
==== Front
F1000Res
F1000Res
F1000Research
2046-1402
F1000 Research Limited London, UK

10.12688/f1000research.133517.3
Research Article
Articles
Exploring the moderating effects of SIRT1 and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis
[version 3; peer review: 1 approved

Ardinata Dedi Conceptualization Formal Analysis Investigation Methodology Supervision Writing – Original Draft Preparation Writing – Review & Editing https://orcid.org/0000-0002-7214-4295
a1
Sari Harahap Novita Data Curation Formal Analysis Funding Acquisition Methodology Project Administration Resources 2
Lubis Nenni Dwi Aprianti Data Curation Funding Acquisition Investigation Methodology Project Administration Validation Writing – Review & Editing 3
Nasution Tetty Aman Conceptualization Formal Analysis Investigation Methodology Validation Writing – Original Draft Preparation Writing – Review & Editing 4
1 Department of Physiology, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia
2 Department of Sport Science, Faculty of Sport Science, Universitas Negeri Medan, Medan, North Sumatra, Indonesia
3 Department of Nutrition, Faculty of Medicine, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia
4 Department of Microbiology, Universitas Sumatera Utara, Medan, North Sumatra, Indonesia
a dedi1@usu.ac.id
No competing interests were disclosed.

8 5 2024
2023
12 5107 5 2024
Copyright: © 2024 Ardinata D et al.
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access article distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background

Relationship age, hemoglobin, and physical frailty have all been investigated in older people with more than one chronic disease. There has been little analysis of the relationship between hemoglobin, age, physical frailty, plasma levels of Sirtuin1 (SIRT1), and the gene polymorphism (SNP) rs7895833 A>G. The goal of this study was to find out how SIRT1 level, SNP rs7895833, hemoglobin, age, and physical frailty (frail score) are related in older Indonesian adults with comorbid chronic diseases.

Methods

This was an observational study. Demographic and clinical data were retrieved from the electronic health records of Universitas Sumatera Utara Hospital, Medan, Indonesia. Physical frailty, SIRT1 level, and SNP rs7895833 were measured using an appropriate and valid method. Purposive sampling was used to determine the eligibility of 132 elderly adults from November 2022 to February 2023.

Results

The indirect effect of hemoglobin on the frail score (FS) through age was negative and significant, according to a conditional mediation analysis (β=-0.0731; p=0.023). Meanwhile, the direct effect of hemoglobin on the FS was negative and not significant (β=0.1632; p=0.052). According to the conditional moderated mediation analysis, the size of the direct effect of age on FS was increased by genotype AG-GG and SIRT1 level (β low=0.2647; p=0.002, β middle=0.2956; p<0.001, and β high=0.319; p<0.001). The size of the conditional indirect effect of Hemoglobin on FS through age was negative and significantly increased by SNP genotype AG-GG and SIRT1 level (β low=-0.0647; p=0.032, β middle=-0.0723; p=0.024, and β high=-0.078; p=0.02).

Conclusions

Higher plasma levels of SIRT1 and the SNP genotype AG-GG may both contribute to physical frailty in the elderly population. Hemoglobin levels in the blood fall with age, which can negatively impact older persons who already have chronic diseases. However, the interactions between these factors are intricate, requiring more study to completely understand the processes underlying development.

Hemoglobin
physical frailty
SIRT1 expression
SNP rs7895833
moderated mediation analysis.
Universitas Sumatera UtaraNo.335/UN5.2.3.1/PPM/KP-TALENTA/2022 This study was funded by the Universitas Sumatera Utara through the TALENTA scheme 2022 with contract No. 335/UN5.2.3.1/PPM/KP-TALENTA/2022. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript. Revised Amendments from Version 2

We acknowledge the importance of analyzing the impact of comorbidities and individual BMI scores on the relationships studied. However, due to the high prevalence of multiple comorbidities in our study population and the relatively small sample size in each subgroup, we were unable to conduct these analyses. This limitation has been added to the revised manuscript. Regarding the rs7895833 SNP, we have included information about its biological impacts in the background section. However, a thorough literature search did not yield specific data on the population distribution of this SNP in Indonesia and North Sumatra, highlighting a gap in current knowledge and the need for future research to investigate the prevalence and potential effects of this genetic variation in these populations. We also recognize the importance of exploring subjects' lifestyle factors, such as routine exercise and diet, which may influence plasma SIRT1 levels. Unfortunately, we did not collect detailed data on these factors, limiting our ability to analyze their potential confounding effects on the observed associations. Future research should aim to comprehensively assess and control for these lifestyle factors to better understand their impact on SIRT1 levels and the relationships examined in this study. Despite these limitations, we believe that our core conclusions remain valid. However, we agree that addressing these factors could further improve our introduction, method, and discussion sections, particularly in terms of the study's limitations. We appreciate the reviewer's valuable input and hope that our responses adequately address their concerns.
==== Body
pmcIntroduction

Frailty has a yearly incidence rate of 4.34%, with a global prevalence rate of 13.6% among older adults. 1 In Indonesia, however, the number of people aged 60 and older was 18.1 million in 2010, representing 7.6% and is projected to rise to 33.7 million by 2025 and 48.2 million by 2035. 2

Among older adult residents, it has been shown that the prevalence of multimorbidity is between 55 and 98%, anemia was within 19 and 76%, and frailty is around 70 and 93%. 3 – 5 According to the literature, older adults who have more chronic diseases are more vulnerable to the risk developing anemia. 6 Anemia and frailty in older adults were found to be correlated, according to a systematic review and meta-analysis of observational studies. 7 Some cross-sectional studies indicate a relationship between older adults’ frailty and hemoglobin levels. 8 , 9 The following hypothesis is therefore proposed: Hypothesis 1 (H1): Hemoglobin is negatively related to FS.

The aging process or the presence of comorbidities are associated to the development of frailty. 10 Frailty and age-related chronic diseases are not only often associated, but one increases the risk of the other, suggesting a bidirectional association between frailty and comorbidity aging-related disorders. 11 , 12 The pathobiology of aging relates chronic disease, multimorbidity, and frailty, and this knowledge provides criteria for diagnosis and management approaches. 13 Able to follow is the hypothesis: Hypothesis 2 (H2): Age is positively related to FS.

Hemoglobin is a protein found in red blood cells that carries oxygen throughout the body. 14 Low hemoglobin levels, known as anemia, are a common condition in older adults and can be caused by a variety of factors, including nutritional deficiencies, chronic diseases, and medications 15 which can lead to a decrease in physical function and an increased risk of frailty. Age is a major risk factor for physical frailty 16 , 17 which is defined as a state of decreased physiological reserve and increased vulnerability to stressors. 18 As people age, they may experience declines in muscle mass and strength, balance and coordination, and cardiovascular and respiratory function, which can contribute to physical frailty. 19 Based on the preceding considerations, the following hypothesis is proposed: Hypothesis 3 (H3): Age mediates the relationship between hemoglobin and FS.

Previous studies have indicated that the SIRT1 SNP rs7895833 is located in the promoter region of the SIRT1 gene, about 21kb upstream of the coding region. 20 Its location in the promoter suggests that it could influence SIRT1 gene expression levels. Altered SIRT1 levels caused by the SNP could dysregulate these processes and lead to much worse health outcomes, including chronic obstructive pulmonary disease, 21 cardiovascular diseases, 22 oxidative stress, 23 essential hypertension and type 2 diabetes mellitus, 24 coronary artery disease, 25 rheumatoid arthritis, 26 dyslipidaemia, 27 metabolic syndrome, 28 rheumatoid arthritis, 29 and neurodegenerative disease. 30 There was limited research on the specific interaction between SIRT1 SNP rs7895833, hemoglobin, age, and physical frailty. However, it is possible that these factors may be related to each other through various biological pathways.

SIRT1 has been related to both frailty and deteriorating health outcomes. However, other investigations have produced inconsistent results. Using Fried’s criteria, there was no consistent correlation between SIRT1 and frailty in older people living in the community, 31 and there was no correlation between frailty and serum-induced SIRT1 expression. 32 Participants in the lowest quintile had a lower likelihood of being weak, but serum-induced SIRT1 expression was not related to age or mortality. 33 Kumar et al., found frail people’s serum sirtuin levels (SIRT1 and SIRT3) were much lower than those of non-frail persons. 34 Frail older adults had higher levels of SIRT1 than robust older adults. 35

Even though the relationship of age, hemoglobin, and frailty in older adults has been studied, there is currently limited studies on the association of these three variables with plasma levels of SIRT1 and the SNP genotype rs7895833 in elderly adults with chronic disease comorbidity. As a consequence, we come to the following hypothesis: Hypothesis 4 (H4): SNP genotype AG-GG and plasma levels of SIRT1 negatively moderates the effect of hemoglobin on FS through age as a mediator.

The purpose of this study was to investigate the effects of plasma levels of SIRT1 and the SIRT1 SNP rs7895833 A>G in the promoter region on the relationship between hemoglobin, age, and frailty in Indonesian older adults with chronic diseases comorbid.

Methods

This study follows ‘A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies (AGReMA) 36 and The Strengthening the Reporting of Observational studies in Epidemiology (STROBE). 37

We conducted observational (cohort) studies of the moderated mediation analyses to find any potential causal effects. The mediator role of age in the association between hemoglobin level and frail scale score is explained by plasma levels of SIRT1 and the NSP rs7895833 genotype serving as moderating variables.

The study included 132 older adults who were scheduled to receive outpatient care at the Universitas Sumatera Utara Hospital in Medan, Indonesia, and who met the study criteria: men and women over the age of 60 with a complete electronic health record of laboratory and clinical data, as well as having chronic diseases one year prior. There are no mental or physical disorders that are interfering with their capacity to respond to questionnaire questions. A purposive sampling approach was used to choose the study subjects. The sample size was determined using the following formula 38 : n=Z1−α∕22p1−pd2

Z 1-α/2 2/22 (type I error 5%)=1.96, expected proportion in population based on previous studies (p)=18.7%, 39 absolute error/precision (d)=0.05.

Measurements

Sociodemographic, clinical, and laboratory data

We used sociodemographic, clinical, and laboratory data results from an electronic health record database after clinical diagnoses were determined for each subject one year ago.

Frailty assessment

The physical frailty phenotype was assessed that used the frailty scale score. During face-to-face interviews with the patients, trained nursing staff used the Indonesian version of the FRAIL scale, which has been proven to be a reliable and valid screening tool for frailty syndrome assessment. 40 The FRAIL scale (FS) consists of five components: fatigue, resistance, ambulation, sickness, and weight loss. The FRAIL scale scores range from 0 to 5 (one point for each component; 0 represents best to 5 represents worst) and indicate robust (0), pre-frail (1 to 2), frail (3 to 5). The physical frailty phenotype was also treated as a continuous variable, ranging from 0 to 5, in the study.

Blood sampling

Blood samples were collected from each subject in line with approved protocols. Subjects were instructed to fast for at least 8 hours before blood collection, which took place between 8:00 and 10:00 a.m. Professional phlebotomists collected 2 mL of blood in tubes containing EDTA using a predefined method.

Blood processing and DNA isolation

The collected blood samples were immediately processed for plasma separation. Plasma samples were aliquoted and stored at -80°C until analysis. Genomic DNA was extracted from the residual white blood cells using a DNA isolation kit (Wizard ®, Madison, USA, A1120) and the manufacturer’s instructions. All pure DNA samples were kept at 2-8°C until PCR was used for SIRT1 genotyping.

SIRT1 assay

The plasma levels of SIRT1 was determined by a monoclonal antibody-based ELISA method using a commercially available human SIRT1 ELISA kit (Elabscience ®, Houston, USA, E-EL-H1546). Microtiter plates were coated with an antibody specific to human SIRT1. 100 μL standard and plasma samples were pipetted into the appropriate wells, and the protocol was followed by using a secondary antibody and then avidin conjugated horseradish peroxidase. The formation of horseradish peroxidase was measured using ELISA reader (Thermo Fisher Scientific, Finland) at 450 nm. Seven different concentrations of purified SIRT1 (20, 10, 5, 2.500, 1.250, 0.630, and 0.31 ng/mL) were used to plot a standard curve. The inter- and intra-assay coefficients of variation were 4.04% and 4.55% respectively, with a detection range of 0.31–20 ng/mL.

Determination of SIRT1 gene polymorphisms

The single nucleotide polymorphism (SNP) rs7895833 was selected because it is one of the most frequent polymorphisms in the SIRT1 gene, and has been associated frailty and several diseases.

SIRT1 rs7895833 A>G in the promoter region 41 were analysed using polymerase chain reactions with two-pair primers (PCR-CTPP) assay with minor modifications. 42 The SIRT1 gene encompassing rs7895833 A>G, polymorphic sites were amplified by PCR using the primers. 41 Briefly, 25 ml total PCR mixtures containing 100–200 ng DNA, 10.0 pmol of each primers, 1.0 mM dNTP (deoxynucleotide triphosphates), 25 mM MgCl2 and 2.5U Taq DNA polymerase in the supplied reaction buffer (Taq Buffer with (NH 4) 2SO 4) were prepared. PCR was performed with the primers were the following:

Forward primer 1: CCCAGGGTTCAACAAATCTATGTTG

Forward primer 2: CCCAGGGTTCAACAAATCTATGTTG

Reverse primer 1: GCTTCCTAATCTCCATTACGTTGAC

Reverse primer 2: CCTCCCAGTCAACGACTTTATC

with the initial denaturation at 95°C for 10 min.; 30 cycles of 95°C for 1 min., 64°C for rs7895833 A>G polymorphism, PCR products were visualized on a 2% agarose gel with ethidium bromide staining and genotyped. The genotypes for polymorphism were defined by 3 distinct banding patterns ( Figure 1); for rs7895833 AG polymorphism: 320, 241 bp for AA genotype; 320, 241 and 136 bp for AG genotype; and 320, 136 bp for GG genotype. 41

Figure 1. SIRT1 SNP rs7895833 A>G representative PCR gel electrophoresis images.

Statistical evaluation

Hardy–Weinberg equilibrium tests were performed with Hardy-Weinberg Equilibrium online calculator.

All statistical analyses were carried out using statistical tool jamovi ver.2.3. and the significance was set at p<0.05 (two-tail). Descriptive statistics were used to examine all of the subject’s characteristics. Normally distributed variables were reported using means and standard deviations, while non-normally distributed ones were summarized with medians and ranges. Qualitative variables were described using the numbers of events and frequencies.

The correlation plot (Qgraph) created with jamovi’s seolmatrix. This module was used to determine how the potential major variables interacted with one another. 43

The jAMM GLM Mediation Model was used to analysis the conditional process. The conditional process analysis to determine how much more the mechanism(s) by which an effect operates is conditional on or varies depending on the nature, environment, stimulus, or individual variations. 44 Mediation and moderation could be integrated analytically as a conditional process model in a variety of ways, depending on which step of the mediation process is moderated, the number of mediators, the number of moderators, and whether or not the direct effect is likewise moderated. 45

Mediating effect

An analysis of mediation was investigated to assess if age mediated the relation between hemoglobin level and frail score. This model was used to determine if hemoglobin and frail score had a considerable indirect influence. When mediator variables are included, the direct effect is diminished but still statistically significant; this effect is known as “partial mediation”. Complete mediation shows that the direct effect is no longer significant when mediator variables have been included. 46

Moderating effect

A subgroup evaluation was carried in the multiple-mediation model to see whether there was a moderating effect on simple pathways. It was considered that the existence of the moderation effect in this path was shown by the statistically significant difference in the path coefficient between the two variables. 47

Moderated mediation

Testing for mediation effects in each subgroup will lead in a biased estimated parameter and low statistical power, in accordance with Edwards’ hypothesis. The estimated parameters, including the total, indirect, and direct effects of the moderated mediation model, were conducted by integrating moderation and mediation models. Subgrouping analysis was solely used to test which path the moderator affected. 48 , 49

Before testing all mediational hypotheses, conditional process analysis depicting all interactions was developed using the general linear mediation model (i.e., the GLM mediation model) with factor coding “dummies” for genotypes AA=0 and AG-GG = 1 and covariates scaling “standardized” for hemoglobin level and plasma levels of SIRT1. A standard (delta method) procedure that leverages the approximation from the central limit theorem 50 was used to test the significance of the total and indirect effects, and the coefficient confidence intervals were deemed statistically significant if they did not include zero.

Ethical considerations

This study was authorized by the Universitas Sumatera Utara Health Ethical Committee under the number 1097/KEPK/USU/2022. Each participant completed a structured questionnaire after signing informed consent, which included questions about their demographics, level of physical frailty (Frail scale), and willingness to submit a blood sample. The Declaration of Helsinki ethical principles were followed during the study’s conduction.

Results

Hardy–Weinberg equilibrium tests

The genotypic frequencies of the SNP rs7895833 A>G in the SIRT1 gene were not in accordance with those expected by Hardy-Weinberg equilibrium in the current investigation, confirming a previous study. 51 We looked at several possibilities: first, we evaluated the possibility of recruiting bias. Second, faults in the real-time PCR genotyping experiment. In each batch, however, proper controls were applied, and the probes used were definitely capable of discriminating between genotypes. Third, the Hardy-Weinberg departure occurred by chance since the observed and expected genotype frequency variations were minimal.

Characteristics of the study’s subjects

This study included 132 eligible subjects. More than half of the participants were female (51.5%). The median age was 65 (range: 60 to 85), and the FS was 1 (range: 0 to 3). Meanwhile, the mean hemoglobin level was 12.35 (±1.8) mg/dL, and the plasma SIRT1 level was 57.1 (±32.3) ng/ml. Table 1 shows the study subjects’ detailed characteristics.

Table 1. Demographic, clinical and genotype characteristics of elderly adults with multimorbid (n=132).

Characteristics		Characteristics		
Age (year)	65 (60-85) a	Comorbidities		
Sex (Female)	68 (51.5) b	Diabetes mellitus	82 (62.12) b	
Frail score	1 (0-3) a	Cardiovascular disease	81 (61.36) b	
%BMI loss 1 year	2.06 (-12.2 – 24.6) a	Hypertension	58 (43.94) b	
Sirtuin1 plasma level (ng/ml)	57.1 (32.3) c	Arthritis	49 (37.12) b	
Systolic Blood Pressure (mmHg)	138.5 (21.7) c	Stroke	35 (26.52) b	
Diastolic Blood Pressure (mmHg)	75.13 (10.81) c	Chronic lung disease	23 (17.42) b	
Hemoglobin (g/dL)	12.35 (1.8) c	Chronic kidney disease	17 (12.88) b	
Fasting blood glucose (mg/dL)	120 (83 – 420) a	Cancer	7 (5.30) b	
HbA1c (%)	7.95 (2.49) c	Genotype rs7895833		
Total cholesterol (mg/dL)	195.18 (43.89) c	AA	16 (12.1) b	
Triglyceride (mg/dL)	132 (53 – 669) a	AG	79 (59.8) b	
High-density lipoprotein (mg/dL)	45 (20-445) a	GG	37 (28.0) b	
Low-density lipoprotein (mg/dL)	133.74 (42.19) c	AG-GG	116 (87.9) b	
Blood urea nitrogen (mg/dL)	20.3 (5.9 – 114.5) a	AA-AG	95 (72.0) b	
Creatinine (mg/dL)	0.9 (0.1 – 15.1) a	Allele rs7895833		
		A	111 (42.05) b	
		G	153 (57.95) b	
a Median (min–max).

b n (%).

c Mean (±SD).

The interrelationship between the potential main variables

There was a negative relationship between hemoglobin levels and FS (r=-0.236, p=0.006). The age yielded similar results (r=-0.259, p=0.003). Meanwhile, age was also shown to have a significant positive association with FS (r=0.325, p=0.006) but a negative correlation with SIRT1 (r=-0.192, p=0.027). There were no statistically significant correlations or relationships detected between the SNP genotypes AA, AG-GG and any of the covariates ( Figure 2).

Figure 2. The correlation plot of the interrelationship between the potential main variables.

Hb (Hemoglobin); SIRT1 (Sirtuin1); Frail score (frailty); genotype (AA, AG-GG). Spearman's rank correlation with two tail significant: *p<0.05, **p<0.01, ***p<0.001.

Hypothesis testing

According to Baron and Kenny’s 47 criterion, there are three conditions for the existence of mediating role: 1) there is a significant correlation between independent variable (hemoglobin) and dependent variable (physical frailty); 2) there is a significant correlation between independent variable (hemoglobin) and mediating variables (age); 3) finally, the regression coefficients of independent variables (hemoglobin) and mediating variable (age) are simultaneously regressed to the dependent variable (physical frailty), the coefficient of mediator should be significant and the coefficient of independent variable become non-significant (complete mediation) or reduced (partial mediation).

Figure 2 depicts them in accordance with the partial correlation’s results. It can be seen that hemoglobin and FS had a moderately strong negative relationship (r=-0.236, p=0.006), and that age and FS had a moderately strong positive relationship (r=0.325, p<0.001). Therefore, the first and second conditions are satisfied. Hence, H1 and H2 were accepted.

The mediating effect of age

Mediation analyses for direct effects, indirect mediation by age, and total effects are provided in Figure 3A and Table 2. When age was included in the model, the following occurred: The direct effect of hemoglobin on FS was negative and non-significant (β=-0.1632, p=0.052). The indirect effect or indirect mediation of hemoglobin on FS was negative and significant (β=-0.0731, p=0.023) and the total effect was negative and significant (β=-0.2363, p=0.005). As a consequence, we may conclude that age completely mediates the negative relationship between hemoglobin and FS, with a significant model mediation effect of 13% (R 2=0.13, p=0.001, F=9.68). As a result, H3 was accepted. This result reveals that lower hemoglobin levels may lead to physical frailty and that this effect was totally influenced by the increasing age of an elderly adult with comorbid chronic diseases.

Figure 3. A conceptual diagram that shows hypothesized interactions between variables study; (A) Mediation model, (B) Moderated mediation model with two moderators.

Table 2. The mediation effect of age between hemoglobin and frail score.

Age	ab	a	b	c’	c	
	-0.0731; 0.023	-0.2587; 0.002	0.2828; <0.001	-0.1632; 0.052	-0.2363; 0.005	
Full model effect	R 2	F	p			
	0.13	3.43	0.004			
n=132. ab=mediated or indirect effect of hemoglobin on frail score through age, a =path from hemoglobin to age, b =path from age to frail score (controlling for hemoglobin), c' =direct effect from hemoglobin to frail score (controlling for age), c =total effect of hemoglobin on frail score (ab + c’). Confidence intervals computed with method: Standard (Delta method). Betas are completely standardized effect sizes. Value expreting on β; p.

Moderated mediation relationship

The moderated mediation model was then put to the test. The SNP genotypes (AA and AG-GG) and SIRT1 were integrated into this model ( Figure 3B and Table 3). Conditional moderated mediation was assessed at levels of SIRT1 of 25% (low), 50% (middle), and 75% (high) and SNP genotypes of AA and AG-GG. We noted the following: The size of the conditional direct effect of age on FS was moderately positive and significantly increased by SNP genotypes AA and SIRT1 level (β middle=0.1828, p=0.034 and β high=0.2087, p=0.015). Whereas by genotype AG-GG and SIRT1 level (β low=0.2647, p=0.002, β middle=0.2956, p<0.001, and β high=0.319, p<0.001). The size of the conditional direct effect of hemoglobin on FS was moderately negative but non-significant by SNP genotypes AA, AG-GG, and all SIRT1 levels. The size of the conditional indirect effect of hemoglobin on FS through age was moderately negative and significantly increased by SNP genotypes AG-GG and SIRT1 level (β low=0.2647, p=0.002, β middle=0.2956, p<0.001, and β high=0.319, p<0.001). The total effect was negative and significant (β=-0.2246, p=0.008). such that the conditional negative indirect effect of hemoglobin on FS completely through age becomes stronger when the SNP genotype was AG-GG and levels of SIRT1 increase (moderated mediation). The SNP genotype and SIRT1 have a 14.1% moderated mediation effect (R 2=0.141, p=0.004, F=3.43) Therefore, H4 was accepted. The study may have found that individuals with the AG-GG genotype and higher levels of SIRT1 may experience a stronger negative indirect effect of hemoglobin on physical frailty, compared to individuals with the AA genotype and lower levels of SIRT1. According to these analyses, decreased hemoglobin levels can lead to physical frailty, and this effect is completely mediated by age, through the SNP genotype AG-GG and elevated SIRT1 levels in elderly adults with comorbid chronic diseases.

Table 3. The moderation effects of SNP genotypes AA, AG-GG, and SIRT1 between hemoglobin and frail score through age as mediation variables.

Genotype * SIRT1	ab	a	b	c’	c	
AA * 25%	-0.0364; 0.137	-0.2444: 0.003	0.149; 0.085	-0.1633; 0.063	-0.2246: 0.008	
AA * 50%	-0.0447; 0.085	-0.2444: 0.003	0.1828; 0.034	-0.163; 0.064	-0.2246: 0.008	
AA * 75%	-0.051; 0.061	-0.2444: 0.003	0.2087; 0.015	-0.1625; 0.064	-0.2246: 0.008	
AG-GG * 25%	-0.0647; 0.032	-0.2444: 0.003	0.2647; 0.002	-0.1608; 0.055	-0.2246: 0.008	
AG-GG * 50%	-0.0723; 0.024	-0.2444: 0.003	0.2956; <0.001	-0.1594; 0.058	-0.2246: 0.008	
AG-GG * 75%	-0.078; 0.02	-0.2444: 0.003	0.319; <0.001	-0.1581; 0.061	-0.2246: 0.008	
Full model effect	R 2	F	p			
	0.141	3.43	0.004			
n=132. ab=mediated or indirect effect of hemoglobin on frail score through age, a =path from hemoglobin to age, b =path from age to frail score (moderated by genotype and SIRT1, and controlling for hemoglobin), c' =direct effect from hemoglobin to frail score (controlling for age), c =total effect of hemoglobin on frail score (ab+c’). Confidence intervals computed with method: Standard (Delta method). Betas are completely standardized effect sizes. Value expreting on β; p.

Discussion

In terms of physical frailty, the current research was conducted in a moderated-moderated mediation or conditional moderated mediation relationship. Hypotheses have been created based on the conceptual model in Figure 1 and the findings of prior studies. The findings supported each of the research hypotheses. The model provided the five variables that supported our conceptual model.

A recent study revealed that the relationship between low hemoglobin levels and physical frailty in older adults with one or more chronic diseases was affected by the age.

Age is a major risk factor for physical frailty, 16 , 17 which is defined as a state of decreased physiological reserve and increased vulnerability to stressors. 18 As people age, they may experience declines in muscle mass and strength, balance and coordination, and cardiovascular and respiratory function, which can contribute to physical frailty. 19

Low hemoglobin levels, also called anemia, is a condition in which the number of red blood cells or the amount of hemoglobin in the blood drops. This usually happens in older adults. Causes of anemia in older adults include nutritional deficiency, chronic kidney disease, chronic inflammation, and occult blood loss from gastrointestinal malignancy, although in many patients the aetiology were unknown. 8 , 52 – 54 Previous studies have shown that the prevalence of physical frailty increases with age, and that low hemoglobin levels are also more common in older adults. 53 , 55 In addition, there is evidence to suggest that low hemoglobin levels are a risk factor for physical frailty, as anemia can lead to reduced physical function and decreased muscle mass.

According to the study, low hemoglobin levels and physical frailty were related. Age completely mediated the effect of low hemoglobin levels on physical frailty, indicating that the relationship between these two variables was only significant when age was excluded. This study further showed that age completely mediated this effect and that SNP genotype AG-GG and high SIRT1 levels further moderated this effect in elderly adults with comorbid chronic diseases. This showed that the following two factors, including the existence of comorbid chronic diseases and a specific genetic variant (AG-GG) of SNP SIRT1, further moderated the relation between low hemoglobin levels and physical frailty. The correlation between low hemoglobin levels and physical frailty, in particular, may have depended on the levels of SIRT1, a protein involved in cellular metabolism, among older adults with comorbid chronic diseases and the AG-GG genotype.

There was a complex interaction between hemoglobin levels, physical frailty, age, and genetic factors that could have big effects on older people with chronic conditions. The blood contained the important protein hemoglobin, which was responsible for carrying oxygen from the lungs to the body’s tissues and organs. 56 Decreased hemoglobin levels can lead to anemia, which can cause fatigue, weakness, and physical frailty.

Physical frailty is a common concern for elderly people, and it is a complex condition affected by several factors, including age, chronic diseases, life styles, and heredity. Studies have shown that elderly adults, particularly those with chronic diseases, who have low hemoglobin levels are more plausible to become physically frail. 57 – 59

Furthermore, genetic factors may contribute to the development of physical frailty in elderly adults. The SIRT1 SNP rs7895833 A>G is closely associated with an increased risk of developing chronic diseases., such as cardiovascular disease, 22 , 25 chronic obstructive pulmonary disease, 21 Parkinson’s disease, 60 type 2 diabetes mellitus, 61 rheumatoid arthritis. 29 These chronic diseases can contribute to the development of physical frailty in elderly adults by reducing muscle mass, strength, and function 11 , 62 and also anemia. 63

SIRT1, a protein that protects cells from oxidative stress, controls glucose and lipid metabolism, and increases DNA integrity by binding to and deacetylating numerous substrates, may also have a role in physical frailty. 64 , 65 SIRT1 is regarded to be one of the potential molecules for promoting healthy aging because of its protective activities against numerous age-related diseases. Some studies have suggested that SIRT1 levels decrease with age; according to several studies, SIRT1 has been studied for its potential role in aging and age-related diseases. 23 , 66 , 67 Additionally, it is well known that it alters skeletal muscle metabolism and function, two major considerations in physical frailty.

There were few studies on the role of SIRT1 in iron metabolism related anaemia of chronic disease or anaemia of inflammation that decreases plasma iron with suppression of erythropoiesis. A study showed that activating SIRT1 can reduce iron accumulation in splenic macrophages by inhibiting hepcidin. 68 This suggests that SIRT1 may inhibit ferroptosis by reducing intracellular iron levels. Another study showed that Intestinal SIRT1 deficiency improved iron metabolism in ethanol-induced liver injury in mice, reducing ferroptosis in hepatocytes. 69

There are still not many studies that show what role the SNP rs7895833 A>G, especially genotype AG-GG, plays in the activity of SIRT1 in older adults. The patients with the wild-type (AA) genotype had a significantly higher level of SIRT1 protein and a significantly lower level of endothelial nitric oxide synthase (eNOS) expression. Patients with the heterozygote mutant (AG) genotype also had a significantly higher level of SIRT1 protein, but eNOS expression was not significantly different. 22 Kilic et al., who observed that older people carrying both the wild-type (AA) genotype and the heterozygote (AG) genotype had significantly higher SIRT1 expression levels in plasma, while older people carrying the heterozygote mutant (AG) genotype had a significantly higher SIRT1 level compared with older people carrying the wild-type (AA) genotype. 23

As was already mentioned, the NSP rs7895833 A>G affects the expression of the SIRT1 gene. It can impact the expression of the SIRT1 gene because it is located in the promoter region, 21 kb upstream of the gene. Thus, the activity of SIRT1 appears to be regulated by a promoter-dependent change in expression mechanism, which may have an impact on the elderly’s metabolism or the progression of neurological disease. Chromatin and transcription are regulated by SIRT1, linking NAD+ signaling and metabolism to the regulation of cellular activities. 70

Limitations

This study has established moderated mediation analysis among the drivers of physical frailty in elderly adults with comorbid chronic diseases, but it is not without limitations. Some limitations of the present study should be noted: The study used an observational (cohort) design and studied only elderly individuals from a university hospital, which may constitute a selection bias, meaning that we may not have been able to establish a causal relationship between the variables of interest. Another constraint of the study is the sample size, which was insufficient to detect all associations with the other studied variables and could limit the generalizability of the results. Other factors, such as multi-comorbidity, BMI, lifestyle habits (including routine exercise, diet, etc.), environmental factors, and medications, could have influenced the results, and we may not have accounted for these variables. However, our findings are supported by previously published literature; several studies with probabilistic samples and a greater number of individuals reported changes in physical frailty in relation to hemoglobin, age, the polymorphism rs7895833, involving genotype AG-GG, and plasma SIRT1 levels.

Conclusion

The present study emphasizes the nuanced interaction of biological variables, especially SIRT1 plasma levels, NSP rs7895833 genotype, and age, in influencing physical frailty in elderly people with chronic diseases. Our findings suggests that SIRT1 levels and genotype modify the effect of age on frailty.

Acknowledgments

We would like to thank all the patients and Laboratory staffs in an integrated laboratory faculty of Medicine, Universitas Sumatera Utara and Universitas Sumatera Utara Hospital who participated in the study.

Data availability

Underlying data

Figshare: Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis, https://doi.org/10.6084/m9.figshare.22492603.v2. 71

Data are available under the terms of the Creative Commons Attribution 4.0 International license (CC-BY 4.0).

10.5256/f1000research.164941.r253713
Reviewer response for version 2
Semadhi Made Putra 12Referee https://orcid.org/0009-0002-0877-4548

1 Padjadjaran University, Sumedang, Indonesia
2 Prodia National Reference Laboratory, Jakarta, Indonesia
2 5 2024 Copyright: © 2024 Semadhi MP
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 2recommendationapprove-with-reservations
For the methodology,

1. It would be clearer if the author divided the subject into each comorbid/chronic disease. Because the influence of previous clinical conditions/chronic diseases cannot be completely ruled out and may interfere with the results. Diabetes, Kidney Disease, Liver Disease, Hypertension, Sarcopenia, Muscle and bone problems etc. can have different impacts on the subject. It is recommended for the author to expand the relationship analysis, explanation and discussion through this clinical condition.

2. For better analysis, authors should ensure that all subjects are in homogeneous BMI groups, or if subjects have different BMI scores, it would be better if those BMI scores are used as analytical groupings. Previous studies have shown that BMI may have a correlation with plasma SIRT1 levels and that this would impact the results.

3. Please add some information about SNP rs7895833 A>G in the background as well as in the discussion (pathological pathway/cascade). It would be interesting if the author could include broader information regarding the biological impacts associated with this SNP also on population distribution in Indonesia/North Sumatra.

4. It would be better if the author could provide or explore more explanations about the subject's activities (routine exercise, eating/diet, etc.) apart from assessing the weakness score. This activity may interfere with plasma SIRT1 levels as a critical variable.

5. In addition to completing number 4, the author must ensure that blood sampling for SIRT1 in all subjects is carried out under homogeneous conditions

6. The conclusions drawn will be broader following additional updated explanations

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Yes

Are all the source data underlying the results available to ensure full reproducibility?

Partly

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Partly

Reviewer Expertise:

Biochemistry and Geriatrics

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

10.5256/f1000research.146512.r253712
Reviewer response for version 1
Singh Amit 1Referee
1 LMBI, National Institute on Aging, Baltimore, Maryland, USA
4 4 2024 Copyright: © 2024 Singh A
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
The author(s) is/are employees of the US Government and therefore domestic copyright protection in USA does not apply to this work. The work may be protected under the copyright laws of other jurisdictions when used in those jurisdictions.
Version 1recommendationapprove-with-reservations
Report for Ardinata et al.- Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis.

Ardinata et al claim to study the effects of SIRT1 protein expression and the associated SIRT1 promoter SNP in Indonesian older adult cohort. They further correlated these levels with hemoglobin, age, and frailty with chronic diseases comorbid. Study emphasize the known SIRT1 effects in interesting cohort and will be useful for aging related studies.

Study lacks in following areas and should be updated accordingly.

Authors claim SIRT1 levels and its relationship with various parameters. It should be corrected in title and also in text that these are plasma levels of SIRT1 not cellular protein. Explanation of plasma source of SIRT1 should be provided.

Manuscript holds just one data figure of genotyping gel. In genotyping gel image the marker lane is labelled as 50bp ladder, first, the marker bands are not clear and second if we follow the marker bands (which should be labelled for each band) the size doesn’t matches the genotype product DNA bands'. The 136bp according to the marker will be 75bp and 241bp will be 200bp and so on . Please lable the gel properly.

Since, SIRT1 is major focus of the manuscript, authors are encouraged to show at least some correlation plots of all 132 donors with SIRT1 levels and frailty or other important parameter.

Repetitions from introduction in discussion part should be avoided. Last paragraph of discussion has many typographical errors and there are also such errors thought out the manuscript, such mistakes should be avoided.

Conclusions can be shortened and many extreme speculations can be avoided.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

Yes

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Partly

Are the conclusions drawn adequately supported by the results?

Partly

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Immunology, Aging, Inflammation

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard, however I have significant reservations, as outlined above.

Ardinata Dedi Universitas Sumatera Utara, and Department of Physiology, Faculty of Medicine, Medan, Indonesia

11 4 2024 Dear Amit Singh

Thank you for your thorough review and valuable suggestions regarding our manuscript entitled "Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases: A moderated mediation analysis." We appreciate the opportunity to clarify and improve our manuscript based on your feedback. Below, we address each of your concerns and describe the amendments we have made to the manuscript accordingly.

Clarification of SIRT1 Levels (Plasma vs. Cellular):

We have revised the title and the manuscript to explicitly state that the SIRT1 levels measured and discussed pertain to plasma levels, not cellular protein levels. To provide clarity, we have also added a brief explanation in the Methods section regarding the plasma source of SIRT1 and its relevance to our study's objectives. 

Genotyping Gel Image Clarification:

We acknowledge the confusion regarding the genotyping gel image and appreciate your pointing out the discrepancies. We have revised the image to include a clearer representation of the marker bands and accurately labelled each band to correspond with the correct DNA size. 

Inclusion of Correlation Plots:

Following your suggestion, we have now included correlation plots that depict the relationship between SIRT1 levels, frailty, and other critical parameters for all 132 participants. These plots provide a visual representation of our findings and strengthen the manuscript. 

Reduction of Repetitions and Typographical Errors:

We carefully reviewed the manuscript to eliminate redundant information between the Introduction and Discussion sections. We have also conducted a thorough proofreading to correct typographical errors throughout the text. These changes aim to improve readability and accuracy, and we believe they significantly enhance the manuscript's quality.

Revision of Conclusions:

We have streamlined the Conclusions section to succinctly summarize our findings without speculative statements. The revised Conclusions focus on our study's contributions to the field and its implications for future research, avoiding overgeneralization. 

We hope that these revisions adequately address your concerns and improve the quality and clarity of our manuscript. We are grateful for your constructive feedback and the opportunity to enhance our work. We look forward to your further suggestions and the possibility of our manuscript being accepted for publication.

Sincerely,

Dedi Ardinata and co-authors

10.5256/f1000research.146512.r243614
Reviewer response for version 1
Manjula Ramu 1Referee https://orcid.org/0000-0002-2237-2599

1 Yale University, Connecticut, USA
20 2 2024 Copyright: © 2024 Manjula R
2024
https://creativecommons.org/licenses/by/4.0/ This is an open access peer review report distributed under the terms of the Creative Commons Attribution Licence, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Version 1recommendationapprove
This study aimed to investigate the relationship between SIRT1 levels, SNP rs7895833, hemoglobin levels, age, and physical frailty (frail score) among 132 older Indonesian adults with comorbid chronic diseases. The present study aligns with recent research suggesting that the association between low hemoglobin levels and physical frailty among older adults with one or more chronic diseases is influenced by age. Furthermore, this study revealed that the SNP genotype AG-GG and high SIRT1 levels further moderated the relationship between low hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. While multiple studies support the protective role of increased SIRT1 expression in the body, the study highlights that SNP rs7895833 A>G affects the expression of the SIRT1 gene.

The manuscript is structured well, and the authors have proved their hypothesis. As mentioned by the authors, along with the sample size the strong limitations of this study are lifestyle habits, environmental factors, and medications, which could have influenced the results.

I believe that conclusions cannot be drawn based on these results.

Is the work clearly and accurately presented and does it cite the current literature?

Yes

If applicable, is the statistical analysis and its interpretation appropriate?

I cannot comment. A qualified statistician is required.

Are all the source data underlying the results available to ensure full reproducibility?

Yes

Is the study design appropriate and is the work technically sound?

Yes

Are the conclusions drawn adequately supported by the results?

Yes

Are sufficient details of methods and analysis provided to allow replication by others?

Yes

Reviewer Expertise:

Sirtuin biology

I confirm that I have read this submission and believe that I have an appropriate level of expertise to confirm that it is of an acceptable scientific standard.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.

Competing interests: No competing interests were disclosed.
==== Refs
References

1 Ofori-Asenso R Chin KL Mazidi M : Global Incidence of Frailty and Prefrailty among Community-Dwelling Older Adults: A Systematic Review and Meta-analysis. JAMA Netw. Open. 2019;2 (8 ):e198398. 10.1001/jamanetworkopen.2019.8398 31373653
2 Adioetomo SM : Indonesia on the Threshold of Population Ageing. Indonesia: UNFPA;2014;65 (632 ).
3 Barnett K Mercer SW Norbury M : Epidemiology of multimorbidity and implications for health care, research, and medical education: A cross-sectional study. Lancet. 2012;380 (9836 ):37–43. 10.1016/S0140-6736(12)60240-2 22579043
4 Biritwum RB Minicuci N Yawson AE : Prevalence of and factors associated with frailty and disability in older adults from China, Ghana, India, Mexico, Russia and South Africa. Maturitas. 2016;91 :8–18. 10.1016/j.maturitas.2016.05.012 27451316
5 Kojima G : Prevalence of Frailty in Nursing Homes: A Systematic Review and Meta-Analysis. J. Am. Med. Dir. Assoc. 2015;16 :940–945. 10.1016/j.jamda.2015.06.025 26255709
6 Gandhi SJ Hagans I Nathan K : Prevalence, Comorbidity and Investigation of Anemia in the Primary Care Office. J. Clin. Med. Res. 2017;9 (12 ):970–980. 10.14740/jocmr3221w 29163729
7 Palmer K Vetrano DL Marengoni A : The Relationship Between Anaemia and Frailty: A Systematic Review and Meta-Analysis of Observational Studies. J. Nutr. Health Aging. 2018;22 :965–974. 10.1007/s12603-018-1049-x 30272101
8 Ruan Y Guo Y Kowal P : Association between anemia and frailty in 13,175 community-dwelling adults aged 50 years and older in China. BMC Geriatr. 2019;19 (1 ):327. 10.1186/s12877-019-1342-5 31796000
9 Steinmeyer Z Delpierre C Soriano G : Hemoglobin concentration; A pathway to frailty. BMC Geriatr. 2020;20 (1 ):202. 10.1186/s12877-020-01597-6 32527230
10 Angioni D Macaron T Takeda C : Can We Distinguish Age-Related Frailty from Frailty Related to Diseases? Data from the MAPT Study. J. Nutr. Health Aging. 2020;24 (10 ):1144–1151. 10.1007/s12603-020-1518-x 33244575
11 Angulo J El Assar M Rodríguez-Mañas L : Frailty and sarcopenia as the basis for the phenotypic manifestation of chronic diseases in older adults. Mol. Asp. Med. 2016;50 :1–32. 10.1016/j.mam.2016.06.001
12 Kleipool EEF Hoogendijk EO Trappenburg MC : Frailty in older adults with cardiovascular disease: Cause, effect or both? Aging Dis. 2018;9 (3 ):489–497. 10.14336/AD.2017.1125 29896436
13 Thillainadesan J Scott IA Le Couteur DG : Frailty, a multisystem ageing syndrome. Age and Ageing. Oxford University Press;2020; Vol.49 : p.758–63. 10.1093/ageing/afaa112 32542377
14 Ahmed MH Ghatge MS Safo MK : Hemoglobin: Structure, Function and Allostery. Subcell. Biochem. 2020. 10.1007/978-3-030-41769-7_14 32189307
15 Stauder R Thein SL : Anemia in the elderly: Clinical implications and new therapeutic concepts. Haematologica. 2014;99 :1127–1130. 10.3324/haematol.2014.109967 24986873
16 Badrasawi M Shahar S Kaur Ajit Singh D : Risk Factors of Frailty Among Multi-Ethnic Malaysian Older Adults. Int. J. Gerontol. 2017;11 (3 ):154–160. 10.1016/j.ijge.2016.07.006
17 Wang X Hu J Wu D : Risk factors for frailty in older adults. Medicine (United States). Lippincott Williams and Wilkins;2022; Vol.101 : p.E30169.
18 Fried LP Cohen AA Xue QL : The physical frailty syndrome as a transition from homeostatic symphony to cacophony. Nat Aging. 2021;1 (1 ):36–46. 10.1038/s43587-020-00017-z 34476409
19 Angulo J El Assar M Álvarez-Bustos A : Physical activity and exercise: Strategies to manage frailty. Redox Biol. 2020;35 :101513. 10.1016/j.redox.2020.101513 32234291
20 Shimoyama Y Suzuki K Hamajima N : Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011;157 (6 ):339–347. 10.1016/j.trsl.2011.02.004 21575918
21 Kalemci S Gokdogan Edgunlu T Kara M : Sirtuin gene polymorphisms are associated with chronic obstructive pulmonary disease in patients in Muğla province. Kardiochirurgia i Torakochirurgia Polska. 2014;3 (3 ):306–310. 10.5114/kitp.2014.45682
22 Kilic U Gok O Bacaksiz A : SIRT1 gene polymorphisms affect the protein expression in cardiovascular diseases. PLoS One. 2014;9 (2 ):e90428. 10.1371/journal.pone.0090428 24587358
23 Kilic U Gok O Erenberk U : A Remarkable Age-Related Increase in SIRT1 Protein Expression against Oxidative Stress in Elderly: SIRT1 Gene Variants and Longevity in Human. PLoS One. 2015;10 :10. 10.1371/journal.pone.0117954 Reference Source
24 Mahmoud AA Ali AHK Eldin EN : Sirtuin 1 gene rs2273773 C > T single nucleotide polymorphism and protein oxidation markers in asthmatic patients. Egypt. J. Med. Hum. Genet. 2016;17 (2 ):191–196. 10.1016/j.ejmhg.2015.12.002
25 Ramkaran P Moodley D Chuturgoon A : Sirtuin 1 rs1467568 and rs7895833 in South African Indians with early-onset coronary artery disease. Cardiovasc. J. Afr. 2016;27 :213–217. 10.5830/CVJA-2015-085 Reference Source 27841908
26 Sabry D Kaddafy SR Abdelaziz AA : Association of SIRT-1 Gene Polymorphism and Vitamin D Level in Egyptian Patients With Rheumatoid Arthritis. J. Clin. Med. Res. 2018;10 (3 ):189–195. 10.14740/jocmr3067e 29416576
27 Casarotto AAF Galera BB Sumiyoshi LM : Polymorphism rs7895833 in the SIRT1 gene and its association with dyslipidaemia in the elderly. Rev. Esp. Geriatr. Gerontol. 2019;54 (4 ):214–219. 10.1016/j.regg.2019.01.008 31040057
28 Tao TT Lin XH Tang SJ : Association of genetic variants in the Sirt1 and Nrf2 genes with the risk of metabolic syndrome in a Chinese Han population. BMC Endocr. Disord. 2022;22 (1 ):84. 10.1186/s12902-022-00965-0 35365152
29 Zhou J He YW Fu L : Gene polymorphisms of SIRT1 in patients with rheumatoid arthritis. Int. J. Rheum. Dis. 2022;25 (2 ):210–217. 10.1111/1756-185X.14257 34866331
30 Siwak M Maślankiewicz M Nowak-Zduńczyk A : Analysis of rs7895833 polymorphism of SIRT1 gene and its influence on the risk occurrence and progression of neurodegenerative disease, such as primary open-angle glaucoma in a Polish population. J. Pre-Clin. Clin. Res. 2022 Dec 27;16 (4 ):127–130. 10.26444/jpccr/157149
31 Fried LP Tangen CM Walston J : Frailty in older adults: Evidence for a phenotype. J. Gerontol. A Biol. Sci. Med. Sci. 2001;56 (3 ):M146–M157. 10.1093/gerona/56.3.M146 11253156
32 Couteur DL Le Benson V Mcmahon A : Determinants of serum-induced SIRT1 expression in older men: the CHAMP study. J. Gerontol. A Biol. Sci. Med. Sci. 2011;66 (1 ):3–8. 10.1093/gerona/glq158 Reference Source 20819794
33 Razi S Cogger V Kennerson M : SIRT1 Polymorphisms and Serum-Induced SIRT1 Protein Expression in Aging and Frailty: The CHAMP Study. 2017. Reference Source
34 Kumar R Mohan N Upadhyay A : Identification of serum sirtuins as novel noninvasive protein markers for frailty. Aging Cell. 2014;13 :975–980. 10.1111/acel.12260 Reference Source 25100619
35 Ma L Niu H Sha G : Serum SIRT1 is Associated with Frailty and Adipokines in Older Adults. J. Nutr. Health Aging. 2018;23 :246–250. 10.1007/s12603-018-1149-7 Reference Source
36 Lee H Cashin AG Lamb SE : A Guideline for Reporting Mediation Analyses of Randomized Trials and Observational Studies: The AGReMA Statement. JAMA. 2021;326 (11 ):1045–1056. 10.1001/jama.2021.14075 34546296
37 Cuschieri S : The STROBE guidelines. Saudi J. Anaesth. 2019;13 :31–S34. 10.4103/sja.SJA_543_18 30930717
38 Charan J Biswas T : How to calculate sample size for different study designs in medical research? Indian J. Psychol. Med. 2013;35 :121–126. 10.4103/0253-7176.116232 24049221
39 Setiati S Soejono CH Harimurti K : Frailty and Its Associated Risk Factors: First Phase Analysis of Multicentre Indonesia Longitudinal Aging Study. Front. Med (Lausanne). 2021 Apr 29;8 .
40 Dwipa L Apandi M Utomo PP : Adaptation and validation of the indonesian version of the frail scale and the sarc-f in older adults. Asian J. Gerontol. Geriatr. 2021;16 (1 ).
41 Shimoyama Y Suzuki K Hamajima N : Sirtuin 1 gene polymorphisms are associated with body fat and blood pressure in Japanese. Transl. Res. 2011;157 (6 ):339–347. 10.1016/j.trsl.2011.02.004 Reference Source 21575918
42 Yin G Mitsuda Y Ezaki T : A new PCR method: One primer amplification of PCR-CTPP products. Mol. Biotechnol. 2012;52 (2 ).
43 Epskamp S Cramer AOJ Waldorp LJ : Qgraph: Network visualizations of relationships in psychometric data. J. Stat. Softw. 2012;48 :48. 10.18637/jss.v048.i04
44 Hayes AF Rockwood NJ : Conditional Process Analysis: Concepts, Computation, and Advances in the Modeling of the Contingencies of Mechanisms. Am. Behav. Sci. 2020;64 (1 ):19–54. 10.1177/0002764219859633
45 Hayes AF Rockwood NJ : Regression-based statistical mediation and moderation analysis in clinical research: Observations, recommendations, and implementation. Behav. Res. Ther. 2017;98 :39–57. 10.1016/j.brat.2016.11.001 27865431
46 Hayes AF : Partial, conditional, and moderated moderated mediation: Quantification, inference, and interpretation. Commun. Monogr. 2018;85 (1 ):4–40. 10.1080/03637751.2017.1352100
47 Baron RM Kenny DA : The moderator-mediator variable distinction in social psychological research: Conceptual, strategic, and statistical considerations. J. Pers. Soc. Psychol. 1986;51 (6 ):1173–1182. 10.1037/0022-3514.51.6.1173 3806354
48 Edwards JR Lambert LS : Methods for integrating moderation and mediation: A general analytical framework using moderated path analysis. Psychol. Methods. 2007;12 (1 ):1–22. 10.1037/1082-989X.12.1.1 17402809
49 Preacher KJ Hayes AF : Asymptotic and resampling strategies for assessing and comparing indirect effects in multiple mediator models. Behav. Res. Methods. 2008;40 :879–891. 10.3758/BRM.40.3.879 18697684
50 Deng A Knoblich U Lu J : Applying the Delta Method in Metric Analytics. 2018.
51 Tagliari CFdS Oliveira CN de Vogel GM : Investigation of SIRT1 gene variants in HIV-associated lipodystrophy and metabolic syndrome. Genet. Mol. Biol. 2020;43 (1 ):e20190142. 10.1590/1678-4685-gmb-2019-0142 32106282
52 Pires Corona L Drumond Andrade FC Oliveira Duarte YA de : The relationship between anemia, hemoglobin concentration and frailty in Brazilian older adults. J. Nutr. Health Aging. 2015;19 (9 ):935–940. 10.1007/s12603-015-0502-3 26482696
53 Corona LP Duarte YA d O Lebrão ML : Prevalence of anemia and associated factors in older adults: Evidence from the SABE Study. Rev. Saude Publica. 2014;48 (5 ):431–723. 10.1590/S0034-8910.2014048005039 25372162
54 Katsumi A Abe A Tamura S : Anemia in older adults as a geriatric syndrome: A review. Geriatr. Gerontol. Int. 2021;21 (7 ):549–554. 10.1111/ggi.14183 34085375
55 Lee CT Chen MZ Yip CYC : Prevalence of Anemia and Its Association with Frailty, Physical Function and Cognition in Community-Dwelling Older Adults: Findings from the HOPE Study. J. Nutr. Health Aging. 2021;25 (5 ):679–687. 10.1007/s12603-021-1625-3 33949637
56 Roy CN : Anemia in Frailty. Clin. Geriatr. Med. 2011;27 :67–78. 10.1016/j.cger.2010.08.005 21093723
57 Baker GT Martin GR : Biological Aging and Longevity: Underlying Mechanisms and Potential Intervention Strategies. J. Aging Phys. Act. 2016;2 (4 ):304–328. 10.1123/japa.2.4.304
58 Caprara G : Diet and longevity: The effects of traditional eating habits on human lifespan extension. Med. J. Nutrition Metab. 2018;11 (3 ):261–294. 10.3233/MNM-180225
59 Pignatti C D’adamo S Stefanelli C : Nutrients and pathways that regulate health span and life span. Geriatrics (Switzerland). 2020;5 . 10.3390/geriatrics5040095
60 Chen X Mai H Chen X : Rs2015 Polymorphism in miRNA Target Site of Sirtuin2 Gene Is Associated with the Risk of Parkinson’s Disease in Chinese Han Population. Biomed. Res. Int. 2019;2019 :1–8. 10.1155/2019/1498034
61 Mahmoud AA Moghazy HM Ezat MAW : Association of sirtuin 1 gene single nucleotide polymorphisms with type 2 diabetes mellitus in essential hypertension patients. Meta Gene. 2016;10 :8–12. 10.1016/j.mgene.2016.09.003
62 Zazzara MB Vetrano DL Carfì A : Frailty and chronic disease. Panminerva Med. 2019;61 . 10.23736/S0031-0808.19.03731-5
63 Madu AJ Ughasoro MD : Anaemia of Chronic Disease: An In-Depth Review. Med. Princ. Pract. 2017;26 :1–9. 10.1159/000452104 27756061
64 Guarente L : Sirtuins, Aging, and Medicine. N. Engl. J. Med. 2011;364 (23 ):2235–2244. 10.1056/NEJMra1100831 21651395
65 Zia A Sahebdel F Farkhondeh T : A review study on the modulation of SIRT1 expression by miRNAs in aging and age-associated diseases. Int. J. Biol. Macromol. 2021;188 :52–61. 10.1016/j.ijbiomac.2021.08.013 34364937
66 Chen C Zhou M Ge Y : SIRT1 and aging related signaling pathways. Mech. Ageing Dev. 2020;187 :111215. 10.1016/j.mad.2020.111215 32084459
67 Manjula R Anuja K Alcain FJ : SIRT1 and SIRT2 Activity Control in Neurodegenerative Diseases. Front. Pharmacol. 2021;11 . 10.3389/fphar.2020.585821 33597872
68 Xin H Wang M Tang W : Hydrogen Sulfide Attenuates Inflammatory Hepcidin by Reducing IL-6 Secretion and Promoting SIRT1-Mediated STAT3 Deacetylation. Antioxid. Redox Signal. 2016;24 (2 ):70–83. 10.1089/ars.2015.6315 26154696
69 Zhou Z Ye TJ DeCaro E : Intestinal SIRT1 Deficiency Protects Mice from Ethanol-Induced Liver Injury by Mitigating Ferroptosis. Am. J. Pathol. 2020;190 (1 ):82–92. 10.1016/j.ajpath.2019.09.012 31610175
70 Zhang T Kraus WL : SIRT1-dependent regulation of chromatin and transcription: Linking NAD+ metabolism and signaling to the control of cellular functions. Biochim. Biophys. Acta. 2010;1804 :1666–1675. 10.1016/j.bbapap.2009.10.022 19879981
71 Ardinata D Harahap NS Lubis NDA : Exploring the moderating effects of SIRT1 protein expression and gene polymorphisms rs7895833 on the relationship between hemoglobin levels and physical frailty in elderly adults with comorbid chronic diseases. A moderated mediation analysis.Dataset. figshare. 2023. 10.6084/m9.figshare.22492603.v2
