
==== Front
BMC CancerBMC Cancer1471-2407BioMed Central London 1471-2407-5-91566107410.1186/1471-2407-5-9Research ArticleFunctional promoter upstream p53 regulatory sequence of IGFBP3 that is silenced by tumor specific methylation Hanafusa Tadashi 14hanafusa@cc.okayama-u.ac.jpShinji Toshiyuki 2toshinji@md.okayama-u.ac.jpShiraha Hidenori 3hshiraha@md.okayama-u.ac.jpNouso Kazuhiro 3nouso@cc.okayama-u.ac.jpIwasaki Yoshiaki 3yiwasaki@cc.okayama-u.ac.jpYumoto Eichiro 3yumoto-gi@umin.ac.jpOno Toshiro 1onot@md.okayama-u.ac.jpKoide Norio 2koide@md.okayama-u.ac.jp1 Okayama University Advanced Science Research Center, Department of Radiation Research, Shikata Laboratory, Shikata-cho 2-5-1, Okayama Japan2 Department of Laboratory Medicine, Okayama University Graduate School of Medicine and Dentistry. Shikata-cho 2-5-1, Okayama Japan3 First Department of Internal Medicine, Okayama University Graduate School of Medicine and Dentistry. Shikata-cho 2-5-1, Okayama Japan4 Department of Microbiology and Immunology, Albert Einstein College of Medicine, 1300 Morris Park Av, Bronx, NY 10461, USA2005 20 1 2005 5 9 9 26 8 2004 20 1 2005 Copyright © 2005 Hanafusa et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
Insulin-like growth factor binding protein (IGFBP)-3 functions as a carrier of insulin-like growth factors (IGFs) in circulation and a mediator of the growth suppression signal in cells. There are two reported p53 regulatory regions in the IGFBP3 gene; one upstream of the promoter and one intronic. We previously reported a hot spot of promoter hypermethylation of IGFBP-3 in human hepatocellular carcinomas and derivative cell lines. As the hot spot locates at the putative upstream p53 consensus sequences, these p53 consensus sequences are really functional is a question to be answered.

Methods
In this study, we examined the p53 consensus sequences upstream of the IGFBP-3 promoter for the p53 induced expression of IGFBP-3. Deletion, mutagenesis, and methylation constructs of IGFBP-3 promoter were assessed in the human hepatoblastoma cell line HepG2 for promoter activity.

Results
Deletions and mutations of these sequences completely abolished the expression of IGFBP-3 in the presence of p53 overexpression. In vitro methylation of these p53 consensus sequences also suppressed IGFBP-3 expression. In contrast, the expression of IGFBP-3 was not affected in the absence of p53 overexpression. Further, we observed by electrophoresis mobility shift assay that p53 binding to the promoter region was diminished when methylated.

Conclusion
From these observations, we conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells.
==== Body
Background
Insulin-like growth factor binding protein (IGFBP)-3 is a multifunctional protein ferrying insulin-like growth factors (IGFs) in circulation and mediating growth suppression signals in cells. Serum IGFBP-3 protein (< 5000 ng/ml) complexes with IGFs and an acid labile subunit (ALS), to extend the half lives and modulate the bio-availability of IGFs [1]. While a precise mechanism of action is not clear, the growth suppressive activity of IGFBP-3 depends on its nuclear translocation [2]. Other growth suppressors such as p53, retinoic acids, transforming growth factor (TGF)-β, and tumor necrosis factor (TNF)-α induce IGFBP-3 as a mediator of growth suppression [3-6]. The growth suppression by IGFBP-3 is independent from the modulation of IGFs action [7-9]. The functional importance of the IGFBP-3 in the growth suppression is noteworthy.

IGFBP-3 is produced in most tissues, but the main site of production is liver. It is produced by non-parenchymal cells (endothelial and Kupffer cells) while parenchymal cells (hepatocytes) do not produce it under normal condition [10]. We postulate that IGFBP-3 is a gene induced by growth suppression signals such as p53 in hepatocytes. While the growth suppression imported by IGFBP-3 suggests the potential for tumor suppression, polymorphisms, but no significant mutations were observed in a survey of several tumors [11]. As gene silencing may occur without mutations, we recently investigated IGFBP-3 promoter hypermethylation in human hepatocellular carcinoma [12]. These promoter hypermethylations were subsequently reported in other tumors systems [13,14].

Promoter analysis of IGFBP-3 indicated that the NaB-RE sequence is essential for the sodium butyrate (NaB) induced IGFBP-3 expression [15], but the importance of the eleven upstream p53 binding sites reported by Bourdon et al. were not confirmed until now [16]. The methylation hot spot we identified exactly matched the putative p53 binding sites that Bourdon et al. indicated. Thus, we postulated that these sites are important for the expression of IGFBP-3 induced by p53. Moreover, we hypothesized that the suppression of apoptosis mediated by IGFBP-3 due to the promoter hypermethylation will be a possible pathway of hepatocarcinogenesis. To explore this possibility, the functions of the promoter upstream binding sites of p53 were examined precisely in this study.

Methods
Cell culture
HepG2 cells were obtained from Japanese Cancer Research Resources Bank (Tokyo, Japan), and maintained in D-MEM supplemented with 10 % FCS (Life Technologies, Tokyo, Japan), antibiotic-antimycotics at 37°C in a humidified atmosphere of 95 % air and 5 % CO2.

Plasmids
pGL2-IGFBP-3, kindly provided by Dr. Youngman Oh (Oregon Health Sciences University, Portland, OR), carries a 1.9 kb IGFBP-3 promoter (-1805/+69) in pGL2-Basic (Promega Corp., Madison, WI). A series of deletion mutant constructs, pGL2-270, pGL2-240, pGL2-210, pGL2-180, pGL2-150, pGL2-120, pGL2-90, pGL2-60, pGL2-30, and pGL2-1 containing the indicated fragments upstream of the transcription start site and 60 bp of fragments downstream of the transcription start site, were generated by PCR amplification of the promoter fragment and subsequent subcloning of the Mlu I-Bgl II fragment to pGL2-Basic (Table 1, Fig. 2). The transcription start site of the IGFBP-3 promoter, +1, is based on the sequence determined by Cubbage et al. [17]. The plasmid containing site-directed mutations in putative p53 binding sites was generated by replacing the wild type Mlu I-Xho I fragment of pGL2-210 with a mutant fragment synthesized artificially (pGL2-210B, Table 1, Fig. 3). A fusion gene with site-directed methylation was constructed by methylating the Mlu I-Xho I fragment (-210/-174) of pGL2-210 in vitro with Sss I methylase (New England Biolabs, Inc., Beverly, MA), and reconstituting the fragment and unmethylated vector (Fig. 4). pCMV-p53 and pCMV-p53mt135 were obtained from BD-Biosciences (East Meadow Circle, Palo Alto, CA).

Transient transfection
HepG2 cells were transiently transfected using the FuGENE 6 transfection reagent according to the manufacturer's instructions (Roche Molecular Biochemicals, Indianapolis IN). Cells were seeded at a density of 5 × 104 cells/well in 24-well plates. After 24 hours, cells were transfected with 0.25 μg/well of reporter plasmid DNA in serum-containing medium. Forty-eight hours post transfection, cells were washed twice with PBS and collected for luciferase assays. Transfections were performed in quadruplicate and experiments were performed at least two times.

Luciferase assay
Luciferase activities of cell lysates were measured according to the manufacturer's instructions (Promega Corp. Madison, WI) using a liquid scintillation counter (Aloka, LSC-700, Tokyo, Japan). Luciferase activities were normalized for total protein determined using the Bradford Assay (Bio-Rad Laboratories, In., Hercules, CA).

EMSA (electrophoresis mobility shift assay)
278 bp of the Mlu I-Bgl II fragment of pGL-210 were labelled using [α-32P]dCTP by end filling with Klenow fragment, and used for EMSA. Oligonucleotide DNAs (BP3WPSF: 5'-GGCTGCAGCG GGCGTGCGCA CGAGGAGCAG GTGCCCGGGC GAGTCTCGAG CTGCACGCCC CCGAGCTCGG-3', BP3WPSR: 5'-CCGAGCTCGG GGGCGTGCAG CTCGAGACTC GCCCGGGCAC CTGCTCCTCG TGCGCACGCC CGCTGCAGCC-3'), comprising the promoter sequence of -210/-149, were custom-made (Sigma-genosys Japan, Ishikari, Japan), annealed one hour at room temperature, and used as cold competitor in the assay. EMSA was performed in a 20 μl reaction containing 10 mM Tris (pH 7.5), 2.5% Glycerol, 50 mM KCl, 0.1 mM EDTA, 1 mM DTT, and in the presence of 50 ng/μl of double-stranded poly [d(I-C)], 5000 cpm (2 ng) of 32P-labeled probe DNA, and 2.5 μg of H2O2 treated MCF7 nuclear extract (Active motif LLC, Palomar, CA). The reaction mixture was incubated at 14°C for 20 min. 20 μl of each reaction mixture was then loaded onto a native 4 % polyacrylamide gel containing 0.5 × Tris-Glycine buffer (25 mM Tris, 190 mM Glycine, 1 mM EDTA pH 8.3), and electrophoresed at 14°C, 100 V for 1 hr. For the supershift assay, a p53 antibody (Ab-2, Oncogene Research Products, San Diego, CA) was used.

Results
Deletion analysis
We identified a hot spot of promoter hypermethylation in human hepatocellular carcinoma and its cell lines in the promoter upstream region of IGFBP-3 (Fig. 1). As methylation sites were identified to the cluster of putative p53 binding sites, we examined the role of these sites in IGFBP-3 expression. First, we constructed promoter deletion mutants of IGFBP-3 and examined the expression of the reporter gene in the absence (Fig. 2A) and presence (Fig. 2B) of p53 expression by the co-transfection of a p53 expression plasmid (pCMV-p53). As the transfection efficiency was not fully controlled, and p53 overexpression may to cause massive changes in cellular conditions, we did not compare results between the presence and absence of p53. Even though, we can obtain clear results about the effect of p53 to IGFBP-3 expression. The pattern of expression of deletion mutants was clearly different in the absence and presence of p53. In the absence of p53 overexpression, we identified the NaB-RE sequence as an essential site for expression, and deletion of p53 binding site enhanced the gene expression (Fig. 2A). These observations were similar to those of Walker et al. [15], but differed as HepG2 cell does not require NaB or Tricostatin A (TSA) for its activation. In contrast, in the presence of p53 over-expression, we identified that four p53 binding sites between -210 to -150 (relative transcription start site as +1) were essential for IGFBP-3 expression (Fig. 2B). When the deletion constructs were co-transfected with pCMV-p53mt135, the expression of the IGFBP-3 promoter was suppressed to a background level (almost same as blank constructs) in all constructs (data not shown). This indicates that IGFBP-3 expression we observe is tightly regulated by p53.

Site-directed mutagenesis
To confirm the importance of p53 binding sites between -210 to -150, we abrogated one of p53 binding sites by site-directed mutagenesis (C to T at -179 and G to C at -176, Fig. 3A). In the absence of p53 overexpression, there exist little differences in expression between the wild type and mutant construct (74 % relative to the wild type) (Fig. 3B). However, in the presence of p53 overexpression, IGFBP-3 expression was strongly decreased in the mutant construct (3.4 %) relative to wild type (Fig. 3B). For reasons already mentioned, we did not compare the result between in presence and absence of p53.

Site-directed methylation
Next, we constructed in vitro methylated promoter constructs to evaluate the effect of methylation (Fig. 4A). For methylation, the Mlu I-Xho I fragment of pGL2-210 was methylated with Sss I methylase and reconstituted with unmethylated reporter vector fragment. As we used linear constructs for the transfection, the expression of luciferase was strongly suppressed compared to circular plasmids (0.7 %). But similar patterns compared to site directed mutation were observed. Although the expression of IGFBP-3 was slightly enhanced in the absence of p53 overexpression in the methylated construct, it was decreased in the presence of p53 overexpression in the methylated construct (Fig. 4B). In this experiment, at a glance, we observed induction of IGFBP-3 expression by p53, but the transfection efficiency of linear plasmids is low, while the relative levels of p53 and the availability of putative negative regulators are extremely different from other experiments. Thus, we cannot conclude in this case, whether or not there is induction by p53.

EMSA
EMSA was performed to determine whether p53 protein binding was disturbed by methylation. In this assay, the wild type and methylated promoter fragments (278 bp, -210/+60) were incubated with H2O2-treated MCF7 nuclear extract that express high level of p53. In the wild type promoter probe, we observed supershifted complex (Fig. 5, lane 4, indicated by arrows) when p53 antibody (Ab-2) is added to the reaction mixture. A 100-fold molar excess of a cold 70 bp sequence containing a p53 binding site (-210/-149), competed the probe (Fig. 5, lane 5). In methylated probe, we observed no supershifted complex (Fig. 5, lane 9). As we used probes that contain a Sp1/GC box and TATA box, we observed the shift and supershift bands in the methylated probe as well as unmethylated probe. These bands were postulated to be due to p53 binding to the nuclear factor such as p300. These observations indicate that p53 binding to the IGFBP3 promoter sequence is blocked or at least attenuated by hypermethylation.

Discussion
We have indicated that the p53 binding sites upstream of IGFBP-3 promoter are essential for its induction by p53, and that the induction can be suppressed by promoter hypermethylation in the human hepatoblastoma cell line HepG2. A working model of the p53 action in IGFBP-3 promoter upstream binding sites is summarized in Fig. 6. In this model, in normal cells, IGFBP-3 is induced by factors such as growth hormone (GH) and IGFs, and steady levels of expression are observed in some cells. That the deletion of p53 binding sites enhances the expression of IGFBP-3, suggests existence of negative regulators (Fig. 6A). In apoptotic cells, p53 tetramers at high levels of expression bind to upstream binding sites. These tetramers recruit the p300 complex to its binding site, thereby a p53-dependent high level of expression (Fig. 6B). In tumor cells, deletions, mutations, methylations of p53 binding sites, or mutations of p53 such as p53mt135, disturb the binding of p53 tetramers to their binding sites, and this prevents the binding of the p300 complex to IGFBP-3 promoter. As a result, the expression of IGFBP-3 is suppressed in tumor cells (Fig.6C). In this model, promoter hypermethylation has the same effect as promoter mutation in determining IGFBP-3 expression.

Our observations of promoter hypermethylation in human hepatocellular carcinomas and derivative cell lines (12), and the observations in this report strongly support the notion that IGFBP3 is a true tumor suppressor gene. IGFBP3 is a gene that is silenced by biallelic hypermethylation or hypermethylation and loss of heterogeneity (LOH) in human hepatocellular carcinoma. As reported recently [14], we have also observed the reduced expression of IGFBP-3 in several tumors such as, breast (9/41), uterus (11/42), ovary (6/16), kidney (6/20), and prostate (1/4) using the cancer profiling array (BD bioscience, data not shown). We therefore postulate that the tumor suppressor role of IGFBP-3 will not be limited to HCCs. In addition, there are also many reports of IGFBP-3 overexpression in tumors from breast [18], prostate [19], kidneys [20], and lung squamous cells [21], so on. We thus anticipate the existence of additional defects, such as papilloma virus infections that inactivate IGFBP-3 [22], TGF-β / Rb signalling abnormalities that often coincide with IGFBP-3 overexpression [23-25], or as yet unknown defects in IGFBP-3 receptor function leading to IGFBP-3, for these overexpression in tumors.

IGFBP-3 is a ubiquitous, multifunctional protein, whose importance as a carrier of IGFs is evident. The absence of gross loss-of-function mutations of IGFBP-3 observed to date likely underscores its functional importance. We hypothesize that IGFBP-3 is a gene whose basal level of expression is essential for cell survival, but upon induction by p53, high levels of expression of IGFBP-3 induces apoptosis. Alternatively, IGFBP-3 may be a gene that is essential for cell survival when induced by growth hormones or IGFs, but functions as an apoptotic mediator when induced by p53.

We observed slight base changes within p53 binding sites strongly influenced the induction of IGFBP-3 by p53. As SNPs that change the expression level of IGFBP-3 were within p53 binding sites [26], and it was reported that the IGFBP-3 is differentially activated by p53 mutants [27,28], we postulate that the expression and functions of IGFBP-3 is controlled in some way by p53 binding sites in the promoter of IGFBP-3. This may include the intronic p53 binding sites as well as the upstream sites explored here. IGFBP-3 may, therefore, have an important function in tumor development through p53 control.

We identified the MyoD (-195/-186) and WT1 (-164/-156) binding sites as well as p53 binding sites at the hypermethylation hot spot in HCC by promoter analysis using TRANSFAC (v 4.0). As MyoD is a transcription factor that can induce apoptosis, and WT1 is a tumor suppressor gene, the existence of a binding site for these putative regulator genes in the hot spot of the promoter of IGFBP-3 suggest the possibility that these genes also use IGFBP-3 as a mediator of their actions.

Conclusions
We conclude that four out of eleven p53 consensus sequences upstream of the IGFBP-3 promoter are essential for the p53 induced expression of IGFBP-3, and hypermethylation of these sequences selectively suppresses p53 induced IGFBP-3 expression in HepG2 cells. As IGFBP-3 functions downstream of many growth suppressors and its growth suppression effects are drastic, and as it is a small-sized secreted protein, the use of IGFBP-3 in tumor therapy will be a promising option.

Abbreviations
ALS; acid labile subunit, D-MEM; Dulbecco's modification of Eagle's medium DTT; dithiothreitol, EDTA; ethylenediaminetetra-acetic acid, EMSA; electrophoresis mobility shift assay, FCS; fetal calf serum, HCC; hepatocellular carcinoma, IGF; Insulin-like growth factor, IGFBP-3; Insulin-like growth factor binding protein-3, LOH; loss of heterogeneity, NaB; sodium butyrate, NaB-RE (sodium butyrate-responsive region), PBS; phosphate buffered saline, PCR; polymerase chain reaction, TGF-β; transforming growth factor-β, TNF-α; tumor necrosis factor-α, SEM; standard error of mean, SNP; single nucleotide polymorphism.

Competing interests
The author(s) declare that they have no competing interests.

Authors' contributions
TH carried out these studies and manuscript preparation, KN and YI participated plasmid construction and reporter assay, TS and HS participated the EMSA, EY helped the array study, TO participated in the design of the study and performed the statistical analysis. NK conceived of the study, and participated in its design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript.

Pre-publication history
The pre-publication history for this paper can be accessed here:



Acknowledgements
We Thank Dr. Y. Oh (Oregon Health Sciences University, Portland, OR) for providing pGL2-IGFBP-3 plasmid and Dr. R. Chaparro (Albert Einstein College of Medicine, New York, NY) for critical reading of this manuscript. This work was supported in part by grants-in aid for Scientific Research from the Ministry of Education, Science and Culture of Japan (#11770273).

Figures and Tables
Figure 1 Schematic genomic structure of the IGFBP3 gene. There exist 11 p53 consensus sequences upstream of the promoter [16] and two binding sites in introns [3]. Polymorphisms and hypermethylations are identified in the promoter upstream p53 binding sites [26, 12].

Figure 2 Deletion analysis of IGFBP-3 promoter for the induction by p53. HepG2 cells were transiently transfected with the panel of IGFBP-3 promoter-luciferase reporter constructs with (B) or without (A) co-transfection by pCMV-p53, and luciferase activity was measured after 48 h. Mean count of luciferase activity +/- SEM is shown.

Figure 3 Mutant analysis of IGFBP-3 promoter for the induction by p53. A, Schematic of four wild type p53 consensus sequence of IGFBP-3 (-159/-209) of pGL2-210 and mutant sequence carrying point mutations in the core consensus sequence (-179 C to T, -176 G to C) of pGL2-210B. B, HepG2 cells were transiently transfected with wild type IGFBP-3 promoter-luciferase reporter constructs pGL2-210 or mutant IGFBP-3 promoter-luciferase reporter constructs pGL2-210B with (filled box) or without (open box) co-transfection by pCMV-p53, and luciferase activity was measured after 48 h. Mean count of luciferase activity +/- SEM is shown.

Figure 4 Methylation analysis of IGFBP-3 promoter for induction by p53. A, Schematic of four wild type p53 consensus sequence of IGFBP-3 (-159/-209) of pGL2-210 and a sequence of the methylated construct carrying the CpG methylation in the core consensus sequence (underlined) of pGL2-210. B, HepG2 cells were transiently transfected with wild type IGFBP-3 promoter-luciferase reporter construct or methylated IGFBP-3 promoter-luciferase reporter construct with (filled box) or without (open box) co-transfection by pCMV-p53, and luciferase activity was measured after 48 h. Mean count of luciferase activity +/- SEM is shown.

Figure 5 Specific binding of p53 to IGFBP-3 promoter and its inhibition by methylation. 2 ng of end-labelled 278 bp of Mlu I-Bgl II fragment of pGL-210 were used for EMSA. To construct the methylated probe, a labelled fragment was methylated in vitro with Sss I methylase. Each reaction contained the components listed in Materials and Methods. 2.5 μg of H2O2-treated MCF7 with an induced p53 expression was used as nuclear extract. Supershift was obtained using 0.1 μg of anti-p53 (Ab-2). As competitor, 200 ng of the fragment that carries the core p53 binding site (-210/-149) were used. The mixture was incubated at room temperature for 20 min and analyzed on 4 % nondenaturating polyacrylamide gel in 0.5 × Tris-Glycine buffer. Supershift bands observed in lane 4 were indicated by arrows.

Figure 6 Working model of p53 action to IGFBP-3 promoter. In normal cells, IGFBP-3 is induced by such as growth hormone and IGFs, and steady level of expression is observed in some cells. As the deletion of p53 binding sites enhances the expression of IGFBP-3, the binding of negative regulators is expected (Fig. 6A). In apoptotic cells, p53 tetramers at high level of expression bind to upstream binding sites. These tetramers recruit the p300 complex to its binding site, and a p53 dependent high level of expression is observed (Fig. 6B). In tumor cells, deletions, mutations, methylations of p53 binding sites, or mutations of p53 such as p53mt135, disturb the binding of p53 tetramers to its binding sites, and this prevents the binding of p300. As a result, the expression of IGFBP-3 is suppressed in tumor cells.

Table 1 Oligonucleotide DNAs used for construction of IGFBP-3 promoter mutants.

Plasmid	Cloned fragment*	sense primer** (5' to 3')	antisense primer** (5' to 3')	
pGL2-270	-270/+60	ggacgcgtctggagtgccggggtggc	ggagatctgctgtggaatccaggcag	
pGL2-240	-240/+60	ggacgcgtggttcttgtagacgacaa	ggagatctgctgtggaatccaggcag	
pGL2-210	-210/+60	ggacgcgtcgggcgtgagcacgagga	ggagatctgctgtggaatccaggcag	
pGL2-180	-180/+60	ggacgcgtgcgagtctcgagctgcac	ggagatctgctgtggaatccaggcag	
pGL2-150	-150/+60	ggacgcgtggccccggctgctcaggg	ggagatctgctgtggaatccaggcag	
pGL2-120	-120/+60	ggacgcgtcccgcagccgtgcctgcg	ggagatctgctgtggaatccaggcag	
pGL2-90	-90/+60	ggacgcgtcctcccaacccccactcc	ggagatctgctgtggaatccaggcag	
pGL2-60	-60/+60	ggacgcgtccggggcgtgtcctgggc	ggagatctgctgtggaatccaggcag	
pGL2-30	-30/+60	ggacgcgttatatacgggccggcgcg	ggagatctgctgtggaatccaggcag	
pGL2-1	+1/+60	ggacgcgtagatgcgagcactgcggc	ggagatctgctgtggaatccaggcag	
pGL2-210B***	-210/+60	ggacgcgtctgcagcgggcgtgagcacga
ggagcaggtgcccgggtgactctcgagct	agctcgagagtcacccgggcacctgctcc
tcgtgctcacgcccgctgcagacgcgtcc	
*; The number is indicated by transcription start site as +1.

**; Mlu I restriction site is included in sense primers and Bgl II restriction site is included in antisense primers.

***; pGL-210B was made by replacing Mlu I-Xho I fragment of pGL2-210 with the oligonucleotide DNA indicated.
==== Refs
Clemmons DR  Insulin-like growth factor binding proteins and their role in controlling IGF actions Cytokine Growth Factor Rev 1997 8 45 62 9174662 10.1016/S1359-6101(96)00053-6 
Lee KW Cohen P  Nuclear effects: unexpected intracellular actions of insulin-like growth factor binding protein-3 J Endocrinol 2002 175 33 40 12379488 10.1677/joe.0.1750033 
Buckbinder L Talbott R Velasco-Miguel S Takenaka I Faha B Seizinger BR Kley N  Induction of the growth inhibitor IGF-binding protein 3 by p53 Nature 1995 377 646 649 7566179 10.1038/377646a0 
Gucev ZS Oh Y Kelley KM Rosenfeld RG  Insulin-like growth factor binding protein 3 mediates retinoic acid- and transforming growth factor beta2-induced growth inhibition in human breast cancer cells Cancer Res 1996 56 1545 1550 8603400 
Rajah R Valentinis B Cohen P  Insulin-like growth factor (IGF)-binding protein-3 induces apoptosis and mediates the effects of transforming growth factor-beta1 on programmed cell death through a p53- and IGF-independent mechanism J Biol Chem 1997 272 12181 12188 9115291 10.1074/jbc.272.18.12181 
Besset V Le Magueresse-Battistoni B Collette J Benahmed M  Tumor necrosis factor alpha stimulates insulin-like growth factor binding protein 3 expression in cultured porcine Sertoli cells Endocrinology 1996 137 296 303 8536626 10.1210/en.137.1.296 
Hong J Zhang G Dong F Rechler MM  Insulin-like Growth Factor (IGF)-binding Protein-3 Mutants That Do Not Bind IGF-I or IGF-II Stimulate Apoptosis in Human Prostate Cancer Cells J Biol Chem 2002 277 10489 10497 11784719 10.1074/jbc.M109604200 
Kim DG Lee DY Cho BH You KR Kim MY Ahn DS  Down-regulation of insulin-like growth factor binding proteins and growth modulation in hepatoma cells by retinoic acid Hepatology 1999 29 1091 1098 10094952 10.1002/hep.510290414 
Huynh H Chow PK Ooi LL Soo KC  A possible role for insulin-like growth factor-binding protein-3 autocrine/paracrine loops in controlling hepatocellular carcinoma cell proliferation Cell Growth Differ 2002 13 115 122 11959812 
Zimmermann EM Li L Hoyt EC Pucilowska JB Lichtman S Lund PK  Cell-specific localization of insulin-like growth factor binding protein mRNAs in rat liver Am J Physiol Gastrointest Liver Physiol 2000 278 G447 57 10712265 
Zou T Fleisher AS Kong D Yin J Souza RF Wang S Smolinski KN Abraham JM Meltzer SJ  Sequence alterations of insulin-like growth factor binding protein 3 in neoplastic and normal gastrointestinal tissues Cancer Res 1998 58 4802 4804 9809981 
Hanafusa T Yumoto Y Nouso K Nakatsukasa H Onishi T Fujikawa T Taniyama M Nakamura S Uemura M Takuma Y Yumoto E Higashi T Tsuji T  Reduced expression of insulin-like growth factor binding protein-3 and its promoter hypermethylation in human hepatocellular carcinoma Cancer Lett 2002 176 149 158 11804742 10.1016/S0304-3835(01)00736-4 
Fraga MF Herranz M Espada J Ballestar E Paz MF Ropero S Erkek E Bozdogan O Peinado H Niveleau A Mao JH Balmain A Cano A Esteller M  A mouse skin multistage carcinogenesis model reflects the aberrant DNA methylation patterns of human tumors Cancer Res 2004 64 5527 5534 15313885 
Chang YS Wang L Suh YA Mao L Karpen SJ Khuri FR Hong WK Lee HY  Mechanisms underlying lack of insulin-like growth factor-binding protein-3 expression in non-small-cell lung cancer Oncogene 2004 23 6569 6580 15247904 10.1038/sj.onc.1207882 
Walker GE Wilson EM Powell D Oh Y  Butyrate, a histone deacetylase inhibitor, activates the human IGF binding protein-3 promoter in breast cancer cells: molecular mechanism involves an Sp1/Sp3 multiprotein complex Endocrinology 2001 142 3817 3827 11517158 10.1210/en.142.9.3817 
Bourdon JC Deguin-Chambon V Lelong JC Dessen P May P Debuire B May E  Further characterisation of the p53 responsive element--identification of new candidate genes for trans-activation by p53 Oncogene 1997 14 85 94 9010235 10.1038/sj.onc.1200804 
Cubbage ML Suwanichkul A Powell DR  Insulin-like growth factor binding protein-3. Organization of the human chromosomal gene and demonstration of promoter activity J Biol Chem 1990 265 12642 12649 1695633 
Rocha RL Hilsenbeck SG Jackson JG Lee AV Figueroa JA Yee D  Correlation of insulin-like growth factor-binding protein-3 messenger RNA with protein expression in primary breast cancer tissues: detection of higher levels in tumors with poor prognostic features J Natl Cancer Inst 1996 88 601 606 8609661 
Singh D Febbo PG Ross K Jackson DG Manola J Ladd C Tamayo P Renshaw AA D'Amico AV Richie JP Lander ES Loda M Kantoff PW Golub TR Sellers WR  Gene expression correlates of clinical prostate cancer behavior Cancer Cell 2002 1 203 209 12086878 10.1016/S1535-6108(02)00030-2 
Yamazaki K Sakamoto M Ohta T Kanai Y Ohki M Hirohashi S  Overexpression of KIT in chromophobe renal cell carcinoma Oncogene 2003 22 847 852 12584564 10.1038/sj.onc.1206153 
Kettunen E Anttila S Seppanen JK Karjalainen A Edgren H Lindstrom I Salovaara R Nissen AM Salo J Mattson K Hollmen J Knuutila S Wikman H  Differentially expressed genes in nonsmall cell lung cancer: expression profiling of cancer-related genes in squamous cell lung cancer Cancer Genet Cytogenet 2004 149 98 106 15036884 10.1016/S0165-4608(03)00300-5 
Mannhardt B Weinzimer SA Wagner M Fiedler M Cohen P Jansen-Durr P Zwerschke W  Human papillomavirus type 16 E7 oncoprotein binds and inactivates growth-inhibitory insulin-like growth factor binding protein 3 Mol Cell Biol 2000 20 6483 6495 10938125 10.1128/MCB.20.17.6483-6495.2000 
Fanayan S Firth SM Butt AJ Baxter RC  Growth inhibition by insulin-like growth factor-binding protein-3 in T47D breast cancer cells requires transforming growth factor-beta (TGF-beta ) and the type II TGF-beta receptor J Biol Chem 2000 275 39146 39151 10993898 10.1074/jbc.M006964200 
Fanayan S Firth SM Baxter RC  Signaling through the Smad pathway by insulin-like growth factor-binding protein-3 in breast cancer cells. Relationship to transforming growth factor-beta 1 signaling J Biol Chem 2002 277 7255 7261 11751851 10.1074/jbc.M108038200 
Laiho M DeCaprio JA Ludlow JW Livingston DM Massague J  Growth inhibition by TGF-beta linked to suppression of retinoblastoma protein phosphorylation Cell 1990 62 175 185 2163767 10.1016/0092-8674(90)90251-9 
Deal C Ma J Wilkin F Paquette J Rozen F Ge B Hudson T Stampfer M Pollak M  Novel promoter polymorphism in insulin-like growth factor-binding protein-3: correlation with serum levels and interaction with known regulators J Clin Endocrinol Metab 2001 86 1274 1280 11238520 10.1210/jc.86.3.1274 
Friedlander P Haupt Y Prives C Oren M  A mutant p53 that discriminates between p53-responsive genes cannot induce apoptosis Mol Cell Biol 1996 16 4961 4971 8756655 
Ludwig RL Bates S Vousden KH  Differential activation of target cellular promoters by p53 mutants with impaired apoptotic function Mol Cell Biol 1996 16 4952 4960 8756654

