
==== Front
J Negat Results BiomedJournal of Negative Results in Biomedicine1477-5751BioMed Central London 1477-5751-4-11570308010.1186/1477-5751-4-1ResearchAssociation study with Wegener granulomatosis of the human phospholipase Cγ2 gene Jagiello Peter 1peter.jagiello@rub.deWieczorek Stefan 1stefan.wieczorek@rub.deYu Philipp 2philipp.yu@lrz.tu-muenchen.deCsernok Elena 3csernok@rheuma-zentrum.deGross Wolfgang L 3gross@rheuma-zentrum.deEpplen Joerg T 1joerg.t.epplen@rub.de1 Department of Human Genetics, Ruhr-University Bochum Germany2 Institute of Medical Microbiology, Immunology and Hygiene, Technical University Munich, Germany3 Department of Rheumatology, University Hospital Luebeck and Rheumaklinik Bad Bramstedt, Germany2005 9 2 2005 4 1 1 7 10 2004 9 2 2005 Copyright © 2005 Jagiello et al; licensee BioMed Central Ltd.2005Jagiello et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
Wegener Granulomatosis (WG) is a multifactorial disease of yet unknown aetiology characterized by granulomata of the respiratory tract and systemic necrotizing vasculitis. Analyses of candidate genes revealed several associations, e.g. with α(1)-antitrypsin, proteinase 3 and with the HLA-DPB1 locus. A mutation in the abnormal limb mutant 5 (ALI5) mouse in the region coding for the hydrophobic ridge loop 3 (HRL3) of the phospholipaseCγ2 (PLCγ-2) gene, corresponding to human PLCγ-2 exon 27, leads to acute and chronic inflammation and granulomatosis. For that reason, we screened exons 11, 12 and 13 coding for the hydrophobic ridge loop 1 and 2 (HRL1 and 2, respectively) and exon 27 of the PLCγ-2 protein by single strand conformation polymorphism (SSCP), sequencing and PCR/ restriction fragment length polymorphism (RFLP) analyses. In addition, we screened indirectly for disease association via 4 microsatellites with pooled DNA in the PLCγ-2 gene.

Results
Although a few polymorphisms in these distinct exons were observed, significant differences in allele frequencies were not identified between WG patients and respective controls. In addition, the microsatellite analyses did not reveal a significant difference between our patient and control cohort.

Conclusion
This report does not reveal any hints for an involvement of the PLCγ-2 gene in the pathogenesis of WG in our case-control study.
==== Body
Background
Wegener granulomatosis (WG) is a systemic inflammatory disease of unknown aetiology characterized by granulomata of the respiratory tract and systemic necrotizing vasculitis [1]. There is a strong and specific association with presence of anti-neutrophil cytoplasmatic antibodies to a defined target antigen, proteinase 3 (PR3-ANCA), which is present within primary azurophil granules of neutrophils (PMN) and lysozymes of monocytes [2]. Upon cytokine priming of PMNs, this enzyme translocates to the cell surface, where PR3-ANCAs can interact with their antigens and activate PMNs [3]. It has been shown that PMNs from patients with active WG expressing PR3 on their surfaces produce respiratory burst and release proteolytic enzymes after activation with PR3-ANCA [4]. The consequence is a self-sustaining chronifying inflammatory process. WG appears as a multifactorial disease, and environmental influences still remain elusive. Several factors, such as bacterial infections, have been proposed as probable initiators of the disease [5]. It has been reported that chronic carrier status of Staphylococcus aureus is a risk factor for disease exacerbation in WG [6]. Recently a strong association of WG with distinct HLA-DPB1 alleles or rather an extended haplotype, respectively, in the MHC class II region has been reported [7]. In addition, analyses of candidate genes revealed several associations, e.g. with α(1)-antitrypsin, and proteinase 3 [[8] and [9]].

A primary candidate gene, PLCγ-2, was proposed on the basis of a novel animal model system. A mutation in the abnormal limb mutant 5 (ALI5) mouse [10] causes a phenotype comparable to human autoimmunity disease like WG: inflammations, granulomatosis, affected organs (lung, kidney with glomerulonephritis, eye and skin) and ANCAs were detected in the ALI5 mouse initially. Yet, this result has to be confirmed in further studies. The ALI5 mutation is located in the genomic region coding for the hydrophobic ridge loop 3. In mouse PLCγ-2 mutation leads to acute and chronic inflammations with a phenotype comparable to WG. Therefore, human PLCγ-2 is a good candidate gene for seeking predisposing genetic factors for WG. The human gene is a member of the PLC family comprising 12 closely related molecules involved in signal transduction from numerous receptors [11]. The protein is activated by cytoplasmatic tyrosine kinases (Lyn, Syk, and Btk) which are induced by engagement of B-cell receptors. In turn, the PLCγ-2 activation leads to the generation of diacylglycerol (DAG) and inositol 1,4,5-trisphosphat (IP3). While DAG activates protein kinase C (PKC, [12]), IP3 mediates Ca2+ mobilization, which is required for activation of B-cells [13]. PLCγ-2 itself is expressed mainly in B-cell, hematopoetic cells, macrophages, granulocytes, testis, sperm, skin and brain [14]. The protein consists of two catalytic domains, which are separated by two SH2 and one SH3 domains [15]. It was established that PLCγ-2 mediates the coupling of G-protein-coupled receptors (GPCRs) and Ca2+ entry in cell lines [16]. The human PLCγ-2 gene is localized on chromosome 16 (16q24.1) spanning 179 kb of genomic DNA. The 4.2 kb mRNA consists of 33 Exon coding for a Mr 140,000 protein with 1265 amino acids [17]. PLCγ-2 is highly polymorphic [18].

Here, we report on an indirect association screen by microsatellite analysis and pooling of DNA in a case-control study design. Furthermore, we screened exons 11, 12 and 13, partly coding for the hydrophobic ridge loop 1 and 2 of PLCγ-2 protein, by single stranded conformation polymorphism (SSCP), sequencing and the PCR/RFLP method. As the ALI5 mutation is located in the region corresponding to the human exon 27, this exon was also screened by SSCP.

Results
Analyses of microsatellites
In the present study we analysed 4 microsatellites intra- or juxta-genic of the PLCγ-2 gene with pooled DNAs from WG patients compared with those from controls (table 1; figure 1). All markers exhibited at least 3 alleles and did not show any intra-subgroup differences. The microsatellite analyses did not reveal significantly different allele distributions between WG patient and control pools (figure 1).

Table 1 Primer sequences and information about microsatellites used in study

	Primer sequence		
			
No.	sense1	antisense	*nucleotide marker	
1	CGCACATGTATCCAGAACT	AGAGGTGGACCCATGCTTA	*di (AT)	
2	CAAAGAAGATAAGGGCAGGC	CCTAGGCGACTCAGTGAGACT	*tetra (TTTA)	
3	AGGAGTTCGAGAAGAGCCTG	TGCCACTACACCCAGATGAT	*di (AC)	
4	TGATCTGTGTCTGGGCTTTC	AGTTGTGACCCTAACATTGCA	*di (AC)	
1 The fluorescence labelled tail (5-Fam-CATCGCTGATTCGCACAT) was added to the 5'end of each sense primer

Figure 1 Schematic representation of the human PLCγ-2 gene with relative localization of exons and investigated microsatellites. P values were generated by contingency tables (for details see "materials and methods"). Vertical lines: exons; No1-6: investigated microsatellites 1-6; Ex: exon.

SSCP, sequencing and PCR/RFLP analyses
SSCP analysis was chosen to identify mutations or polymorphisms, respectively, in exons 11, 12, 13 and 27 of the PLCγ-2 gene. DNA's of patients and controls with altered migration behaviour were sequenced. Identified variations were genotyped individually by SSCP and/or PCR/RFLP in individual patient and control samples (see table 2). Exon 12 revealed a low frequent SNP (1122G>A), which represents the first base pair of the exon. In exon 13 two previously identified SNPs (1293T>C and 1296T>C) were detected [18]. Both SNPs showed similar frequencies as reported [18]. All variations were found not significantly different in WG patients compared to the control group, and they were not associated with amino acid substitutions. In one patient our analyses revealed a single base substitution (3030G>A) in exon 27.

Table 2 Summary of found variations in the human PLCγ-2 gene in exons 11, 12, 13 and 27

	variation	frequency of alleles			
					
exon	bp1	codon	WG patients	controls	P value	restriction enzymes	
11	-	-	-	-	-	-	
12	1122G>A	T329T	3/262	3/162	0.55	BanI	
13	1293T>C2	F382F	7/350	4/324	0.68	PfIFI	
	1296T>C2	D383D	143/262	96/186	0.78	TaqI	
27	3030G>A	T961T	1/1663	0/1803	0.51	-	
1Numbering according to BC007565 (UCSC); 2Previously reported SNPs; 3Frequencies determined by SSCP analyses

Discussion
As recently reported a mutation in the PLCγ-2 gene in the ALI5 mouse leads to acute and chronic inflammation and granulomatosis. In addition, the ALI5 mice show similar symptoms as WG patients. For this reason screening of PLCγ-2 appears as a logical consequence in seeking candidate genes for WG. In the present study PLCγ-2 was analysed by an indirect microsatellite approach using pooled DNA from WG patients with a defined PR3-ANCA+ status and a matched control cohort as reported before [7]. Furthermore, exons partly representing the catalytic domains of the PLCγ-2 protein, HRL1, 2 and 3, were analysed by SSCP, sequencing and by the PCR/RFLP method. We did not find any hints of an involvement of the PLCγ-2 gene in the pathophysiology of WG. Hence, we exclude at this time that the PLCγ-2 gene predisposes for WG in our cohort.

Our study revealed 4 single base substitutions, 2 of which were reported before [18]. A further silent and low frequent SNP was detected in exon 12 which did not differ significantly between patient and control cohorts after PCR/RFLP analyses. As this SNP is the first basepair (bp) after the 3'-splice site one might hypothesise an influence on splicing but to present knowledge this SNP does not change a consensus sequence required for splicing. The ALI5 mutation is located in the HRL3 domain partly corresponding to the human exon 27 of PLCγ-2. Our analysis revealed a SNP (G>A) at position 3030 in one WG patient.

The indirect microsatellite based approach did not reveal any association of PLCγ-2 with WG. Altogether 4 microsatellites spread in the PLCγ-2 gene were analysed. The approach using pooled DNA and ad hoc designed markers intragenic or in the immediate vicinity of a distinct gene has proven to be a reliable and efficient method to detected predisposing loci in WG before [7]. Here, none of the markers did show a significant allele distribution between the patient and control group.

Conclusion
In conclusion, our analysis of the human PLCγ-2 gene did not reveal an association of PLCγ-2 with WG. In contrast to ALI5 mice, where a single mutation leads to distinct symptoms of inflammatory autoimmunity, human WG depends on a more complex genetic background. Further analysis of all exons of PLCγ-2 might yield an association with WG but our microsatellite analysis strongly suggests that predisposition for WG is not due to variations in the PLCγ-2 gene.

Material and Methods
Patients and controls
175 well-characterized patients of German origin with a clinical diagnosis of WG and a defined PR3-ANCA+ status were included in present study. Diagnosis of WG was established according international standards [[19] and [20]]. All patients were biopsy-proven. Biopsies were seen in German reference centre for vasculitis (Department of Pathology, University of Schleswig-Holstein Campus Luebeck, Germany) by 2 different observers. A group of 165 healthy individuals of German origin were used as controls. All persons gave informed consent.

Microsatellite analysis
Pooling of DNA was performed as reported before [7]. Patient (n = 150) and healthy control (n = 100) individuals from the abovementioned groups were divided into 3 and 2 sub-pools, respectively, containing 50 persons each.

In this study 3 intragenic microsatellites as well as one in the immediate vicinity of the gene were included (table 1; see also UCSC Database, June 2002 Freeze; URL). Oligonucleotides were designed by Primer Express 2.0 software (ABI) adjusted to an annealing temperature of 55°C.

For PCR we used the 'tailed primer PCR' as described before [7]. For amplification three oligonucleotides were used: 1. tailed sense primer (tailed F), 2. anti-sense primer and 3. labeled primer (labeled F) corresponding to the 5'-tail sequence of tailed F. PCR conditions were as follows: 1 × PCR buffer (Qiagen), 1.5 pmol labeled F, 0.2 mM each dNTP, 3 mM MgCl2, 0.2 pmol tailed F, 1.5 pmol reverse primer, 0.25 U Qiagen Hot Start Taq (Qiagen) and 50 ng DNA.

Electrophoreses were run using ABI standard protocols. Raw data were analyzed by the Genotyper software (ABI) producing a marker-specific allele image profile (AIP, see [21] and [7]). AIP consists of series of peaks with different heights reflecting the allele frequency within each analyzed DNA pool.

Statistics for comparisons of allele frequencies of patients and controls was performed as described before [[21] and [7]]. Case and control distributions were compared statistically by means of contingency tables.

SSCP, sequencing and PCR/RFLP analyses
Exons 11, 12, 13 and 27 were analysed by the SSCP method. PCR was performed using oligonucleotides reported before ([18], exon 27 corresponding to exon 26). Heat-denaturated fragments were then separated by polyacrylamide gel electrophoresis under non-denaturating conditions yielding specific band patterns for each of the alleles. Results were visualized by autoradiography. Alleles of representative probes were determined by direct DNA sequence analysis on a 377 ABI automatic sequencer (ABI). Afterwards, variations were genotyped individually by PCR/RFLP method with restriction enzymes specific for the respective change (for details see table 2). The variation in exon 27 was individually genotyped by the SSCP method.

Authors' contribution
PJ and SW carried out the molecular genetic studies, performed the statistical analysis and drafted the manuscript. PY participated in study design and helped to draft the manuscript. EC and WLG provided the samples and performed diagnostics of the patient group. JTE conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.
==== Refs
Lamprecht P Gross WL  Wegener's granulomatosis Herz 2004 29 47 56 14968341 10.1007/s00059-004-2525-0 
Csernok E Muller A Gross WL  Immunopathology of ANCA-associated vasculitis Intern Med 1999 38 759 765 10526937 
Csernok E Ernst M Schmitt W Bainton DF Gross WL  Activated neutrophils express proteinase 3 on their plasma membrane in vitro and in vivo Clin Exp Immunol 1994 95 244 250 8306499 
van der Geld YM Limburg PC Kallenberg CG  Proteinase 3, Wegener's autoantigen: from gene to antigen J Leukoc Biol 2001 69 177 190 11272267 
Brons RH Bakker HI Van Wijk RT Van Dijk NW Muller Kobold AC Limburg PC Manson WL Kallenberg CG Tervaert JW  Staphylococcal acid phosphatase binds to endothelial cells via charge interaction; a pathogenic role in Wegener's granulomatosis? Clin Exp Immunol 2000 119 566 573 10691932 10.1046/j.1365-2249.2000.01172.x 
Popa ER Tervaert JW  The relation between Staphylococcus aureus and Wegener's granulomatosis: current knowledge and future directions Intern Med 2003 42 771 780 14518661 
Jagiello P Gencik M Arning L Wieczorek S Kunstmann E Csernok E Gross WL Epplen JT  New genomic region for Wegener's granulomatosis as revealed by an extended association screen with 202 apoptosis-related genes Hum Genet 2004 114 468 477 14968360 10.1007/s00439-004-1092-z 
Esnault VL Testa A Audrain M Roge C Hamidou M Barrier JH Sesboue R Martin JP Lesavre P  Alpha 1-antitrypsin genetic polymorphism in ANCA-positive systemic vasculitis Kidney Int 1993 43 1329 1332 8315946 
Gencik M Meller S Borgmann S Fricke H  Proteinase 3 gene polymorphisms and Wegener's granulomatosis Kidney Int 2000 58 2473 2477 11115080 10.1046/j.1523-1755.2000.00430.x 
Yu P Constien R Dear N Katan M Hanke P Bunney TD Kunder S Quintanilla-Martinez L Huffstadt U Schroeder A Jones NP Peters T Fuchs H Hrabe de Angelis M Nehls M Grosse J Wabnitz P Meyer TPH Yasuda K Schiemann M Schneider-Fresenius C Jagla W Russ A Popp A Josephs M Marquardt A Laufs J Schmittwolf C Wagner H Pfeffer K Mudde GC  Autoimmunity and inflammation due to a gain-of-function mutation in phospholipase Cγ2 that specifically increases external Ca2+ entry Immunity  
Rhee SG  Regulation of phosphoinositide-specific phospholipase C Annu Rev Biochem 2001 70 281 312 11395409 10.1146/annurev.biochem.70.1.281 
Rhee SG Bae YS  Regulation of phosphoinositide-specific phospholipase C isozymes J Biol Chem 1997 272 15045 15048 9182519 10.1074/jbc.272.24.15045 
Kurosaki T Maeda A Ishiai M Hashimoto A Inabe K Takata M  Regulation of the phospholipase C-gamma2 pathway in B cells Immunol Rev 2000 176 19 29 11043765 10.1034/j.1600-065X.2000.00605.x 
Marshall AJ Niiro H Yun TJ Clark EA  Regulation of B-cell activation and differentiation by the phosphatidylinositol 3-kinase and phospholipase Cgamma pathway Immunol Rev 2000 176 30 46 11043766 10.1034/j.1600-065X.2000.00611.x 
Manning CM Mathews WR Fico LP Thackeray JR  Phospholipase C-gamma contains introns shared by src homology 2 domains in many unrelated proteins Genetics 2003 164 433 442 12807765 
Patterson RL van Rossum DB Ford DL Hurt KJ Bae SS Suh PG Kurosaki T Snyder SH Gill DL  Phospholipase C-gamma is required for agonist-induced Ca2+ entry Cell 2002 111 529 541 12437926 10.1016/S0092-8674(02)01045-0 
Emori Y Homma Y Sorimachi H Kawasaki H Nakanishi O Suzuki K Takenawa T  A second type of rat phosphoinositide-specific phospholipase C containing a src-related sequence not essential for phosphoinositide-hydrolyzing activity J Biol Chem 1989 264 21885 21890 2557343 
Wang D Boylin EC Minegishi Y Wen R Smith CI Ihle JN Conley ME  Variations in the human phospholipase Cgamma2 gene in patients with B-cell defects of unknown etiology Immunogenetics 2001 53 550 556 11685467 10.1007/s002510100356 
Leavitt RY Fauci AS Bloch DA Michel BA Hunder GG Arend WP Calabrese LH Fries JF Lie JT Lightfoot RW  The American College of Rheumatology 1990 criteria for the classification of Wegener's granulomatosis Arthritis Rheum 1990 33 1101 1107 2202308 
Jennette JC Falk RJ Andrassy K Bacon PA Churg J Gross WL Hagen EC Hoffman GS Hunder GG Kallenberg CG  Nomenclature of systemic vasculitides: Proposal of an international consensus conference Arthritis Rheum 1994 37 187 192 8129773 
Goedde R Sawcer S Boehringer S Miterski B Sindern E Haupts M Schimrigk S Compston A Epplen JT  A genome screen for linkage disequilibrium in HLA-DRB1*15-positive Germans with multiple sclerosis based on 4666 microsatellite markers Hum Genet 2002 111 270 277 12215840 10.1007/s00439-002-0801-8

