for 1 h. Cells were incubated with respective antibodies in blocking buffer overnight (Table 1). Then, cells were incubated with the respective secondary antibodies for 1 h and counterstained with Hoechst 33342 solution (1:10,000, Thermo Fisher Scientific, MA, USA) for 5 min. Coverslips were mounted with Epredia™ Shandon™ Immu-Mount™ (Thermo Fisher Scientific, MA, USA) onto glass slides. For picture acquisition, cells were imaged with a DMI6000 B fluorescence microscope (Leica Biosystems, Wetzlar, Germany). Table 1 Primary and secondary antibodies used for immunofluorescence staining

Primary antibody	Secondary antibody	
GFAP

goat

	Abcam

ab107159

	1:1000	Alexa Fluor goat anti-chicken 594	Life Technologies

A11042

	1:500	
GGAS

Rabbit

	Thermo Fisher Invitrogen

PA5-76-367

	1:200	Alexa Fluor donkey anti-rabbit 488	Life Technologies

A21206

	1:500	
STING

Rabbit

	Abcam

ab227704

	1:100	Alexa Fluor donkey anti-rabbit 488	Life Technologies

A21206

	1:500	

RNA Extraction and Analysis

For RNA isolation and gene expression studies, cells were seeded on PLO-coated 6-well plates with 400,000 cells per well. Four biological replicates were employed in this study. RNA was extracted by removing cell culture medium from wells and solving cells in 600 µL RNA-Solv® Reagent (Omega Bio-tek, Inc., GA, USA). The isolation is based on a phenol-chloroform phase separation, whereby the upper aqueous phase is used to extract total RNA content. RNA concentration and purity were measured with a NanoDrop 1000 spectrometer (Thermo Fisher Scientific, MA, USA). Reverse transcription to cDNA was performed with a M-MLV Reverse Transcriptase (Thermo Fisher Scientific, MA, USA) with random primer (Thermo Fisher Scientific, MA, USA) according to the manufacturer’s instructions. Semi-quantitative real-time PCRs (qRT-PCR) were performed with an AceQ SYBR Green qPCR Master Mix (Nanjing Vazyme Biotech Co, Nanjing, China) with the listed target primers (Table 2) and measured with a CFX Connect™ Real-Time system (BioRad, Feldkirchen, Germany). Data were analysed through the ΔΔCt-method. For each sample, values of the gene of interest were normalized to the relative quantity of the reference gene Cyclophilin A. Table 2 List of primers used in this study. bp = basepairs, AT = annealing temperature

ATF4	129 bp, AT: 62 °C	IRF3	75 bp, AT: 65 °C	
Sense	GCTCTTCACGAAACCCAGCA	Sense	CTCCCCTGGCTCAGGAACT	
Antisense	CCAACACTTCGCTGTTCAGGA	Antisense	CCAAGGCAAAATCAGCGGTT	
ATF6	124 bp, AT: 60 °C	Psmb8	128 bp, AT: 64 °C	
Sense	TTCTTCAACTCAGCACGTTCC	Sense	CGGGACACTACAGTTTCTCCGT	
Antisense	AGGCTTCTCTTCCTTCAGTGG	Antisense	GCCGTGCGCCATTTCAATCT	
cGAS	75 bp, AT: 65 °C	S100a10	100 bp, AT: 60 °C	
Sense	GGCCGAGACGGTGAATAAAGT	Sense	CCCTCTGGCTGTGGACAAAAT	
Antisense	ACGCCTTTGAACTCGGACTC	Antisense	AATGATGAGCCCCGCCACTA	
CHOP	108 bp, AT: 65 °C	STING1	127 bp, AT: 65°C	
Sense	TGTTGAAGATGAGCGGGTGG	Sense	GACTGCTGTCTGCCCTTTGA	
Antisense	GCTTTCAGGTGTGGTGGTGT	Antisense	GGATGGATGCAGGTTGGAGT	
Cyclophilin A	196 bp, AT: 65 °C	sXBP1	169 bp, AT: 60 °C	
Sense	GGCAAATGCTGGACCAAACAC	Sense	TGCTGAGTCCGCAGCAGGTG	
Antisense	TTAGAGTTGTCCACAGTCGGAGATG	Antisense	GCTGGCAGACTCTGGGGAAG	
IFNB1	132 bp, AT: 65 °C	tXBP1	147 bp, AT: 60 °C	
Sense	CGACTACAAGCAGCTCCAGT	Sense	GAAAGAAAGCCCGGATGAGC	
Antisense	GGGTGCATCACCTCCATAGG	Antisense	TCCCCAAGCGTGTCCTTAAC	

Protein Extraction and Analysis

Cells were seeded on PLO-coated 10 cm dishes with two million cells per dish. Four biological replicates were employed in this study. After treatment, protein isolation was started by detaching cells with trypsin. Medium was added for neutralisation. Cell suspension was collected and centrifugated at 4 °C. The cell pellets were collected and resuspended in 50 µL RIPA buffer. Protein concentration was measured with the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific, MA, USA) which was used according to manufacturer’s instructions. Protein concentration was measured with a Tecan infinite M200 plate reader and processed with the i-control 3.4.2.0 software (Tecan, Männedorf, Switzerland). For the SDS-Page, 12% (v/v) SDS-gels were used. Samples were adjusted to 20 µg protein per 20 µL reaction volume with RIPA buffer and Laemmli buffer. The Spectra Multicolor Broad Range Protein Ladder (Thermo Fisher Scientific, MA, USA) was used for band size reference. For blotting in a semi-dry setup, gels were transferred to PVDF Western blotting membranes (Roche Holding AG, Basel, Switzerland). Membranes were blocked for 1 h in 5% milk or 5% BSA depending on the solvent of the primary antibody (see Table 3). Membranes were incubated overnight with the corresponding primary antibodies. Afterwards, they were incubated with a secondary antibody for 2 h. Membranes were developed with an ECL chemiluminescence kit (Thermo Fisher Scientific, MA, USA). For evaluation of the individual protein signal, a densitometric analysis of bands was performed and later normalized to the GAPDH reference bands using the ImageJ software (NIH, Bethesda, MD, USA). For full-length western blots, please refer to Supplementary Fig. 1–3. Table 3 Primary and secondary antibodies used for Western blot

Primary antibody	Secondary antibody	
GAPDH

Rabbit

	Santa Cruz

sc-25778

	1:5,000 (in 5% milk)	IgG (H+L)-HRP (Bio-Rad)	Bio-Rad

170-6515

	1:5000 (in 5% milk)	
cGAS

Rabbit

	Thermo Fisher Invitrogen

PA-5-76367

	1:500 (in 5% milk)	IgG (H+L)-HRP (Bio-Rad)	Bio-Rad

170-6515

	1:5000 (in 5% milk)	
STING

Rabbit

	Abcam

ab227704

	1:800 (in 5% BSA)	IgG (H+L)-HRP (Bio-Rad)	Bio-Rad

170-6515

	1:5000 (in 5% milk)	

Statistical Analysis

Statistical analysis of experimental data was performed with GraphPad Prism 9.1.1 and IBM SPSS Statistics 22. Data are indicated as arithmetic mean±standard deviation unless stated otherwise. The statistical evaluation for semi-starvation and refeeding was divided; thus, two-way ANOVA was calculated on both conditions individually to only include two parameters in the comparison (time and treatment). Normal distribution was tested with the Shapiro-Wilk test. In case of non-normal distribution, a Box-Cox transformation with an adequate lambda was applied. When the data tested positive for normal distribution, statistical significance was tested with a two-way ANOVA test. A p ≤ 0.05 was considered as statistically significant. For western blot analysis, a normalization to the control group per each timepoint was performed. Therefore, a statistical evaluation was not performed.

Results

Primary rat astrocytes were subjected to reduced glucose levels for 15 days to investigate the impact on cell metabolism and stress responses. The subsequent re-supplementation of glucose for 6 days allowed the examination of reversibility of the regulatory mechanisms during starvation.

Metabolic Activity but not Cytotoxicity Was Affected

The use of a 2 mM glucose cell culture medium led to an overall reduction in cellular metabolic activity (Fig. 3). During the starvation phase, metabolic activity decreased in the semi-starved group compared to the control. Following glucose supplementation on day 15, differences in metabolic activity between the groups diminished equalizing the fluorescence absorbance between control and experimental group. A cytotoxicity assessment showed no discernible differences among the groups at all time points (data not shown).Fig. 3 Metabolic activity of semi-starved primary astrocytes. Metabolic activity was assessed with a CTB assay with eight technical replicates in two independent experiments (n = 2). Graph depicts mean ± SD

Unfolded Protein Response (UPR) Was Highly Reversible in Gene Expression

Glucose-starved cells exhibited elevated activity in genes associated with the UPR (Fig. 4). The gene expression of all UPR transcription factors followed a similar trend. When glucose was reduced in the experimental group, the UPR gene expression immediately increased at day 3 and remained elevated over the whole time of semi-starvation. The effect reached the significant threshold at the experimental time point of day 6 (p < 0.001) for ATF4 (Fig. 4A), ATF6 (Fig. 4B), tXBP1 (Fig. 4C), and sXBP1 (Fig. 4D). Notably, two variants of XBP1 were studied: the total transcript (tXBP1) and the spliced form (sXBP1), which is indicative of UPR-related transcription factor activity. When glucose was re-supplemented, the effect was reversed for all UPR factors, equalizing the experimental and the control group.Fig. 4 Unfolded protein response in semi-starved astrocytes. A, B, C, and D show relative mRNA expression of unfolded protein response markers from four independent experiments (n = 4). Graphs depict mean ± SD. Two-way ANOVA was calculated on semi-starvation period and recovery period individually. ***p ≤ 0.001, **p ≤ 0.01, *p ≤ 0.05. E shows protein, and F and G show relative normalized protein expression of unfolded protein response markers. Dots in graphs indicate replicates from independent experiments. Data was normalized to the control of each time point, and statistical analysis was not performed

On the protein expression level, the CHOP protein was only detectable in the semi-starvation condition. It was observable mainly on day 9 and day 15 in culture, but not yet on day 3, suggesting a longer pathway response time until CHOP protein formation (Fig. 4E+F). Upon glucose re-supplementation, CHOP protein levels normalized at day 18 and day 21. Protein levels of ATF4 showed a slight increase in the semi-starvation group, with no abrupt change upon glucose re-supplementation, possibly due to slower translational processes, hinting at ATF4 being more consistently expressed after glucose starvation (Fig. 4G).

STING Gene and Protein Levels and Cellular Localization

The STING signalling pathway, a mediator of intracellular DNA stress, showed subtle differences between the semi-starvation group and control group, without statistical significance (Fig. 5A–E). Glucose re-supplementation did not yield noticeable effects. ANOVA indicated an impact of the starvation period on gene expression of cGAS (p = 0.0145) and STING (p = 0.0012) during the initial 15 days. Within this experimental set-up, the expression of cGAS and STING seems to be unaffected in quantity.Fig. 5 cGAS-STING pathway in semi-starved astrocytes. A and B show relative mRNA expression of cGAS-STING pathway markers from four independent experiments (n = 4). Graphs depicts mean ± SD. Two-way ANOVA was calculated on semi-starvation period and recovery period individually. No significant difference was found in the comparison between “control” and “starvation” at the indicated time points. C shows protein, and D and E show relative normalized protein expression of cGAS-STING pathway markers. Dots in graphs indicate replicates from independent experiments. Data was normalized to the control of each time point and statistical analysis was not performed

As quantification of cGAS and STING transcription and protein alone were not able to provide further insight into pathway regulation, we investigated other pathway aspects with their position within the cell (Fig. 6). Notably, cGAS protein accumulation within the nucleus was observed exclusively during starvation, indicating a conditional nuclear presence in glucose scarcity (Fig. 6A). STING vacuoles could be observed within the cytosol of some GFAP-positive astrocytes (Fig. 6B), but no prominent STING vacuoles were observed in astrocytes with a strong GFAP-positivity (Fig. 7). Correlation analysis of GFAP and STING gene expression data revealed a negative association (r = −0.541, p = 0.046).Fig. 6 Localization of cGAS and STING within astrocytes in glucose semi-starvation. Exemplary pictures are shown from GFAP-positive astrocytes (in red) cultured with 2 mM glucose that were either coupled with cGAS (A) or STING (B) (in green). White scale bar is 50 µm; yellow scale bar is 10 µm

Fig. 7 Immunofluorescence signal of GFAP and STING. A Exemplary pictures are shown from GFAP-positive astrocytes (in red) cultured with 25 mM condition glucose. Astrocytes with a strong GFAP intensity do not display STING vacuoles (in green). White scale bar is 50 µm. B This observation is supported by the correlation of mRNA expression of STING and GFAP, demonstrating a negative correlation (r =  − 0.541, p = 0.046). The mean value of replicates was summarized in the graph. Data was collected from four independent experiments (n = 4)

Discussion

In patients with AN, weight restoration remains the primary therapeutical approach. Even though the cognitive impairments are improving after body weight increase, follow-up measurements in recovered patients still show a reduced brain volume (Seitz et al. 2018). The astrocyte semi-starvation cell culture model was established to mimic effects of glucose reduction in the brain in disorders such as AN. Previous results demonstrated that astrocytes respond to this condition with an increase in UPR markers (Kogel et al. 2021). To test for reversibility of effects, a recovery phase was now added to the model. The recovery phase demonstrated a reversal of upregulation for most of the UPR markers upon glucose recovery. In our recovery astrocyte model, not only the UPR but also the cGAS-STING pathway was studied. Here, the starvation had no observable effect on the quantitative gene and protein expression, but the organization of structures within the cell compartments changed during starvation. This observation is the basis for new research questions regarding the influence of innate immunity response and sterile inflammation to astrocytes, mediated by the cGAS-STING pathway.

The capability of astrocytes to quickly adapt to environmental alterations, including fluctuations in nutrient availability such as glucose, has been described before (Arend et al. 2019; Giovannoni and Quintana 2020). The capacity of adaptation is owed to an array of receptors on the astrocyte membrane. The receptors process signals of neurotransmitters, neuromodulators, and other signalling molecules. The glucose transporter GLUT1 senses and transports the sugar molecules across the cell membrane along a concentration gradient (Gandhi et al. 2009). When glucose is reduced, cell metabolism is changed. There is a switch towards lactate production to further maintain energy resources for neuronal cells (Arend et al. 2019). As an adaption to glucose scarcity, astrocytes are able to maintain glycogen storages, demonstrating their metabolic flexibility (Dringen et al. 1993; Dringen and Hamprecht 1993). In another semi-starved astrocytic culture, the switch from the glycolytic glucose metabolism to a lactate-based ATP production was observed within 2 days of glucose reduction (Arend et al. 2019).

The upregulation of the UPR response is a sign of cellular stress. The outcome of the UPR controls the cellular fate. ER homeostasis and folding capacity are either restored or cells undergo apoptosis if the accumulation of unfolded and misfolded proteins is not manageable (Hetz 2012; Chipurupalli et al. 2021). The present results support the idea that the reduction of glucose leads to excessive stress that influences ER function. Glucose starvation can lead to a change in intracellular metabolism pathways that affect protein folding processes. The function of the ER is closely linked to the availability of energy and metabolic substrates like glucose. If, in the absence of glucose, less ATP is produced, protein folding cannot be performed adequately and traffic within the ER will be disrupted (Depaoli et al. 2019). The observed activation of UPR upon glucose reduction reflects a connection between glucose availability, cellular metabolism, and protein folding within the ER.

The astrocyte semi-starvation cell culture model is emulating a complex eating disorder. With the help of this model, we want to investigate the reaction of astrocytes to glucose starvation. It serves to analyse astrocyte stress, modelling a static moment in cell dynamics. Neither proliferation rate nor mortality rate was shown to be affected in the model. This enables the study of the mechanisms prior to critical events such as massive cell death. Studying pathway reversibility is crucial to determine astrocyte flexibility. Uncovering pathway mechanisms susceptible to drug intervention are needed to find approaches saving the pathological phenotype observed in patients with AN. Molecular changes that have been adaptive during starvation, but that are persisting throughout recovery, might be maladaptive and could lead to a higher probability of relapse on the systemic level. The non reversibility -of ATF4 protein upregulation in our model is to be further investigated. It should be determined if this phenotype can be rescued under a prolonged recovery period. The ATF4 mRNA expression is quick to adapt, hinting at a lack of ATF4 protein degradation. CHOP protein expression on the other hand is immediately downregulated in recovery. The persistence of ATF4 protein expression might keep astrocytes more susceptible to UPR activation. This could help enforce homeostasis by activating necessary pathways towards cell survival or towards apoptosis, depending on the degree of cellular stress.

Another stress-pathway in connection with the ER is the cGAS-STING pathway. This innate immune signalling pathway plays a crucial role in detecting cytoplasmic nucleic acids (Zhang et al. 2020). Nutrient deficiency can lead to increased DNA damage and mitochondrial damage, as the organism has a decreased ability to manage reactive oxygen species (Kaliszewska et al. 2021; Kaźmierczak-Barańska et al. 2020). cGAS can be present in the cytoplasm as well as in the nucleus where it is bound by nucleosomes (Barnett et al. 2019; Michalski et al. 2020; Zhao et al. 2020). cGAS in the cytoplasmic environment can activate the cGASSTING pathway as response to nucleic acids, but cGAS in the nucleus remains inactive. In the nucleus, nucleosomes block dsDNA binding (Michalski et al. 2020; Zhao et al. 2020), but also block DNA repair (Li et al. 2022). Accumulation of unrepaired DNA damage will lead to apoptosis. cGAS can also attach to short telomeres avoiding mitotic chromosome end-to-end fusions which would lead to further aberrant DNA occurrences (Li et al. 2022).

A characteristic presence of cGAS protein in the nucleus was observed during semi-starvation. This is demonstrating a cGAS-STING pathway regulation depending on glucose concentration. The function of nuclear cGAS in this context is to be determined. Then, a lower GFAP-positivity was linked to a higher quantity of STING protein in astrocytes. The finding was confirmed through mRNA expression levels. This is hinting towards the presence of the cGAS-STING pathway in a specific astrocytic phenotype. For both cGAS and STING activity, a change in mRNA and protein quantity might not be detectable in a heterogenous astrocyte population. Furthermore, a focus might need to be put on the modulation of different pathway proteins as to shed light on cGAS-STING pathway activation during starvation.

Further studies should also focus on the intercellular dynamics of the CNS. This could include co-culturing astrocytes with neurons. Astrocytes support neurons at several levels, as through maintaining homeostasis and providing metabolic support (Bonvento and Bolaños 2021; Durkee et al. 2021). It should be clarified how alterations of the UPR and cGAS STING pathway affect astrocytes in their supporting role and consequently affect neuronal functioning.

Conclusion

Cell dynamics, like alterations in cell numbers and stress responses, are important regulatory mechanisms in the impaired brain of patients with AN. If we understand these processes and their implications on brain function, AN pathophysiology, and chronic manifestation of the illness could be addressed. In the present study, it was demonstrated that re-supplementing of glucose after a semi-starvation period led to a mostly instant reduction of UPR response. A focus can be put on processes that are differentially regulated during starvation and that cannot be reversed through re-supplementation of glucose. Hardship in recovery of patients with AN could potentially be due to persistent maladaptive pathway regulations. Those pathways could be targeted to facilitate and stabilize recovery.

Supplementary Information

Below is the link to the electronic supplementary material.Supplementary file1 (DOCX 1177 KB)

Acknowledgements

The authors would like to express their thanks for laboratory support to Helga Helten, Petra Ibold, and Florian Schmitz. The authors would also like to thank Sam Schaack and Elle Wilson for reviewing the manuscript and Adam Breitscheidel for creating the fitting illustrations.

Author Contribution

Clara Voelz: methodology, validation, formal analysis, investigation, writing — original draft, visualization. Lena E. M. Schaack: methodology, validation, formal analysis, investigation, writing — original draft, visualization. Vanessa Kogel: methodology, investigation, writing — review and editing. Cordian Beyer: conceptualization, resources, writing — review and editing, supervision. Jochen Seitz: conceptualization, writing — review and editing, supervision, funding acquisition. Stefanie Trinh: conceptualization, writing — original draft, supervision, funding acquisition.

Funding

Open Access funding enabled and organized by Projekt DEAL. University Hospital Aachen, START (16/22).

Data Availability

Datasets generated and analyzed during this study are available from the corresponding author upon reasoned request.

Declarations

Competing Interests

The authors declare no competing interests.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Clara Voelz and Lena E. M. Schaack shared first authors.

Jochen Seitz and Stefanie Trinh shared last authors.
==== Refs
References

Allen NJ Lyons DA Glia as architects of central nervous system formation and function Science (New York, N.Y.) 2018 362 6411 181 185 10.1126/science.aat0473 30309945
Arend C Ehrke E Dringen R Consequences of a metabolic glucose-depletion on the survival and the metabolism of cultured rat astrocytes Neurochem Res 2019 44 10 2288 2300 10.1007/s11064-019-02752-1 30788754
Bahnsen K Bernardoni F King JA Geisler D Weidner K Roessner V Dynamic structural brain changes in anorexia nervosa: a replication study, mega-analysis, and virtual histology approach J Am Acad Child Adolesc Psychiatry 2022 61 9 1168 1181 10.1016/j.jaac.2022.03.026 35390458
Barnett KC, Coronas-Serna JM, Zhou W, Ernandes MJ, Cao A, Kranzusch PJ, Kagan JC (2019) Phosphoinositide interactions position cGAS at the plasma membrane to ensure efficient distinction between self- and viral DNA. Cell 176(6):1432–1446.e11. 10.1016/j.cell.2019.01.049
Berchio C Annen LC Bouamoud Y Micali N Temporal dynamics of cognitive flexibility in adolescents with anorexia nervosa: a high-density EEG study Euro J Neurosci 2023 57 6 962 980 10.1111/ejn.15921
Bonvento G Bolaños JP Astrocyte-neuron metabolic cooperation shapes brain activity Cell Metab 2021 33 8 1546 1564 10.1016/j.cmet.2021.07.006 34348099
Chipurupalli S Samavedam U Robinson N Crosstalk between ER stress, autophagy and inflammation Front Med 2021 8 758311 10.3389/fmed.2021.758311
Depaoli MR Hay JC Graier WF Malli R The enigmatic ATP supply of the endoplasmic reticulum Biol Rev Cambridge Philos Soc 2019 94 2 610 628 10.1111/brv.12469 30338910
Dringen R Gebhardt R Hamprecht B Glycogen in astrocytes: possible function as lactate supply for neighboring cells Brain Res 1993 623 2 208 214 10.1016/0006-8993(93)91429-v 8221102
Dringen R Hamprecht B Differences in glycogen metabolism in astroglia-rich primary cultures and sorbitol-selected astroglial cultures derived from mouse brain Glia 1993 8 3 143 149 10.1002/glia.440080302 8225556
Durkee C Kofuji P Navarrete M Araque A Astrocyte and neuron cooperation in long-term depression Trends Neurosci 2021 44 10 837 848 10.1016/j.tins.2021.07.004 34334233
Frakes AE Dillin A The UPRER: sensor and coordinator of organismal homeostasis Mol Cell 2017 66 6 761 771 10.1016/j.molcel.2017.05.031 28622521
Frintrop L Trinh S Liesbrock J Leunissen C Kempermann J Etdöger S The reduction of astrocytes and brain volume loss in anorexia nervosa-the impact of starvation and refeeding in a rodent model Transl Psychiatry 2019 9 1 159 10.1038/s41398-019-0493-7 31164627
Gandhi GK Cruz NF Ball KK Dienel GA Astrocytes are poised for lactate trafficking and release from activated brain and for supply of glucose to neurons J Neurochem 2009 111 2 522 536 10.1111/j.1471-4159.2009.06333.x 19682206
Giovannoni F Quintana FJ The role of astrocytes in CNS inflammation Trends Immunol 2020 41 9 805 819 10.1016/j.it.2020.07.007 32800705
Hetz C The unfolded protein response: controlling cell fate decisions under ER stress and beyond Nat Rev Mol Cell Biol 2012 13 2 89 102 10.1038/nrm3270 22251901
Hurley MM Collica SC Aston SA Wiles LJ Weiner RC Biswas A Adolescent female rats prone to the activity based anorexia (ABA) paradigm have altered hedonic responses and cortical astrocyte density compared to resistant animals Appetite 2022 168 105666 10.1016/j.appet.2021.105666 34461195
Kaliszewska A, Allison J, Martini M, Arias N (2021) Improving age-related cognitive decline through dietary interventions targeting mitochondrial dysfunction. Int J Mol Sci 22(7):3574. 10.3390/ijms22073574
Kaufman RJ Orchestrating the unfolded protein response in health and disease J Clin Invest 2002 110 10 1389 1398 10.1172/JCI16886 12438434
Kaźmierczak-Barańska J, Boguszewska K, Karwowski BT (2020) Nutrition can help DNA repair in the case of aging. Nutrients 12(11):3364. 10.3390/nu12113364
Kogel V Trinh S Gasterich N Beyer C Seitz J Long-term glucose starvation induces inflammatory responses and phenotype switch in primary cortical rat astrocytes J Mol Neurosci 2021 71 11 2368 2382 10.1007/s12031-021-01800-2 33580474
Li X Li X Xie C Cai S Li M Jin H cGAS guards against chromosome end-to-end fusions during mitosis and facilitates replicative senescence Protein & Cell 2022 13 1 47 64 10.1007/s13238-021-00879-y 34676498
Michalski S de Oliveira Mann CC Stafford CA Witte G Bartho J Lammens K Hornung V Hopfner KP Structural basis for sequestration and autoinhibition of cGAS by chromatin Nature 2020 587 7835 678 682 10.1038/s41586-020-2748-0 32911480
Milos G Hebebrand J Endokrine Folgen der Anorexia nervosa Praxis 2019 108 14 899 904 10.1024/1661-8157/a003348 31662110
Motwani M Pesiridis S Fitzgerald KA DNA sensing by the cGAS-STING pathway in health and disease Nat Rev Genet 2019 20 11 657 674 10.1038/s41576-019-0151-1 31358977
Murthy AMV Robinson N Kumar S Crosstalk between cGAS-STING signaling and cell death Cell Death Differ 2020 27 11 2989 3003 10.1038/s41418-020-00624-8 32948836
Neale J Hudson LD Anorexia nervosa in adolescents Br J Hosp Med (London, England : 2005) 2020 81 6 1 8 10.12968/hmed.2020.0099
Pruccoli J Chiavarino F Nanni C Parmeggiani A General psychopathological symptoms in children, adolescents, and young adults with anorexia nervosa-a naturalistic study on follow-up and treatment Eur J Pediatr 2023 182 3 997 1007 10.1007/s00431-022-04745-9 36542163
Reville M-C O’Connor L Frampton I Literature review of cognitive neuroscience and anorexia nervosa Curr Psychiatry Rep 2016 18 2 18 10.1007/s11920-015-0651-4 26797860
Reyes-Ortega P Soria-Ortiz MB Rodríguez VM Vázquez-Martínez EO Díaz-Muñoz M Reyes-Haro D Anorexia disrupts glutamate-glutamine homeostasis associated with astroglia in the prefrontal cortex of young female rats Behav Brain Res 2022 420 113715 10.1016/j.bbr.2021.113715 34906609
Rozpedek W Pytel D Mucha B Leszczynska H Diehl JA Majsterek I The role of the PERK/eIF2α/ATF4/CHOP signaling pathway in tumor progression during endoplasmic reticulum stress Curr Mol Med 2016 16 6 533 544 10.2174/1566524016666160523143937 27211800
Seitz J Konrad K Herpertz-Dahlmann B Extend, pathomechanism and clinical consequences of brain volume changes in anorexia nervosa Curr Neuropharmacol 2018 16 8 1164 1173 10.2174/1570159X15666171109145651 29119931
Seitz J Trinh S Kogel V Beyer C Brain volume loss, astrocyte reduction, and inflammation in anorexia nervosa Adv Neurobiol 2021 26 283 313 10.1007/978-3-030-77375-5_12 34888839
Specht HE Mannig N Belheouane M Andreani NA Tenbrock K Biemann D Lower serum levels of IL-1β and IL-6 cytokines in adolescents with anorexia nervosa and their association with gut microbiota in a longitudinal study Front Psychiatry 2022 13 920665 10.3389/fpsyt.2022.920665 36061277
Walton E Bernardoni F Batury V-L Bahnsen K Larivière S Abbate-Daga G Brain structure in acutely underweight and partially weight-restored individuals with anorexia nervosa: a coordinated analysis by the ENIGMA Eating Disorders Working Group Biol Psychiatry 2022 92 9 730 738 10.1016/j.biopsych.2022.04.022 36031441
Zhang X Bai X-C Chen ZJ Structures and mechanisms in the cGAS-STING innate immunity pathway Immunity 2020 53 1 43 53 10.1016/j.immuni.2020.05.013 32668227
Zhao B Xu P Rowlett CM Jing T Shinde O Lei Y West AP Liu WR Li P The molecular basis of tight nuclear tethering and inactivation of cGAS Nature 2020 587 7835 673 677 10.1038/s41586-020-2749-z 32911481
