
==== Front
BMC Plant BiolBMC Plant Biology1471-2229BioMed Central London 1471-2229-4-181555016810.1186/1471-2229-4-18Research ArticleMolecular cloning and functional expression of geranylgeranyl pyrophosphate synthase from Coleus forskohlii Briq Engprasert Surang 1engprasert@yahoo.comTaura Futoshi 1tauraf@shoyaku.phar.kyushu-u.ac.jpKawamukai Makoto 2kawamuka@life.shimane-u.ac.jpShoyama Yukihiro 1shoyama@shoyaku.phar.kyushu-u.ac.jp1 Graduate School of Pharmaceutical Science, Kyushu University, 3-1-1 Maidashi, Higashi-ku, Fukuoka 812-8582, Japan2 Department of Applied Bioscience and Biotechnology, Faculty of Life and Environment Science, Shimane University, Matsue 690-8504, Japan2004 18 11 2004 4 18 18 20 8 2004 18 11 2004 Copyright © 2004 Engprasert et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
Isopentenyl diphosphate (IPP), a common biosynthetic precursor to the labdane diterpene forskolin, has been biosynthesised via a non-mevalonate pathway. Geranylgeranyl diphosphate (GGPP) synthase is an important branch point enzyme in terpenoid biosynthesis. Therefore, GGPP synthase is thought to be a key enzyme in biosynthesis of forskolin. Herein we report the first confirmation of the GGPP synthase gene in Coleus forskohlii Briq.

Results
The open reading frame for full-length GGPP synthase encodes a protein of 359 amino acids, in which 1,077 nucleotides long with calculated molecular mass of 39.3 kDa. Alignments of C. forskohlii GGPP synthase amino acid sequences revealed high homologies with other plant GGPP synthases. Several highly conserved regions, including two aspartate-rich motifs were identified. Transient expression of the N-terminal region of C. forskohlii GGPP synthase-GFP fusion protein in tobacco cells demonstrated subcellular localization in the chloroplast. Carotenoid production was observed in Escherichia coli harboring pACCAR25ΔcrtE from Erwinia uredovora and plasmid carrying C. forskohlii GGPP synthase. These results suggested that cDNA encoded functional GGPP synthase. Furthermore, C. forskohlii GGPP synthase expression was strong in leaves, decreased in stems and very little expression was observed in roots.

Conclusion
This investigation proposed that forskolin was synthesised via a non-mevalonate pathway. GGPP synthase is thought to be involved in the biosynthesis of forskolin, which is primarily synthesised in the leaves and subsequently accumulates in the stems and roots.
==== Body
Background
Forskolin, a labdane diterpene, is a major active compound isolated from tuberous roots of Coleus forskohlii Briq. (Lamiaceae) [1]. C. forskohlii has been used as an important folk medicine in India. Futher, forskolin has been found to be a potent activator of adenylate cyclase [2], leading to an increase in levels of c-AMP, which affects heart action, blood and intraocular pressure. Recently, forskolin has become commercially available as a drug for treating heart disease in Japan. Forskolin is not available by chemical synthesis due to its complicated structure. However, two groups have reported successful total synthesis of forskolin [3,4].

Isoprenoids are essential for the normal growth and development processes in all living organisms. Isopentenyl diphosphate (IPP; C5) is a common metabolic precursor of all isoprenoids. Recently, several groups have demonstrated that two distinct pathways synthesise IPP in plants. The mevalonate (MVA) pathway occurs in the cytoplasm, and an alternative mevalonate-independent (2C-methyl-D-erythritol 4-phosphate; MEP) pathway occurs in plastids [5-7].

Geranylgeranyl diphosphate (GGPP) synthase catalyses the consecutive condensation of an allylic diphosphate with three molecules of IPP to produce GGPP, an essential linear precursor for biosynthesis of diterpenes, carotenoid, retinoids and side chain of chlorophyll [8]. GGPP synthase is an important branch point prenyltransferase enzyme in terpenoid biosynthesis.

GGPP synthase genes have been cloned in a number of organisms including; Arabidopsis thaliana [9,10], Taxus canadensis [11], Helianthus annuus [12], Scoparia dulcis and Croton sublyratus [13], Sulfolobus acidocaldarius [14], Neurospora crassa [15], and mouse and human [16]. Amino acid sequence comparison has shown that GGPP synthases contain several domains of conserved amino acid residues including the first aspartate-rich motifs (FARM) and the second aspartate-rich motif (SARM) [17]. Futhermore, recent studies suggested that two amino acids at the four and five positions before FARM in the sequence, as well as an insertion in FARM of plant GGPP synthases play important roles in product length determination [13,18].

Carotenoids arise from the coupling of two molecules of GGPP. The carotenoid biosynthetic gene cluster (crt genes) of Erwinia uredovora was elucidated [19], and is currently used to investigate the function of carotenoid related genes in a heterologous system. This crt gene cluster is composed of six genes; crtB (phytoene synthase), crtE (GGPP synthase), crtI (phytoene desaturase), crtX (zeaxanthin β-glucosidase), crtY (lycopene cyclase) and crtZ (β-carotene hydroxylase). Consequently, the production of carotenoids using E. coli harbouring the crt gene cluster can be used for the determination of GGPP synthase activity.

GGPP synthase is suggested to be a key enzyme in the biosynthesis of forskolin. Herein, we report the cDNA encoding C. forskohlii GGPP synthase and its heterologous expression in E. coli.

Results and discussion
cDNA cloning and sequencing of C. forskohlii GGPP synthase gene
The open reading frame (ORF) for full-length GGPP synthase gene encodes a protein of 359 amino acids, 1,077 nucleotides long, with a calculated molecular mass of 39.3 kDa. The amino acid sequence of C. forkohlii GGPP synthase revealed high homology throughout the entire coding region of Catharanthus roseus (75%), Arabidopsis thaliana (73%), Sinapis alba (72%), Croton sublyratus (69%), Scoparia dulcis (67%) and Mentha piperita (64%) (Fig. 1). However, comparison of the amino acid sequence with that of prokaryotic GGPP synthases showed a low level of homology (30–53%). Highly conserved residues were designated as domains I-VII. Two conserved aspartate-rich motifs, DDXX(X)D, were identifed. FARM and SARM have been shown to be important in substrate binding and catalysis [20-22].

Transient expression of putative localization signal of C. forskohlii GGPP synthase in tobacco cells
Sequence alignment of plant GGPP synthases showed that the N-terminal region has a low level of homology. It is reasonable to assume that these GGPP synthases have localization signals in their N-terminal regions to target them into specific subcellular compartments. The N-terminal region of C. forskohlii GGPP synthase was predicted to be localized in chloroplasts by the ChloroP 1.1 Prediction Server. In an effort to determine the localization of C. forskohlii GGPP synthase, the sequence coding for the 80 amino acid sequence at the N-terminus of C. forskohlii GGPP synthase was fused to the N-terminus of the GFP reporter gene and transformed into BY-2 tobacco cells. The pattern of putative localization signal of C. forskohlii GGPP synthase was identical to the positive chloroplast targeting signal [35SΩ-pt-sGFP(S65T)] (Fig. 2). The N-terminal region of C. forskohlii GGPP synthase was determined to contain a chloroplast localization signal. Recently, plant GGPP synthases have been determined to be translocated into plastids, mitochondria and cytosol [9,23].

Heterologous expression and activity of C. forskohlii GGPP synthase
In order to express C. forskohlii GGPP synthase, the gene was constructed and cloned into the plasmid pBluescript II KS-. The fusion protein of GGPP synthase with lacZ had a calculated molecular mass of 41.6 kDa, was observed in the soluble fraction of E. coli carrying pGGPPS after IPTG induction (Fig. 3).

Functional activity of expressed GGPP synthase was investigated by genetic complementation with the carotenogenic crt gene cluster. Carotenoids are produced in E. coli harbouring a crt cluster gene from E. uredovora. Replacements of a crt gene with an unknown gene with the same activity, can be used to determine the function of the gene [15]. Herein, the C. forskohlii GGPP synthase gene was cloned into pBluescript II KS- vector (pGGPPS) in order to produce a lacZ fusion protein. pGGPPS was then transformed into E. coli DH10B carrying the plasmid pACCAR25ΔcrtE in which the crtE encoding GGPP synthase had been deleted. The yellow color of carotenoid was observed in the transformant, indicating that pGGPPS carried the gene substituting the function of the crtE gene (Fig. 4). Carotenoid production of the transformants was compared with that of E. coli transformant carrying plasmid pACCAR25ΔcrtE and pBAA encoding mouse GGPP synthase (positive control) [16], and with transformant carrying plasmid pACCAR25ΔcrtE and a pBluescript II KS- (pBS) vector (negative control). This result suggested that the coding region of a cDNA of C. forskohlii GGPP synthase encodes a functional GGPP synthase.

Expression of GGPP synthase gene in organs of C. forskohlii
The expression of GGPP synthase gene was investigated by RT-PCR in different organs of C. forskohlii. Total RNA extracted from the roots, stems and leaves of an eight-month-old plant were analysed. The C. forskohlii GGPP synthase gene was strongly expressed in the leaves, whereas expression was decreased in stems and barely expressed in roots (Fig. 5). Therefore, the leaves are thought to be the primary location for forskolin synthesis. We previously reported the forskolin concentration in clonally propagated plant organs of C. forskohlii [24]. Tuberous roots and the stem base were determined to contain a higher concentration of forskolin than the organs. Moreover, the stem base, parts of the epidermis and cortex, the vascular bundle, and the pith were analysed separately. The highest concentration of forskolin was identified in the vascular bundle tissue. From these data, we proposed that GGPP synthase involved in biosynthesis of forskolin, is mainly synthesised in leaves, subsequently distributed to stems and finally accumulated in stem bases and roots.

Forskolin production via non-mevalonate pathway
In an effort to investigate the forskolin biosynthesis pathway by a non-mevalonate pathway, various concentrations of fosmidomycin, the specific inhibitor of 1-deoxy-D-xylulose-5-phosphate reductoisomerase (DXR) enzyme in the non-mevalonate pathway were applied to the C. forskohlii culture and the forskolin content of roots was determined (Fig. 6). Treatment led to a decrease in forskolin, whereas 10 μM fosmidomycin had no effect on forskolin production. At higher concentrations a dose-dependent inhibitory effect was observed. At 1000 μM fosmidomycin, the forskolin content was decreased by up to fifty percent in comparison to the control tissue without inhibitor treatment. Thus, forskolin was thought to be synthesised via a non-mevalonate pathway.

A recent 13C-glucose feeding experiment using 13C-NMR analytical methodology suggested the biosynthetic pathway of forskolin via a non-mevalonate pathway [25]. In addition, the DXR gene regarding the specific enzyme in the first step of the non-mevalonate pathway was cloned from C. forskohlii [26].

Conclusions
C. forskohlii GGPP synthase was cloned and its subcellular localization was determined. The N-terminal region contained a signal which was localized in chloroplasts. Functional expression of GGPP synthase was investigated by genetic complementation with the carotenogenic crt gene cluster. Carotenoids were produced when the crtE gene was replaced with C. forskohlii GGPP synthase. GGPP synthase is thought to be involved in biosynthesis of forskolin, which is primary synthesised in the leaves, subsequently distributed to stems and finally accumulated in stem bases and roots.

Methods
Plant materials and reagents
C. forskohlii plantlets were cultured in hormone-free MS (Murashige and Skoog) medium at 25°C under a 16 hours light cycle. The light intensity was 3000 lux and the relative humidity was 60%. Shoot cuttings (10 mm in length) propagated by shoot tip culture were successively cultivated in vermiculite. BY-2 tobacco single cell suspension [27] was cultured in liquid modified LS (Leinsmaier and Skoog) medium supplemented with 0.2 mg l-1 of 2,4-D (2,4-dichlorophonoxy acetic acid) under dark conditions at 25°C on an orbital incubator. Restriction enzymes, ligase, and PCR-polymerase were purchased from Takara Shuzo Co., Ltd. (Tokyo, Japan) and Toyobo Co., Ltd. (Tokyo, Japan). Fosmidomycin (FR-3154) was purchased from Molecular Probes (Oregon, USA). Chemical reagents were purchased from Sigma Chemical Company (St. Louis, USA) and Nacalai Tesque Inc. (Tokyo, Japan)

Bacterial strains and plasmids
E. coli TOP10F' and E. coli DH10B carrying the plasmid pACCAR25ΔcrtE were used in the present investigation. The pUC119 vector was used for cDNA cloning and sequencing. The pBluescript II KS- vector was used as a GGPP synthase expression plasmid. The 35SΩ-sGFP(S65T) plasmid was used as a green fluorescent protein (GFP) reporter plasmid. The pBI121 plant vector and Agrobacterium tumefaciens LBA4404 were used for transformation of GFP and GFP-fusion genes to plant cells.

cDNA cloning and sequencing of C. forskohlii GGPP synthase gene
Total RNA was prepared from roots of the C. forskohlii culture using the acid guanidium-phenol-chloroform extraction procedure [28]. Single strand cDNA was synthesised using an oligo-dT adapter primer, M-MLV reverse transcriptase and total RNA as template. Degenerate primers were designed based on highly conserved amino acid sequences of previously cloned genes encoding plant GGPP synthases [13]. A 470 bp cDNA fragment was amplified using a nested PCR with Taq DNA polymerase and degenerate primers A, B, C and D (Table 1). The 3' end of cDNA was amplified using 3' rapid amplification of cDNA ends (RACE) with gene specific primers I and J, and adapter primer F. A 522 bp product was obtained by nested PCR. For 5' RACE, the first strand cDNA was polyadenylated at its 5' end by terminal deoxynucleotidyl transferase. The first and second PCR were performed with specific primers G and H and adapter primers E and F. A 285 bp product was obtained. The entire coding region of 1,077 bp was amplified by nested PCR using specific primers K, L, M and N designed from 5' and 3' RACE products.

All amplified cDNA fragments were purified and digested with restriction enzymes at sites introduced via the PCR primers, and cloned into the vector pUC119. After transformation to E. coli TOP10F', clones harboring inserts were sequenced using a Model 310 Genetic Analyzer (PE Biosystems) using a BigDye Terminator Cycle Sequencing Kit.

The amino acid sequence deduced from the nucleotide sequence was compared with sequence databases in the Genome Net WWW server using the FASTA program. Multiple amino acid sequence alignment was performed using the CLUSTALW Multiple Sequence Alignment in the GenomeNet CLUSTALW Server.

Construction and expression of putative localization signal of C. forskohlii GGPP synthase
A 240 bp fragment of the N-terminal region of C. forskohlii GGPP synthase was PCR-amplified using primers P and Q and the PCR product was digested and cloned into the SalI-NcoI site of the 35SΩ-sGFP(S65T) plasmid. 35SΩ-pt-sGFP(S65T) was used as the positive control for chloroplast targeting [29,30]. GFP, GGPP synthase-GFP fusion and pt-GFP fusion with CaMV35SΩ promoter and NOS3' terminator [35SΩ-sGFP (S65T), 35SΩ-GGPP synthase-sGFP (S65T) and 35SΩ-pt-sGFP (S65T), respectively] were subcloned into the HindIII-EcoRI site of the pBI121 vector and then transformed into A. tumefaciens LBA4404. The transformants were cultured at 28°C for two days in YEB liquid medium containing 25 μg/ml of kanamycin and 25 μg/ml of rifampicin. The transformants were washed twice and re-suspended in YEB medium. Agrobacterium transformants (108 cells) were applied to four ml of five-day-old BY-2 suspension culture. The culture was incubated at 28°C for two days under dark conditions. GFP and GFP fusion protein were analysed by fluorescence microscopy using Nikon Eclipse TE2000-U model. Cells were observed at a 400 × magnification.

Construction of plasmid for C. forskohlii GGPP synthase expression
The coding region of a cDNA of C. forskohlii GGPP synthase was amplified by PCR using specific primers M and O. A PCR product was digested; purified and cloned into the KpnI-SalI site of pBluescript II KS- vector, namely pGGPPS. This plasmid was transformed into E. coli XL1-Blue MRF' for over-expression. The transformants were cultured in LB liquid medium containing 50 μg/ml of ampicillin and 25 μg/ml of chloramphenicol. The culture was induced with 1 mM isopropyl-1-thio-β-D-galactoside (IPTG) and incubated for six hours at 37°C. The cells were harvested and washed with 50 mM Tris-HCl pH 8.0 by centrifugation. The pellet was re-suspended, lysozyme was added and the mixture was incubated for 30 minutes. The mixture was then sonicated for four cycles of 15 seconds at one minute intervals. The soluble fraction was obtained after centrifugation at 10,000 × g for 10 minutes. SDS-PAGE was conducted in order to detect the proteins [31].

Genetic complementation expression
The pACCAR25ΔcrtE plasmid contains the gene cluster crtB, crtI, crtX, crtY and crtZ encoding carotenoid biosynthetic enzymes with the exception of crtE (encoding GGPP synthase). The plasmid pBAA containing mouse GGPP synthase (positive control plasmid) and E. coli DH10B carrying the plasmid pACCAR25ΔcrtE was provided by Dr. M. Kawamukai, Shimane University, Japan [16]. pBluescript II KS- vector, pBS, was used as negative control. pGGPPS, pBAA and pBS were transformed into E. coli DH10B carrying the plasmid pACCAR25ΔcrtE. All transformants were plated on LB agar medium containing 50 μg/ml of ampicillin and 25 μg/ml of chloramphenicol and then incubated for two to three days at 25°C.

Reverse transcriptase-PCR (RT-PCR)
An eight-month-old C. forskohlii was analysed in twelve separate parts; leaf (L1–L4), stem (S1–S5) and root (R1–R3). The numbering is based on the maturation of organs. Total RNA was extracted from each part of plant. One microgram of total RNA was used as the template for the synthesis of the first strand cDNA (using SuperScript First-Strand Synthesis System for RT-PCR, Invitrogen). Primers M and O, the first strand cDNA and KOD-polymerase were used for the amplification of C. forskohlii GGPP synthase with the condition of denaturation, 98°C, 15 seconds; annealing, 60°C, 2 seconds and extension, 74°C, 5 seconds. The 18S rRNA fragment used as an internal control was amplified using primers R and S under the same conditions of C. forskohlii GGPP synthase amplification. The amplified PCR products were analysed by 1.0% agarose gel electrophoresis.

Analysis of forskolin production
C. forskohlii plantlets were treated with various concentrations of fosmidomycin and then investigated for forskolin content using the HPLC method as previously described [26]. Forskolin was detected by comparison with the retention time of a forskolin standard (Sigma) detected by UV absorption at 202 nm.

List of abbreviations
crt, carotenogenic gene; FARM, first aspartate-rich motif; GFP, green fluorescent protein; GGPP, geranylgeranyl diphosphate; MEP, 2C-methyl-D-erythritol 4-phosphate; MVA, mevalonate; SARM, second aspatate-rich motif

Authors' contributions
SE carried out the molecular genetic studies, participated in the sequence alignment, forskolin analysis and drafted the manuscript. TF participated in the design of the study and coordination. MK participated in genetic complementation and coordination. YS conceived the study and participated in its design and coordination. All authors read and approved the final manuscript.

Acknowledgements
35SΩ-sGFP(S65T) plasmid was generously provided by Dr. Yasuo Niwa, University of Shizuoka, Japan.

Figures and Tables
Figure 1 Amino acid sequence alignment of C. forskohlii GGPP synthase and other plant GGPP synthases. The residues boxed in black indicate the positions of at least five of the six compared sequences while the gray shading indicates similar amino acids. Dashes indicate gaps introduced for optimization of the alignment. Numbers of amino acids are indicated in the left and right margins. Asterisks show the seven domains that are highly conserved among prenyltransferases with two aspartate-rich motifs (domain II and VI). Species and accession numbers are C. forskohlii, AY515700; S. dulcis, AB034250_1; C. sublyratus, AB034249_1; C. roseus, T09966; S. alba, T10452; A. thaliana, F85434.

Figure 2 Transient expression of GFP and GFP fusion proteins in BY-2 tobacco cells. (A) GFP protein [35SΩ-sGFP (S65T)]; (B) Arabidopsis chloroplast targeting signal (pt)-GFP fusion protein [35SΩ-pt-sGFP (S65T)]; (C) putative localization signal of GGPP synthase-GFP fusion protein [35SΩ-GGPP synthase-sGFP (S65T)]

Figure 3 Expression of GGPP synthase in pBluescript II KS-vector analysed by SDS-PAGE. M = molecular mass standards are indicated in kDa; lane 1 = control (E. coli transformed with pBluescriptII KS-); lane 2 = total protein extract after 6 hours of IPTG induction; lane 3 = soluble cytoplasmic fraction of cells treated with IPTG; and lane 4 = insoluble fraction of cells treated with IPTG

Figure 4 Carotenoid production of E. coli harboring plasmid pACCAR25ΔcrtE and plasmid expressing. (1) mouse GGPP synthase, pBAA; (2) plasmid expressing C. forskohlii GGPP synthase, pGGPPS; and (3) pBluescript II KS- vector, pBS

Figure 5 Expression of GGPP synthase in roots, stems and leaves of C. forskohlii culture. Ten microliters of PCR product was loaded in each lane. The lower panel shows 18S rRNA fragment as an internal control.

Figure 6 Effect of fosmidomycin on forskolin production.

Table 1 Primers for cDNA cloning of GGPP synthase.

Primers	Sequences (5' to 3')	Designed from	
A	GGGGTACCYITTGYATHGCIGCITAYGA	conserved sequence (LCIAACE)	
B	GGGGTACCGTIGARATGATHCAYACIAT	conserved sequence (VEMIHTM)	
C	CGGGATCCTTIGTIACRTCIARDATRTC	conserved sequence (DILDVTK)	
D	CGGGATCCARRTCYTTICCIGCIGTYTT	conserved sequence (KTAGKDL)	
E	GACTCGTCTAGAGGATCCCGT	adapter primer	
F	GACTCGTCTAGAGGATCCCGT17	oligo-dT adapter primer	
G	GGGGTACCCCTTATGGTTGGTGGGCTTC	degenerated PCR product (KPTNHK)	
H	CGCCACGTTCTCGCCGTAGA	degenerated PCR product (VYGENVA)	
I	CCATATTGGGTGGCGCCGAT	degenerated PCR product (AILGGAD)	
J	GGGGTACCGATGAGGCGGTGGAGAAGCT	degenerated PCR product (DEAVEKL)	
K	ATTTGGTGTTCGACGACGAC	5'RACE	
L	GGGGTACCCATATGAGCCTCATCGCGAGTC	5'RACE	
M	GCACGCGTCGACATTGTTCCGGTAAGCAAT	3'RACE	
N	AGTGAAATGGAAATTATTCA	3'RACE	
O	GGGGTACCGATGAGCCTCATCGCGAGTCCA	5'RACE	
P	GCACGCGTCGACAACAATGAGCCTCATCGCG	N-terminal sequence (MSLIAS)	
Q	CATGCCATGGGGTTCACCCGCTCTGCCTTCT	N-terminal sequence (EKAERVN)	
R	TTCTTGGATTTATGAAAGACGAACAAC	18S rRNA	
S	AAGACCAACAATTGCAATGATCTATCC	18S rRNA
==== Refs
Bhat SV Bajqwa BS dornauer H de Scousa NJ Fehlhabar HW  Structures and stereochemistry of new labdane diterpenoids from Coleus forskohlii Briq Tetrahedron Lett 1977 18 1669 1672 10.1016/S0040-4039(01)93245-9 
Metzger H Lindner E  The positive inotropic-acting forskolin, a potent adenylatecyclase activator Drug Res 1981 31 1248 1250 
Ziegler FE Jaynes BH Saindane MT  A synthetic route to forskolin J Am Chem Soc 1987 109 8115 6 
Corey FJ Jardine PDS Rohloff JC  Total synthesis of (+/-)-forskolin J Am Chem Soc 1988 110 3672 3 
Eisenreich W Schwarz M Cartayrade A Arigoni D Zenk MH Bacher A  The deoxyxylulose phosphate pathway of terpenoid biosynthesis in plants and microorganisms Chem Biol 1998 5 R221 R233 9751645 10.1016/S1074-5521(98)90002-3 
Rohmer M Knani M Simonin P Sutter B Sahm H  Isoprenoid biosynthesis in bacteria: a novel pathway for the early steps leading to isopentenyl diphosphate Biochem J 1993 295 517 524 8240251 
Rohmer M Seemann M Horbach S Bringer-Meyer S Sahm K  Glyceraldehyde 3-phosphate and pyruvate as precursors of isoprenic units in an alternative non-mevalonate pathway for terpenoid biosynthesis J Am Chem Soc 1996 118 2564 2566 10.1021/ja9538344 
Wang K Ohnuma S  Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution Trends Biochem Sci 1999 24 445 451 10542413 10.1016/S0968-0004(99)01464-4 
Okada K Saito T Nakagawa T Kawamukai M Kamiya Y  Five geranylgeranyl diphosphate synthases expressed in different organs are localized into three subcellular compartments in Arabidopsis Plant Physiol 2000 122 1045 1056 10759500 10.1104/pp.122.4.1045 
Zhu XF Suzuki K Okada K Tanaka K Nakagawa T Kawamukai M Matsuda K  Cloning and functional expression of a novel geranylgeranyl pyrophosphate synthase gene from Arabidopsis thaliana in Escherichia coli Plant Cell Physiol 1997 38 357 361 9150607 
Hefner J Ketchum FEB Croteau R  Cloning and functional expression of a cDNA encoding geranylgeranyl diphosphate synthase from Taxus canadensis and assessment of the role of this prenyltransferase in cells induced for taxol production Arch Biochem Biophys 1998 360 62 74 9826430 10.1006/abbi.1998.0926 
Oh SK Kim IJ Shin DH Yang J Kang H Han KH  Cloning, characterization, and heterologous expression of a functional geranylgeranyl pyrophosphate synthase from sunflower (Helianthus annuus L.) J Plant Physiol 2000 157 535 542 
Sitthithaworn W Kojima N Viroonchatapan E Suh DY Iwanami N Hayashi T Noji M Saito K Niwa Y Sankawa U  Geranylgeranyl diphosphate synthase from Scoparia dulcis and Croton sublyratus. Plastid localization and conversion to a farnesyl diphosphate synthase by mutagenesis Chem Pharm Bull 2001 49 197 202 11217109 10.1248/cpb.49.197 
Ohnuma S Suzuki M Nishino T  Archaebacterial ether-linked lipid biosynthetic gene. Expression cloning, sequencing, and characterization of geranylgeranyl-diphosphate synthase J Biol Chem 1994 269 14792 14797 8182085 
Sandmann G Misawa N Wiedemann M Vittorioso P Carattoli A Morelli G Macino G  Functional identification of al-3 from Neurospora crassa as the gene for geranylgeranyl pyrophosphate synthase by complementation with crt genes, in vitro characterization of the gene product and mutant analysis J Photochem Photobiol B: Biol 1993 18 245 251 10.1016/1011-1344(93)80071-G 
Kainou T Kawamura K Tanaka K Matsuda H Kawamukai M  Identification of the GGPS1 genes encoding geranylgeranyl diphosphate synthases from mouse and human Biochim Biophys Acta 1999 1437 333 340 10101267 
Koike-Takeshita A Koyama T Obata S Ogura K  Molecular cloning and nucleotide sequences of the genes for two essential proteins constituting a novel enzyme for heptaprenyl diphosphate synthesis J Biol Chem 1995 270 18396 18400 7629164 10.1074/jbc.270.31.18396 
Ohnuma S Hirooka K Hemmi H Ishida C Ohto C Nishino T  Conversion of product specificity of archaebacterial geranylgeranyl-diphosphate synthase. Identification of essential amino acid residues for chain length determination of prenyltransferase reaction J Biol Chem 1996 271 18831 18837 8702542 10.1074/jbc.271.31.18831 
Misawa N Nakagawa M Kobayashi K Yamano S Izawa Y Nakamura K Harashima K  Elucidation of the Erwinia uredovora carotenoid biosynthetic pathway by functional analysis of gene products expressed in Escherichia coli J Bacteriol 1990 172 6704 6712 2254247 
Ashby MN Kutsunai SY Ackerman S Tzagoloff A Edwards PA  COQ2 is a candidate for the structural gene encoding para-hydroxybenzoate: polyprenyl-transferase J Biol Chem 1992 267 4128 4136 1740455 
Joly A Edward PA  Effect of site-directed mutagenesis of conserved aspartate and arginine residues upon farnesyl diphosphate synthase activity J Biol Chem 1993 268 26983 26989 8262934 
Song L Poulter CD  Yeast farnesyl-diphosphate synthase: site-directed mutagenesis of residues in highly conserved prenyltransferase domains I and II Proc Natl Acad Sci USA 1994 91 3044 3048 8159703 
Kuntz M Romer S Suire C Hugueney P Weil JH Schantz R Carmara B  Identification of a cDNA for the plastid-located geranylgeranyl pyrophosphate synthase from Capsicum annuum: correlative increase in enzyme activity and transcript level during fruit ripening Plant J 1992 2 25 34 1303794 
Yanagihara H Sakata R Shoyama Y Murakami H  Rapid analysis of small samples containing forskolin using monoclonal antibodies Planta Med 1996 62 169 172 8657754 
Asada Y Li W Terada T Yoshikawa T Sasaki K Hayashi T Shimomura K  Pharmaceutical Society of Japan  Biosynthesis of forskolin In Proceedings of the 120th Annual Meeting of the Pharmaceutical Society of Japan: Gifu, Japan 2000 3 5 29–31 March 2000 
Engprasert S Taura F Shoyama Y  Molecular cloning, expression and characterization of recombinant 1-deoxy-D-xylulose-5-phosphate reductoisomerase from Coleus forskohlii Briq Plant Science  
Natakata T Nemoto Y Hasezawa S  Tobacco BY-2 cell line as the "Hela" cell in the cell biology of higher plants Int Rev Cytol 1992 132 1 30 
Chomczynski P Sacchi N  Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction Anal Biochem 1987 162 156 159 2440339 10.1006/abio.1987.9999 
Niwa Y Hirano T Yoshimoto K Shimizu M Kobayashi H  Non-invasive quantivative detection and applications of non-toxic, S56T-type green fluorescent protein in living plants Plant J 1999 18 455 463 10406127 10.1046/j.1365-313X.1999.00464.x 
Chiu WI Niwa Y Zeng W Hirano T Kobayashi H Sheen J  Engineered GFP as a vital reporter in plants Curr Biol 1996 6 325 330 8805250 10.1016/S0960-9822(02)00483-9 
Laemmli UK  Cleavage of structural proteins during the assembly of the head of bacteriophage T4 Nature 1970 227 680 685 5432063

