
==== Front
BMC NephrolBMC Nephrology1471-2369BioMed Central London 1471-2369-6-11564212710.1186/1471-2369-6-1Research ArticlePolymorphisms of the insertion / deletion ACE and M235T AGT genes and hypertension: surprising new findings and meta-analysis of data Mondry Adrian 1mondry@hotmail.comLoh Marie 1marie_lohcs@yahoo.comLiu Pengbo 1pengbo_liu@yahoo.comZhu Ai- Ling 1zhuailing@hotmail.comNagel Mato 2nagel@moldiag.de1 Bioinformatics Institute, 30 Biopolis Street, #07-01 Matrix Building, 138671 Singapore2 MolDiag Ag, Albert- Schweitzer- Ring 32, 02943 Weisswasser, Germany2005 11 1 2005 6 1 1 28 7 2004 11 1 2005 Copyright © 2005 Mondry et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
Essential hypertension is a common, polygenic, complex disorder resulting from interaction of several genes with each other and with environmental factors such as obesity, dietary salt intake, and alcohol consumption. Since the underlying genetic pathways remain elusive, currently most studies focus on the genes coding for proteins that regulate blood pressure as their physiological role makes them prime suspects.

The present study examines how polymorphisms of the insertion/deletion (I/D) ACE and M235T AGT genes account for presence and severity of hypertension, and embeds the data in a meta-analysis of relevant studies.

Methods
The I/D polymorphisms of the ACE and M235T polymorphisms of the AGT genes were determined by RFLP (restriction fragment length polymorphism) and restriction analysis in 638 hypertensive patients and 720 normotensive local blood donors in Weisswasser, Germany. Severity of hypertension was estimated by the number of antihypertensive drugs used.

Results
No difference was observed in the allele frequencies and genotype distributions of ACE gene polymorphisms between the two groups, whereas AGT TT homozygotes were more frequent in controls (4.6% vs. 2.7%, P = .08). This became significant (p = 0.035) in women only. AGT TT genotype was associated with a 48% decrease in the risk of having hypertension (odds ratio: 0.52; 95% CI, 0.28 to 0.96), and this risk decreased more significantly in women (odds ratio: 0.28; 95% CI, 0.1 to 0.78). The meta-analysis showed a pooled odds ratio for hypertension of 1.21 (TT vs. MM, 95% CI: 1.11 to 1.32) in Caucasians. No correlation was found between severity of hypertension and a specific genotype.

Conclusion
The ACE I/D polymorphism does not contribute to the presence and severity of essential hypertension, while the AGT M235T TT genotype confers a significantly decreased risk for the development of hypertension in the population studied here. This contrasts to the findings of meta-analyses, whereby the T allele is associated with increased risk for hypertension.
==== Body
Background
Essential hypertension is a common, polygenic, complex disorder resulting from interaction of several genes with each other and with environmental factors such as obesity, dietary salt intake, and alcohol consumption. Since the underlying genetic pathways remain elusive[1], currently most studies focus on the genes coding for proteins that regulate blood pressure as their physiological role makes them prime suspects.

The Renin-Angiotensin System (RAS) has a central role in regulating blood pressure and sodium homeaostasis. Genes encoding components of RAS, including angiotensinogen (AGT), angiotensin-converting enzyme (ACE), angiotensinogen II type-1 receptor (AGTR1), and renin, have been extensively investigated as genetic determinants of essential hypertension [2]. Polymorphisms of RAS[3] genes seem also to play a role in the development of diseases that cause secondary hypertension[4,5]. Subjects carrying the ACE D allele have unanimously been shown to have increased ACE serum activity[3,6] while the T235 AGT variant has been associated with elevated angiotensinogen levels [7]. However, so far there are no consistent findings.

In 1992, the M235T AGT TT polymorphism was first reported to be associated with hypertension [8]. This finding has not been confirmed by all investigators[9,10]. Although no relationship between the ACE gene and hypertension was observed in one early linkage study [11] and most recent studies including one meta-analysis [12-14], several studies have suggested a role: hypertensive individuals have a high prevalence of the D allele or DD genotype [3,15,16].

The inconsistent results might be explained in part by the genetic and environmental heterogeneity among different ethnic groups [13]. On the other hand, one recent study [17] reported that the MM, AA, CC, DD/ID genotype combination was associated with a substantially higher prevalence of hypertension in the participants to the Olivetti Heart Study, even though no individual effect of each isolated genotype was detected.

The present study investigates the relationship between variants of the I/D ACE gene and M235T AGT gene, and the presence and severity of essential hypertension in a large homogeneous German population. The effect of a combination of ACE and AGT gene polymorphisms on hypertension was also examined.

Methods
Study design
The design of the study followed the guidelines proposed by Cooper et al [18], and the study was carried out in accordance with the Declaration of Helsinki [19].

Study population
This cross-sectional study comprised a total of 1358 individuals from Weisswasser, a county town of 25,000 in Saxony, Germany. After giving informed consent, 720 normotensive subjects were selected from local blood donors and 638 hypertensive patients from the local renal care center. All hypertensive patients included in the study had been diagnosed as suffering from primary hypertension by the attending consultants on first contact with the clinic. Hypertensives were defined as those who received at least one antihypertensive medication. At the time of blood sampling, 34.2% were diabetic (6 type 1, 212 type 2), and 65.1% were suffering from kidney disease. Of the 37 patients with K/DOQI stage 5 (Kidney failure: GFR, 15 ml/min/1.73 m2 or dialysis), 15 were due to diabetic nephropathy, 5 to chronic pyelonephritis, 1 to chronic glomerulonephritis, 1 light chain deposits, 1 polycystic kidney disease, and 14 of unknown cause (no biopsy obtained). The severity of hypertension was estimated based on the number of antihypertensive medications used, a surrogate marker for the severity of hypertension[8]. Age and gender distribution is described in table 1.

Genotyping
RFLP (restriction fragment length polymorphism) and restriction analysis were used to determine the frequencies of the I/D polymorphisms of the ACE gene, and homo-/ heterozygoty of the M235T AGT gene[20,21]. ACE I/D polymorphism was studied by PCR based amplification of a 597 bp long gene fragment of the ACE gene, which lacks 287 bp in case of the deletion (D) variant. The primers used were: sense- 5'GATGTGGCCATCACATTCGTCAGAT3', and antisense- 5'CTGGAGACCACTCCCATCCTTTCT3'.

AGT M235T polymorphism was studied by first amplifying a 104 bp long fragment of the AGT gene using the following primer sequences: sense- 5'CCGTTTGTGCAGGGCCTGGCTCTCT3', and antisense: 5'CAGGGTGCTGTCCACACTGGACCCC3'.

The M -> T point mutation at position 235 creates a detection site for the restriction enzyme Tth 111I.

Statistical analysis
Statistical analysis was carried out using SPSS personal computer statistical package (version 11.5, SSPS Inc, Chicago, IL). Demographic characteristics were compared by t test for continuous data and Pearson's χ2 test for categorical data. Allele frequencies were calculated with the gene-counting method. χ2 test was used for assessment of the Hardy-Weinberg equilibrium for the distribution of genotypes. Odds ratios were calculated with a 95% confidence interval. A P < .05 was considered significant.

Meta-analysis
A meta-analysis was performed using Review Manager 4.2 (The Cochrane Collaboration) to further examine the association of the AGT M235T gene polymorphisms with essential hypertension in Caucasians. A systematic literature search in PubMed Medline for articles published between April 2002 and June 2004 was carried out using the following MESH-headings: "angiotensinogen/genetics", "hypertension/genetics", "blood pressure/genetics", and "adult". The search was limited to articles published in English and studies on Caucasian human subjects. Only 2 studies were left after strict examination according to the exclusion criteria listed in [22]. A total of 25 studies were finally included: 22 were from the most recent meta-analysis [22], which covered articles from January 1992 to March 2002; 2 were selected from the query described above, and the last one was the present study. Homogeneity among studies was assessed on the basis of χ2 test using P-value < 0.05. The Mantel-Haenszel odds ratios were calculated by applying both fixed effect model and random effect model in case of heterogeneity.

Results
Demographic data are summarized in Table 1. Hypertensives were older (58.80 ± 13.22 years) than controls (41.24 ± 12.66 years, p < .0001), and more often male (53.2% vs. 44.4%, p = .001).

AGT M/T genotyping was successful in 637 hypertensives and 720 normotensives, and ACE I/D genotype was analyzed in 636 hypertensive and 719 control subjects. The roles of age and gender in the association between hypertension and ACE and AGT gene polymorphisms were examined by comparing the effects of ACE and AGT genotypes for hypertension in men and women, young and elderly subjects respectively. "Young" was defined as "age < 50 years old", and "elderly" was characterized as "age ≥ 50 years old".

ACE polymorphism
No differences were observed in ACE allele and genotype frequency distribution between hypertensives and controls with respect to gender and age, and no deviations from Hardy-Weinberg equilibrium were observed in any of subgroups (P > 0.1). ACE genotypes I/I, I/D and D/D were of almost identical frequency within both groups (P = 1.0, Figure 1). Risk assessment showed that there were no significant risk changes for hypertension in the subjects either with the ACE DD genotype (odds ratio: 1.00, 95% CI: 0.74 to 1.36, P = .98, Table 2) or D allele (odds ratio: D vs. I: 1.00, 95% CI: 0.86 to 1.17, P = .98).

AGT polymorphism
AGT T/T homozygotes tended to be more frequent in controls than in hypertensives (4.6% vs. 2.7%, Figure 2). In women, this finding became significant (5.3% vs. 1.7%, Figure 3), but no difference in AGT genotype frequency was found in men. The distribution of the AGT genotypes in all subgroups of the sample population was not in Hardy-Weinberg equilibrium (P < .001). AGT TT genotype was associated with a significant 48% decrease in the risk of being hypertensive (Table 2, odds ratio: 0.52; 95% CI: 0.28 to 0.96; P = .034), and this risk decreased even more to 72% in women (odds ratio: 0.28; 95% CI: 0.1 to 0.78; P = .01). However, no difference was observed in the AGT allele frequency distribution with respect to age and gender (Table 3, P > 0.05), and the effect of the AGT T allele did not reach a significant level in the decrease of hypertension risk (odds ratio: T vs. M: 0.88; 95% CI: 0.75 to 1.03; P = .12).

Meta-analysis of studies on AGT polymorphisms in Caucasians
When all studies were pooled, Caucasian individuals with TT genotype had an odds ratio for hypertension of 1.21(95% CI: 1.11 to 1.32) compared with those with MM genotype (Figure 4). The studies included in the meta-analysis are [8,20,23-43]. The pooled odds ratio (odds ratio: TT vs. MM: 1.23; 95% CI: 1.13 to 1.34) increased by 2.5% when the presented study was excluded. Tests for heterogeneity were significant (P < 0.001) in the above two cases, and the odds ratios (TT vs. MM) rose to 1.30 (95% CI: 1.10 to 1.54), and 1.35 (95% CI: 1.15 to 1.59) respectively when applying the random effects model.

Combination of ACE and AGT polymorphisms
The effect of eight combinations (TT, DD/ID; TT, II/ID; MM, DD/ID; MM, II/ID; DD MM/MT; DD, TT/MT; II, MM/MT; II, TT/MT) on hypertension was examined. No statistically significant association was observed between any combination above and hypertension in all subjects combined. Nonetheless, in women, both genotypes of TT, DD/ID and TT, II/ID were significantly associated with lower prevalence of hypertension (Table 2, 20% vs. 43.3%, odds ratio: 0.33, P = 0.038; 19% vs.43.6%, odds ratio: 0.31, P = 0.026), while MM, DD/ID genotype significantly increased the risk for hypertension (Table 2, 49.2% vs. 40.1%, odds ratio: 1.45, P = 0.028).

No association could be identified between severity of hypertension and a specific ACE or AGT genotype (Table 4).

Discussion
Although some recent studies [15,16,44,45] suggested a unique sex-specific role of ACE in essential hypertension, no significant association of essential hypertension with the ACE gene I/D polymorphism was observed in this German population of 1,358 for either gender. This finding confirms earlier observations in another German population [31], in other Caucasian populations [11,12,14,46], and in one meta-analysis [13]. The distribution of the ACE genotypes was in Hardy-Weinberg equilibrium in this German population while that was not the case in Pereira et al's study [1]. One possible explanation is the ethnic difference. Pereira et al. [1] showed that there were statistically different ACE I/D polymorphism genotypic frequencies in different ethnic groups.

Surprisingly, the cross-sectional study presented here shows a higher prevalence of the T/T M235T AGT gene in the control group compared to the hypertensive group. AGT TT genotype was associated with a decrease in the risk for hypertension (odds ratio-TT vs. MM: 0.52; 95% CI: 0.28 to 0.96) and a more significant association was found in women (odds ratio-TT vs. MM: 0.28; 95% CI: 0.1 to 0.78), compared to men. This is in stark contrast to findings from previous studies, including two German datasets [31,32], and three meta-analyses [10,22,47], which reported that the AGT 235 T-allele and/or TT genotype significantly increased the risk for essential hypertension in Caucasians: odds ratio T vs. M was 1.20 (95% CI: 1.11 to 1.29) [10], odds ratio TT vs. MM was 1.31 [47], and odds ratio TT vs. MM was 1.19 (95% CI: 1.10 to 1.30)[22]. In agreement with the previous meta-analyses, the meta-analysis presented here showed increased odds for hypertension (odds ratio: TT vs. MM: 1.21) in Caucasians conferred by TT, and the odds ratio rose by 2.5% when the present study was excluded. Of the 25 studies included in the present meta-analysis, the present study was the only one in which the AGT T235T genotype decreased odds for hypertension. Nevertheless, the quality of meta-analysis results depends on the quality of the individual studies included, and unusual sample sizes might bias the finding. For example, one single study [43] included in the previously largest meta-analysis [22] was exceptionally large, giving it enormous weight. The highly variable study quality implies that all interpretations must be made with great caution, as was explicitly pointed out by Kunz et al. [10]

Although no significant difference was observed in AGT T allele frequency distribution between hypertensives and controls with respect to age and gender, the frequency of the AGT T allele among normotensives was higher than that among hypertensives (0.36 vs. 0.33). This was inconsistent with one previous meta-analysis in Caucasians, which showed that among controls, the mean allele frequency for the AGT T allele was 0.41 (95% CI: 0.34 to 0.48), and among cases, increased to 0.45 (95% CI: 0.38 to 0.52) [10]. In the present study, the frequency of the AGT T allele among hypertensives (0.33) was outside the lower border of the 95% confidence interval (0.38 to 0.52) reported in [10]. This may reveal the specific genetic background of this particular German population.

The AGT genotype distribution is not in Hardy-Weinberg equilibrium (P < 0.001) while no deviations from Hardy-Weinberg equilibrium are observed on the ACE genotype distribution in the same population. This may be explained by a shift toward a higher frequency of MT individuals (62.4%) instead of TT individuals (3.7%) in this specific population.

The study population presented here contains a large proportion (65%) of patients with renal disease. While selection of participants based on patient records excluded those patients that had symptoms suggesting the diagnosis of secondary hypertension at first contact, the possibility remains that at least a part of the study population suffers from renal rather than essential hypertension. It should be noted, however, that the majority of studies included in the presented meta-analysis does not give specific information regarding renal function of hypertensives, and the largest study [43] is population based and does not name any specific, kidney related exclusion criteria.

Another possible explanation is that the AGT T allele frequency may decrease with age, which was reported from the United Arab Emirates [48]. The prevalence of hypertension increases with advancing age. According to the National Health and Nutrition Examination Survey III (NHANES III) prevalence estimates for the years 1988–1994, American Whites aged 55 to 64 years have a more than threefold higher prevalence of hypertension (42.1%) than those aged 35 to 44 years (11.3%) [49]. Frossard et al detected that AGT T allele frequency decreased with age in the United Arab Emirates[48]. The ACE DD genotype was found associated with human longevity [50]. In the present study, normotensives are significantly younger than hypertensives (41 ± 12 yrs vs. 59 ± 13 yrs). It is conceivable that many of the young individuals are at hypertension risk because of their ACE or AGT genotype, but have not yet shown hypertension at the time of genotyping, and may develop hypertension in their older age. This might lead to some misclassifications and hence reduce the power of this study. On the other hand, two studies of German populations [32,51] reported that the AGT T allele was a risk factor for hypertension in individuals younger than 50 years of age. In the present study, young hypertensives had a higher frequency of the AGT T allele than elderly hypertensives (0.36 vs. 0.32), but the difference didn't reach statistical significance (p = .22). It is possible that the small percentage (24.9%) of the studied hypertensives under 50 years of age biased the finding.

A number of studies [51-54] examined the relationship between RAS genotype and the severity of hypertension, but their results were contradictory. In accordance with two [52,54] of them including one German dataset, the present study fails to find an effect of the AGT or ACE genotype on the severity of hypertension. Nevertheless, in the present study, hypertensives that carried at least one copy of the AGT T allele (TT or MT: n = 397) were less likely to take two or more antihypertensive medications than those with MM genotype (n = 225) (odds ratio -TT or MT vs. MM: 0.797; 95% CI: 0.57 to 1.12; P = .185), and their average number of antihypertensive drugs was lower (2.09 vs. 2.20; P = .276). Despite not reaching statistical significance, this observation was in contrast to Schunkert et al's study [51] on another German population (subjects initially participated in the MONICA Augsburg cohort baseline survey), which found that the carriers of the AGT T allele (n = 418) had a 2.1-fold higher probability of taking two or more antihypertensive drugs than individuals with the MM genotype (n = 216). It is worth pointing out that in the present study, the number of subjects taking antihypertensive medications is much larger than in Schunkert et al's study (622 vs. 143). While the data is far from statistical significance, the trend is in line with those findings that associate rather the M allele with hypertension in the present study.

The effect of a combination of RAAS genes' polymorphisms on blood pressure has been investigated in the participants to the Olivetti Heart Study [17], in which the MM, AA, CC, DD/ID genotype was detected to be associated with a substantially higher prevalence of hypertension in the absence of detectable effects of each individual polymorphism at any single locus. The present study showed very similar findings in women: MM, DD/ID genotype significantly increased the odds for hypertension (odds ratio: 1.45; 95% CI: 1.04 to 2.02), while TT, DD/ID and TT, II/ID were significantly associated with lower prevalence of hypertension (odds ratio: 0.33, 95% CI: 0.11 to 0.99; odds ratio: 0.31, 95% CI: 0.10 to 0.92). The risk of hypertension in the women with TT, DD/ID and TT, II/ID, however, didn't change much compared with those with TT alone (odds ratio: 0.31, 95% CI: 0.12 to 0.83). This suggests that there is only a slight synergistic effect between the AGT and ACE genes.

Although in most surveys the prevalence of hypertension appears to be equal in women and men [55], sex-specific effects of ACE or AGT genes on hypertension have been reported recently [16,43]. For instance, Sethi et al. [43] found the AGT TT associated with an increase in risk for hypertension in women but not in men from the Copenhagen City Heart Study with a population of 9100 subjects, and an association of the ACE DD genotype with increased diastolic blood pressure was detected in men, but not in women from the Framingham Heart Study [16]. In the present study, the AGT TT genotype was negatively correlated to hypertension in women only while no sex-specific effect of the ACE gene was shown. It is possible that the fact is covered by the different gender distributions: in this population, there are more women in normotensives than in hypertensives (55.6% vs. 46.8%, P = .001).

In addition to the factor declared above, the result may be influenced by the study design and the composition of the sample population. The study design itself may influence the results. As mentioned above, this study was a cross-sectional study where subjects were assessed at a single time, and at that time most of the controls were younger than 50 years old. Animal studies have shown that hypertension genes may be activated for only certain periods during the life history of an organism [2]. Hence, some of them might develop hypertension at an older age, resulting from the activated hypertension genes. Longitudinal studies are needed to further examine the relationship between hypertension and genes at different ages.

The population can be described as static population with a mixed Germanic-Slavonic background. Due to the location (a provincial town on the German-Polish border) and political and historical setting (little population fluctuation during the over 140 years of imperial, fascist and socialist rule, no influx due to lack of economic attractivity after reunification), the population may be assumed as homogeneous. Several recent studies [56-61] have reported significant differences in prevalence of hypertension between Germany and Poland, which, however, are assumed to be largely dependent on life-style differences, mostly salt intake. These differences, however, are unlikely to play a role in the study population due to its homogeneity with regards to life style preferences following successful assimilation over many generations. In the case of ACE polymorphism with all allele frequencies greater than 15%, there is no need to examine population stratification [62]. This becomes more urgent for AGT where there is no Hardy- Weinberg equilibrium. As the sample information, however, does not include data on the ethnic background of the probands, additional haplotyping carried out on the samples would not have allowed to rectify for the historical ethnic background (Germanic versus Slavonic).[62,63]

In the meantime, it should be noted that the present study was carried out on an unusually large population (second only to one in 63 studies included in Sethi's meta-analysis[22]). Given the large homogeneous population-based sample, the findings cannot be attributed to simple selection bias. Therefore, the finding that the AGT TT genotype associated with a decreased risk for essential hypertension is likely to be true for this particular German population.

Conclusions
Despite the limitations mentioned, this cross-sectional study does not support the notion that the ACE I/D polymorphism contributes to the prevalence and severity of essential hypertension. However, the M235T TT genotype of AGT gene was detected to confer a significantly decreased risk for the prevalence of hypertension in women from this particular population. Despite the large sample size, the present study fails to revise the odds ratio in a meta-analysis of a total of 25 studies on the association between the AGT M235T polymorphisms and hypertension in caucasians. This observation may reflect a very specific local inheritance pattern of the AGT genotypes. If this holds true, studies aiming at drug development based on genomic traits must be scrutinized rigorously as therapeutic recommendations may be valid for selected subpopulations only[64].

Competing interests
The author(s) declare that they have no competing interests.

Authors' contributions
M.N. designed and initiated the study, analyzed the samples and wrote part of the manuscript. A-L.Z. and M.L. did the statistical analysis. A.M. devised the concept for meta-analysis and wrote the manuscript. L.P. created the figures. M.N. and A.M. should be considered as joint co- authors.

Pre-publication history
The pre-publication history for this paper can be accessed here:



Figures and Tables
Figure 1 ACE genotypes and allele frequencies, both genders combined. No significant differences. F(D): frequency of D- allele.

Figure 2 AGT genotypes and allele frequencies, both genders combined. No significant differences. F(T): frequency of T- allele.

Figure 3 AGT genotypes and allele frequencies in women (significant at p = 0.035). F(T): frequency of T- allele.

Figure 4 Risk of hypertension associated with the AGT M235T genotypes in Caucasians.

Table 1 Demographic features. M: male. F: female.

	Hypertensives (n = 638)	Normotensives (n = 720)	P- value	
Gender (M/F)	339/298	319/400	0.001	
Age (yrs, + SD	58.80 ± 13.22	41.24 ± 12.66	< 0.001	
Age < 50 yrs: n (%)	159 (24.9%)	547 (76.0%)	< 0.001	
Age > 50 yrs: n (%)	479 (75.1%)	173 (24.0%)	< 0.001	
Table 2 Hypertension risks estimates for AGT and ACE genotypes by gender.

Odds ratio (95%CI)	
MT vs. MM	TT vs. MM	ID vs. II	DD vs. II	MM DD/ID vs. Others	MM II/ID vs. Others	TT DD/ID vs. Others	TT II/ID vs. Others	
	
0.87	0.52	1	1	1.2	1.04	0.56	0.56	
(0.69–1.09)	(0.28–0.96)*	(0.77–1.31)	(0.74–1.36)	(0.94–1.53)	(0.81–1.34)	(0.28–1.09)	(0.28–1.12)	
0.82	0.83	0.83	0.79	1	1.16	0.85	1.08	
(0.59–1.15)	(0.36–1.93)	(0.57–1.21)	(0.52–1.22)	(0.76–1.43)	(0.81–1.66)	(0.34–2.11)	(0.39–3.01)	
0.88	0.28	1.26	1.32	1.45	0.97	0.33	0.31	
(0.64–1.21)	(0.10–0.78)*	(0.85–1.85)	(0.86–2.03)	(1.04–2.02)*	(0.69–1.37)	(0.11–0.99)*	(0.10–0.92)*	
*P < 0.05; CI, confidence interval.

Table 3 AGT T allele frequencies by age and gender.

	f(T)	
		
	Hypertensives (n)	Normotensives (n)	P- value	
Age < 50 yrs	0.36 (159)	0.36 (547)	NS	
Age ≥ 50 yrs	0.32 (479)	0.37 (173)	NS	
Male	0.35 (339)	0.37 (319)	NS	
Female	0.32 (298)	0.36 (400)	NS	
Total	0.33 (638)	0.36 (720)	NS	
f(T), frequency of AGT T allele; NS, not significant; yrs, years.

Table 4 Prevalence of ACE and AGT genotypes by severity of hypertension.

	ACE Genotype n (%)	AGT Genotype n (%)	
		
	II	ID	DD	P- value	MM	MT	TT	P- value	
Hypertensive, one drug	56 (22)	120 (48)	74 (30)	0.458	83 (33)	163 (65)	5 (2)	0.225	
Hypertensive, > two drugs	89 (24)	189 (51)	93 (25)	0.458	142 (38)	217 (59)	12 (3)	0.225
==== Refs
Pereira AC Mota GF Cunha RS Herbenhoff FL Mill JG Krieger JE  Angiotensinogen 235T allele "dosage" is associated with blood pressure phenotypes Hypertension 2003 41 25 30 12511525 10.1161/01.HYP.0000047465.97065.15 
Thiel B Weder AB  Genes for Essential Hypertension: Hype, Help, or Hope? J Clin Hypertens (Greenwich) 2000 2 187 193 11416645 
Rigat B Hubert C Alhenc-Gelas F Cambien F Corvol P Soubrier F  An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels J Clin Invest 1990 86 1343 1346 1976655 
Bantis C  Einfluss genetischer Polymorphismen des Renin-Angiotensin-Systems auf die primären chronischen Glomerulonephritiden. Klinik für Nephrologie 2002 Düsseldorf, Heinrich- Heine- Universität 
Bantis C Ivens K Kreusser W Koch M Klein-Vehne N Grabensee B Heering P  Influence of genetic polymorphisms of the renin-angiotensin system on IgA nephropathy Am J Nephrol 2004 24 258 267 15031629 10.1159/000077398 
Tsukada K Ishimitsu T Tsuchiya N Horinaka S Matsuoka H  Angiotensin-converting enzyme gene polymorphism and cardiovascular endocrine system in coronary angiography patients Jpn Heart J 1997 38 799 810 9486933 
Miller JA Scholey JW  The impact of renin-angiotensin system polymorphisms on physiological and pathophysiological processes in humans Curr Opin Nephrol Hypertens 2004 13 101 106 15090866 
Jeunemaitre X Soubrier F Kotelevtsev YV Lifton RP Williams CS Charru A Hunt SC Hopkins PN Williams RR Lalouel JM  Molecular basis of human hypertension: role of angiotensinogen Cell 1992 71 169 180 1394429 10.1016/0092-8674(92)90275-H 
Brand E Chatelain N Keavney B Caulfield M Citterio L Connell J Grobbee D Schmidt S Schunkert H Schuster H Sharma AM Soubrier F  Evaluation of the angiotensinogen locus in human essential hypertension: a European study Hypertension 1998 31 725 729 9495253 
Kunz R Kreutz R Beige J Distler A Sharma AM  Association between the angiotensinogen 235T-variant and essential hypertension in whites: a systematic review and methodological appraisal Hypertension 1997 30 1331 1337 9403549 
Jeunemaitre X Lifton RP Hunt SC Williams RR Lalouel JM  Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension Nat Genet 1992 1 72 75 1338766 10.1038/ng0492-72 
Harrap SB Tzourio C Cambien F Poirier O Raoux S Chalmers J Chapman N Colman S Leguennec S MacMahon S Neal B Ohkubo T Woodward M  The ACE gene I/D polymorphism is not associated with the blood pressure and cardiovascular benefits of ACE inhibition Hypertension 2003 42 297 303 12925557 10.1161/01.HYP.0000088322.85804.96 
Staessen JA Wang JG Ginocchio G Petrov V Saavedra AP Soubrier F Vlietinck R Fagard R  The deletion/insertion polymorphism of the angiotensin converting enzyme gene and cardiovascular-renal risk J Hypertens 1997 15 1579 1592 9488209 10.1097/00004872-199715120-00059 
Lachurie ML Azizi M Guyene TT Alhenc-Gelas F Menard J  Angiotensin-converting enzyme gene polymorphism has no influence on the circulating renin-angiotensin-aldosterone system or blood pressure in normotensive subjects Circulation 1995 91 2933 2942 7796503 
Higaki J Baba S Katsuya T Sato N Ishikawa K Mannami T Ogata J Ogihara T  Deletion allele of angiotensin-converting enzyme gene increases risk of essential hypertension in Japanese men : the Suita Study Circulation 2000 101 2060 2065 10790347 
O'Donnell CJ Lindpaintner K Larson MG Rao VS Ordovas JM Schaefer EJ Myers RH Levy D  Evidence for association and genetic linkage of the angiotensin-converting enzyme locus with hypertension and blood pressure in men but not women in the Framingham Heart Study Circulation 1998 97 1766 1772 9603529 
Siani A Russo P Paolo Cappuccio F Iacone R Venezia A Russo O Barba G Iacoviello L Strazzullo P  Combination of renin-angiotensin system polymorphisms is associated with altered renal sodium handling and hypertension Hypertension 2004 43 598 602 14967847 10.1161/01.HYP.0000117985.57001.b3 
Cooper DN Nussbaum RL Krawczak M  Proposed guidelines for papers describing DNA polymorphism-disease associations Hum Genet 2002 110 207 208 11935332 10.1007/s00439-001-0672-4 
World medical association declaration of Helsinki The journal of American medical association 2000 284 3043 3045 10.1001/jama.284.23.3043 
Marre M Jeunemaitre X Gallois Y Rodier M Chatellier G Sert C Dusselier L Kahal Z Chaillous L Halimi S Muller A Sackmann H Bauduceau B Bled F Passa P Alhenc-Gelas F  Contribution of genetic polymorphism in the renin-angiotensin system to the development of renal complications in insulin-dependent diabetes: Genetique de la Nephropathie Diabetique (GENEDIAB) study group J Clin Invest 1997 99 1585 1595 9120002 
Russ AP Maerz W Ruzicka V Stein U Gross W  Rapid detection of the hypertension-associated Met235-->Thr allele of the human angiotensinogen gene Hum Mol Genet 1993 2 609 610 8518804 
Sethi AA Nordestgaard BG Tybjaerg-Hansen A  Angiotensinogen gene polymorphism, plasma angiotensinogen, and risk of hypertension and ischemic heart disease: a meta-analysis Arterioscler Thromb Vasc Biol 2003 23 1269 1275 12805070 10.1161/01.ATV.0000079007.40884.5C 
Procopciuc L Popescu T Jebeleanu G Pop D Zdrenghea D  Essential arterial hypertension and polymorphism of angiotensinogen M235T gene J Cell Mol Med 2002 6 245 250 12169209 
Fardella CE Claverie X Vignolo P Montero J Villarroel L  T235 variant of the angiotensinogen gene and blood pressure in the Chilean population J Hypertens 1998 16 829 833 9663923 10.1097/00004872-199816060-00014 
Caulfield M Lavender P Farrall M Munroe P Lawson M Turner P Clark AJ  Linkage of the angiotensinogen gene to essential hypertension N Engl J Med 1994 330 1629 1633 8177268 10.1056/NEJM199406093302301 
Davis D Liyou N Lockwood D Johnson A  Angiotensinogen genotype, plasma protein and mRNA concentration in isolated systolic hypertension Clin Genet 2002 61 363 368 12081721 10.1034/j.1399-0004.2002.610508.x 
Barley J Blackwood A Sagnella G Markandu N MacGregor G Carter N  Angiotensinogen Met235-->Thr polymorphism in a London normotensive and hypertensive black and white population J Hum Hypertens 1994 8 639 640 7990101 
Fernandez-Llama P Poch E Oriola J Botey A Rivera F Revert L  Angiotensinogen gene M235T and T174M polymorphisms in essential hypertension: relation with target organ damage Am J Hypertens 1998 11 439 444 9607382 10.1016/S0895-7061(97)00483-4 
Borecki IB Province MA Ludwig EH Ellison RC Folsom AR Heiss G Lalouel JM Higgins M Rao DC  Associations of candidate loci angiotensinogen and angiotensin-converting enzyme with severe hypertension: The NHLBI Family Heart Study Ann Epidemiol 1997 7 13 21 9034402 10.1016/S1047-2797(97)00155-5 
Jeunemaitre X Charru A Chatellier G Dumont C Sassano P Soubrier F Menard J Corvol P  M235T variant of the human angiotensinogen gene in unselected hypertensive patients J Hypertens Suppl 1993 11 Suppl 5 S80 1 8158445 
Mondorf UF Russ A Wiesemann A Herrero M Oremek G Lenz T  Contribution of angiotensin I converting enzyme gene polymorphism and angiotensinogen gene polymorphism to blood pressure regulation in essential hypertension Am J Hypertens 1998 11 174 183 9524045 10.1016/S0895-7061(97)00402-0 
Schmidt S Sharma AM Zilch O Beige J Walla-Friedel M Ganten D Distler A Ritz E  Association of M235T variant of the angiotensinogen gene with familial hypertension of early onset Nephrol Dial Transplant 1995 10 1145 1148 7478115 
Rodriguez-Perez JC Rodriguez-Esparragon F Hernandez-Perera O Anabitarte A Losada A Medina A Hernandez E Fiuza D Avalos O Yunis C Ferrario CM  Association of angiotensinogen M235T and A(-6)G gene polymorphisms with coronary heart disease with independence of essential hypertension: the PROCAGENE study. Prospective Cardiac Gene J Am Coll Cardiol 2001 37 1536 1542 11345362 10.1016/S0735-1097(01)01186-X 
Wang WY Glenn CL Zhang W Benjafield AV Nyholt DR Morris BJ  Exclusion of angiotensinogen gene in molecular basis of human hypertension: sibpair linkage and association analyses in Australian anglo-caucasians Am J Med Genet 1999 87 53 60 10528248 10.1002/(SICI)1096-8628(19991105)87:1<53::AID-AJMG11>3.0.CO;2-I 
Fornage M Turner ST Sing CF Boerwinkle E  Variation at the M235T locus of the angiotensinogen gene and essential hypertension: a population-based case-control study from Rochester, Minnesota Hum Genet 1995 96 295 300 7649545 10.1007/BF00210410 
Rodriguez-Perez JC Rodriguez-Esparragon FJ Hernandez-Perera O Fiuza-Perez MD Anabitarte-Prieto A Losada-Cabrera A  Effects of the angiotensinogen gene M235T and A(-6)G variants on blood pressure and other vascular risk factors in a Spanish population J Hum Hypertens 2000 14 789 793 11114694 10.1038/sj.jhh.1001110 
Vasku A Soucek M Znojil V Rihacek I Tschoplova S Strelcova L Cidl K Blazkova M Hajek D Holla L Vacha J  Angiotensin I-converting enzyme and angiotensinogen gene interaction and prediction of essential hypertension Kidney Int 1998 53 1479 1482 9607178 10.1046/j.1523-1755.1998.00924.x 
Hingorani AD Sharma P Jia H Hopper R Brown MJ  Blood pressure and the M235T polymorphism of the angiotensinogen gene Hypertension 1996 28 907 911 8901843 
Tiret L Ricard S Poirier O Arveiler D Cambou JP Luc G Evans A Nicaud V Cambien F  Genetic variation at the angiotensinogen locus in relation to high blood pressure and myocardial infarction: the ECTIM Study J Hypertens 1995 13 311 317 7622852 
Kiema TR Kauma H Rantala AO Lilja M Reunanen A Kesaniemi YA Savolainen MJ  Variation at the angiotensin-converting enzyme gene and angiotensinogen gene loci in relation to blood pressure Hypertension 1996 28 1070 1075 8952598 
Johnson AG Simons LA Friedlander Y Simons J Davis DR MaCallum J  M235-->T polymorphism of the angiotensinogen gene predicts hypertension in the elderly J Hypertens 1996 14 1061 1065 8986904 
Tiret L Blanc H Ruidavets JB Arveiler D Luc G Jeunemaitre X Tichet J Mallet C Poirier O Plouin PF Cambien F  Gene polymorphisms of the renin-angiotensin system in relation to hypertension and parental history of myocardial infarction and stroke: the PEGASE study. Projet d'Etude des Genes de l'Hypertension Arterielle Severe a moderee Essentielle J Hypertens 1998 16 37 44 9533415 10.1097/00004872-199816010-00007 
Sethi AA Nordestgaard BG Agerholm-Larsen B Frandsen E Jensen G Tybjaerg-Hansen A  Angiotensinogen polymorphisms and elevated blood pressure in the general population: the Copenhagen City Heart Study Hypertension 2001 37 875 881 11244011 
Fornage M Amos CI Kardia S Sing CF Turner ST Boerwinkle E  Variation in the region of the angiotensin-converting enzyme gene influences interindividual differences in blood pressure levels in young white males Circulation 1998 97 1773 1779 9603530 
Gesang L Liu G Cen W Qiu C Zhuoma C Zhuang L Ren D Pincuo Z Chan Y  Angiotensin-converting enzyme gene polymorphism and its association with essential hypertension in a Tibetan population Hypertens Res 2002 25 481 485 12135330 10.1291/hypres.25.481 
Harrap SB Davidson HR Connor JM Soubrier F Corvol P Fraser R Foy CJ Watt GC  The angiotensin I converting enzyme gene and predisposition to high blood pressure Hypertension 1993 21 455 460 8384602 
Staessen JA Kuznetsova T Wang JG Emelianov D Vlietinck R Fagard R  M235T angiotensinogen gene polymorphism and cardiovascular renal risk J Hypertens 1999 17 9 17 10100088 
Frossard PM Hill SH Elshahat YI Obineche EN Bokhari AM Lestringant GG John A Abdulle AM  Associations of angiotensinogen gene mutations with hypertension and myocardial infarction in a gulf population Clin Genet 1998 54 285 293 9831339 10.1034/j.1399-0004.1998.5440405.x 
Wolz M Cutler J Roccella EJ Rohde F Thom T Burt V  Statement from the National High Blood Pressure Education Program: prevalence of hypertension Am J Hypertens 2000 13 103 104 10678279 10.1016/S0895-7061(99)00241-1 
Schachter F Faure-Delanef L Guenot F Rouger H Froguel P Lesueur-Ginot L Cohen D  Genetic associations with human longevity at the APOE and ACE loci Nat Genet 1994 6 29 32 8136829 10.1038/ng0194-29 
Schunkert H Hense HW Gimenez-Roqueplo AP Stieber J Keil U Riegger GA Jeunemaitre X  The angiotensinogen T235 variant and the use of antihypertensive drugs in a population-based cohort Hypertension 1997 29 628 633 9040449 
Beige J Zilch O Hohenbleicher H Ringel J Kunz R Distler A Sharma AM  Genetic variants of the renin-angiotensin system and ambulatory blood pressure in essential hypertension J Hypertens 1997 15 503 508 9170002 10.1097/00004872-199715050-00005 
Gharavi AG Lipkowitz ML Diamond JA Chamie R Phillips RA  Ambulatory blood pressure monitoring for detecting the relation between angiotensinogen gene polymorphism and hypertension Am J Hypertens 1997 10 687 691 9194517 10.1016/S0895-7061(97)00097-6 
Tiago AD Badenhorst D Nkeh B Candy GP Brooksbank R Sareli P Libhaber E Samani NJ Woodiwiss AJ Norton GR  Impact of renin-angiotensin-aldosterone system gene variants on the severity of hypertension in patients with newly diagnosed hypertension Am J Hypertens 2003 16 1006 1010 14643573 10.1016/j.amjhyper.2003.07.010 
Nolan CR  Schrier RW  The patient with hypertension Manual of Nephrology 2000 5th Philadelphia, Lippincott Williams & Wilkins 231 264 
Zdrojewski T Szpakowski P Bandosz P Pajak A Wiecek A Krupa-Wojciechowska B Wyrzykowski B  Arterial hypertension in Poland in 2002 J Hum Hypertens 2004 
Kearney PM Whelton M Reynolds K Whelton PK He J  Worldwide prevalence of hypertension: a systematic review J Hypertens 2004 22 11 19 15106785 10.1097/00004872-200401000-00003 
Sharma AM Wittchen HU Kirch W Pittrow D Ritz E Goke B Lehnert H Tschope D Krause P Hofler M Pfister H Bramlage P Unger T  High prevalence and poor control of hypertension in primary care: cross-sectional study J Hypertens 2004 22 479 486 15076152 10.1097/00004872-200403000-00009 
Wittchen HU Krause P Hofler M Pfister H Kupper B Pittrow D Bramlage P Unger T Sharma AM Ritz E Goke B Lehnert H Tschope D Kirch W  [Aim, design and methods of the "Hypertension and diabetes screening and awareness" -- (HYDRA) study] Fortschr Med Orig 2003 121 Suppl 1 2 11 14732944 
Rywik SL Piotrowski W Rywik TM Broda G Szczesniewska D  Is the decrease of cardiovascular mortality in Poland associated with the reduction of global cardiovascular risk related to changes in life style? Kardiol Pol 2003 58 344 55; discussion: 355 14523482 
Gumprecht J Zychma MJ Moczulski DK Gosek K Grzeszczak W  Family history of end-stage renal disease among hemodialyzed patients in Poland J Nephrol 2003 16 511 515 14696752 
Reich DE Goldstein DB  Detecting association in a case-control study while correcting for population stratification Genet Epidemiol 2001 20 4 16 11119293 10.1002/1098-2272(200101)20:1<4::AID-GEPI2>3.0.CO;2-T 
Ardlie KG Lunetta KL Seielstad M  Testing for population subdivision and association in four case-control studies Am J Hum Genet 2002 71 304 311 12096349 10.1086/341719 
Bloche MG  Race-based therapeutics N Engl J Med 2004 351 2035 2037 15533852 10.1056/NEJMp048271

