
==== Front
BMC Infect DisBMC Infectious Diseases1471-2334BioMed Central London 1471-2334-4-551557163310.1186/1471-2334-4-55Technical AdvanceComparison of nested PCR and real time PCR of Herpesvirus infections of central nervous system in HIV patients Drago Lorenzo 1lorenzo.drago@unimi.itLombardi Alessandra 1microbio@unimi.itDe Vecchi Elena 1microbio@unimi.itGiuliani Giuseppe 1microbio@unimi.itBartolone Rosaria 1microbio@unimi.itGismondo Maria Rita 1mariarita.gismondo@unimi.it1 Laboratory of Clinical Microbiology, L. Sacco Teaching Hospital and Department of Clinical Sciences L. Sacco, University of Milan, Via GB Grassi74, 20157 Milan, Italy2004 30 11 2004 4 55 55 8 7 2004 30 11 2004 Copyright © 2004 Drago et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
Molecular detection of herpesviruses DNA is considered as the reference standard assay for diagnosis of central nervous system infections. In this study nested PCR and real time PCR techniques for detection of Herpes simplex virus type 1 (HSV-1), Cytomegalovirus (CMV) and Epstein-Barr virus (EBV) in cerebrospinal fluid of HIV patients were compared.

Methods
Forty-six, 85 and 145 samples previously resulted positive for HSV-1, CMV and EBV by nested PCR and 150 randomly chosen negative samples among 1181 collected in the period 1996–2003 were retrospectively reassessed in duplicate by real time PCR and nested PCR.

Results
Samples giving positive results for CMV, HSV-1 and EBV with nested PCR were positive also with real time PCR. One of the negative samples resulted positive for HSV and one for EBV. Real time PCR showed comparable sensitivity and specificity vs nested PCR.

Conclusion
Real time PCR proved to be a suitable method for diagnosis of herpesvirus infections in CNS, showing comparable sensitivity and being less time consuming than nested PCR.
==== Body
Background
Opportunistic infections as well as tumors and vascular and metabolic disorders are common in HIV-infected patients [1-3]. Generally, opportunistic viral infections are caused by a broad spectrum of different species with similar clinical patterns, especially those affecting the central nervous system (CNS), where differential diagnosis requires simultaneous screening of a wide range of different viruses [4,5]. Moreover, immunodeficiency induced by HIV infection favours reactivation of herpesviruses which could cause important diseases by themselves [6].

Although the rate of CNS complications is relatively low, if compared with the high prevalence of herpesviruses in the population, these viruses represent the most important pathogens associated with viral encephalitis and meningitis [7,8], being cytomegalovirus (CMV) the most frequently identified virus in HIV-positive patients, followed by Epstein-Barr virus (EBV) and Herpes simplex virus type 1 (HSV-1) [9]. CMV, that is often responsible of asymptomatic infections in immunocompetent host, is able to cause serious manifestations such as retinitis, pneumonia and encephalitis in presence of an alteration of immunoresponse, while the recovery of Epstein-Barr virus (EBV) in cerebrospinal fluid (CSF) seems to be a prognostic sign for the development of cerebral tumors in patients with AIDS [10,11]. HSV-1 is the most commonly detected virus in diagnostic laboratory, being cause of a variety of clinical symptoms in different anatomical sites such as skin, lips, oral cavity and, especially in immunocompromised patients, CNS [12].

One-step or nested polymerase chain reaction (PCR) has rapidly replaced immunological assays based on virus specific Ig antibodies in CSF for laboratory diagnosis of Herpesvirus infections, even if serological methods are considered an additional tool for defining clinical diagnosis.

Although nested PCR is considered the method of choice in terms of specificity [9,13,14], some additional aspects should be considered.

In the last years, introduction of real time PCR has markedly increased the ease and the speed in the virology laboratory due to the relevant technology that permits rapid temperature cycling within a close system. Considering the importance of relationship between viral load in CSF and severity and outcome of disease, an additional advantage of Real Time PCR is the capability to perform simultaneous qualitative and quantitative analysis.

Here is reported our experience gained in the diagnosis of herpesvirus infections of the CNS in HIV patients by means of nested PCR and Real Time PCR, which has been recently applied in our laboratory.

Methods
CSF samples collection
A total of 1181 CSF samples collected in the period 1996 – 2003 from HIV patients attending at Luigi Sacco Teaching Hospital of Milan (Italy) affected by acute encephalitis or meningitis or encephalopathy or other neurological syndromes were considered.

Particularly, they consisted of 684, 954 and 933 CSF samples previously tested for HSV-1, CMV and EBV, respectively, by means of nested PCR. Of these, all the positive samples and 150 negative samples randomly chosen were retested by means of nested PCR and real time PCR. Each sample was re-extracted and run in duplicate.

CSF positive and negative samples were stored at -80°C until analysis.

Clinical data of patients with positive samples were available only in the 20% of the total. These patients generally recorded meningoencephalitis signs such as central motor or sensory alterations, consciousness loss, seizures defects.

Nucleic acid extraction
Spin-column based QIAamp Mini Kit (Quiagen, Hilden, Germany) protocol extraction for CSF was used as indicated by the manufacturer.

This procedure allowed for the rapid purification of DNA from 200 μL of CSF and comprised four successive steps carried out using QIAamp Spin Columns in a standard microcentrifuge. Purified DNA was concentrated at a final volume of 20 μL.

Nested PCR
Nested PCR was carried out in a 50 μl mixture containing 40 μl of first amplification mix (outer primers, buffer, dNTP)-(Amplimedical SpA-Bioline Division-Italy), 2U/μl Taq DNA polymerase (Roche Diagnostics-Germany) and 5 μl of purified DNA. Primer pairs selecting for glycoprotein D gene of HSV-1 [15], for the late protein gp58 of CMV [16], and for Bam HI-W region of EBV [17] are shown in Table 1.

After an initial 2 min denaturation at 94°C, 35 cycles of 94°C for 30 sec, 55°C for 30 sec and 72°C for 30 sec were carried out, followed by a 5 min extension at 72°C using a thermal cycler (Gene Amp PCR System 2400-Applied Biosystem – Monza – Italy). The reaction mixture for the second amplification round was the same as for the first one, except for the "inner" primers used instead of the "outer" primers. In the second amplification round 44 μl of amplification mix and 1 μl of the first amplification round PCR product were used. The thermal cycling was repeated as for the first amplification round but using 30 cycles after the initial 2 min denaturation. Each amplification run contained a negative control, consisting of water and a positive plasmidial control.

Analysis for the PCR products was performed by means of 4 % agarose gel electrophoresis followed by visualization with ethidium bromide (0.4 μg/mL) staining and UV illumination to confirm the expected products.

Real Time PCR
For diagnostic real time PCR Taq polymerase RT PCR Kit (Amplimedical SpA-Bioline Division-Turin Italy) was used. Target regions for HSV and CMV were the same as in nested PCR, while EBNA-1 gene was amplified for EBV [9] as shown in Table 2..

The RT PCR was performed in 25 μl mixture containing 20 μl of amplification mix (buffer, dNTPs, Taq gold polymerase, Rox passive fluorocrome, primers and MGB Eclipse probe) and 5 μl of purified DNA.

The amplification program included an initial decontamination with uracile N'-glycosilase at 50°C for 2 min, followed by denaturation at 95°C for 10 min and 45 two steps of 15 sec at 95°C and 1 min at 60°C.

The RT PCR products were detected by measuring fluorescence with passive reference dye in Sequence Detection System ABI Prism 7000 (Applied Biosystem). Control threshold (Ct) values were calculated by determining the point at which the fluorescence exceeded a background limit of 0.04. Each analytical session comprised also a negative control (distilled water).

Quantification was carried out by analysing four positive plasmidial standards at 102, 103, 104 and 105 copies/reaction. The standards were obtained by cloning the target amplification product in a plasmid, which was transformed and cultured in Escherichia coli. Plasmidic DNA was purified with a commercial kit (Qiagen) and its concentration determined spectrophotometrically. Then, plasmidic DNA was serially diluted in a stabilizing buffer to the final desired concentration. Amounts of copies/mL in each sample were determined by means of a quantification software (Amplimedical), by considering an extraction recovery of 80%.

Results
Nested PCR
Of 954 CSFs previously examined for CMV by means of nested PCR, 85 samples resulted positive. Among the 684 CSFs tested for HSV-1, 46 samples were found positive, while, 145 of 933 CSFs tested resulted positive for EBV.

Reassessment of these positives and of 150 negative samples confirmed results previously obtained with the same method, with the exception of one HSV-1 positive sample, which resulted negative when retested, as shown in Table 3.

Real Time PCR
Results from real time PCR are reported in Table 3. All the samples for which nested PCR gave positive results were confirmed by Real Time-PCR for CMV, HSV-1 and EBV. Of the 150 samples resulted negative by nested PCR, 148 were negative, while 1 sample resulted positive for HSV and 1 for EBV. The positive sample giving negative result when reassessed by nested PCR was negative also by real time PCR.

Sensitivity and specificity
By considering nested PCR as gold standard [9,13], sensitivity and specificity of real time PCR are described in Table 4. Comparable sensitivity (100%) and specificity (99–100 %) were found for real time PCR in respect to nested PCR.

Discussion
Introduction of PCR into routine diagnostic has rapidly gained a pivotal role for diagnosis of a wide range of diseases, supplanting, in many cases, other methods, such as the classical serodiagnosis. This is particularly true for diagnosis of herpes virus infections in immunocompromised patients, where diminished or suppressed virus-specific antibody responses do not reflect possible reactivated herpes mediated aethiologies [18].

Real time PCR has represented a further step forward, since it allows for quantitative detection of target DNA in a single sample over a large range, remaining possible qualitative detection. Even if contradictory results have been found [19-21], quantification of DNA could represent an important issue to evaluate the severity and outcome of herpesvirus encephalitis, and it may be also used to monitor the success of antiviral therapy. This strategy has already been used for monitoring of patients at risk for CMV infections, when viral load kinetic patterns are used to identify patients who are more likely to have recurrence of CMV disease after the initiation of therapy, as well as to identify patients needing treatment [22-24]. Moreover, in these cases, use of a highly sensitive assay could be of crucial value.

In the last years several real-time PCR methods have been developed for detection of herpesviruses in different biological specimens [25-27]. Real-time PCR has been well recognized to offer several advantages over nested PCR other than allowing quantification of viral load: it reduces the risk of amplicon contamination, being a close-system, is a safer laboratory protocol by not using ethidium bromide, and it allows a notable reduction of time required for response.

In the present work, we compared a real time PCR panel for detection of herpesvirus DNA in CSF with methods employing nested PCR. Our results indicate an overall agreement between the two methods, as reported by other authors [9,27,28]. Differences between the two assays were observed for HSV-1 and EBV analysis, where one negative sample was found positive by real time PCR.

Since extraction panels and primers for HSV and CMV were uniform for the both types of assays, inhibitors present in the DNA preparations could not explain the different results obtained for these samples. Moreover, being nested PCR generally considered as the gold standard for diagnosis of herpes virus in CSF, we tried to use similar primers, chemistry and amplification conditions in order to limit differences for a better comparison of the performance of the two methods. Thus, discrepancies could be likely attributed to the different detection of amplification products, although real time PCR has been reported to be as sensitive as nested PCR [29]. This suggestion is also supported by the fact that the two patients with CSF negative for HSV-1 and EBV with nested PCR showed clinical syndromes compatible with viral encephalitis and clinically improved with antiviral treatment (data not shown). These data seem to suggest that real time PCR could be more sensitive than nested PCR. Since the limit of detection is generally calculated by using plasmidial DNA, it may be possible that, although molecular sensitivity is reported to be similar for nested PCR and real-time PCR [27,28], some differences may occur for biological specimens. The sample classified positive for HSV-1, which resulted negative when retested with both methods, was one of the oldest in our collection, dating 1996, and it might have degraded over the 7 years storage. From this point of view, development of standardized quality controls might be very helpful [30].

Conclusions
Data obtained in this study confirms the validity of real-time PCR method for detection of herpesvirus DNA in CSF specimens of HIV patients, being sensitive, rapid and quantitative. Since specific and rapid diagnosis is the main target in the case of CNS infections, real time PCR could be considered the method of choice, due to its high specificity, sensitivity and rapidity, once proper quality controls will be available.

Competing interest
The company Amplimedical SpA-Bioline Division-Italy will pay the article processing fees for the manuscript.

Authors' contributions
LD conceived of the study and participated in its design and coordination, AL carried out real time PCR, EDV participated in data analysis and drafted the manuscript, GG performed statistical analysis, RB carried out nested PCR, MRG participated in design and coordination of the study. All authors read and approved the final manuscript.

Pre-publication history
The pre-publication history for this paper can be accessed here:



Figures and Tables
Table 1 Nucleotide base sequence of primers used in nested PCR

Virus	Region		Primer (5'-3')	
HSV-1	GpD	Outer	ATCACGGTAGCCCGGCGCTGTGACA
CATACCGGAACGCACCACACAA	
		Inner	CCATATCGACCACACCGACGA
GGTAGTTGGTCGTTCGCGCTGAA	
CMV	MIEA	Outer	AAGCGGCCTCTGATAACCAAGCC
AGCACCATCCTCCTCTTCCTCTGG	
		Inner	AGTGTGGATGACCTACGGGCCATCG
GGTGACACCAGAGAATCAGAGGAGC	
EBV	BamH I – W	Outer	GAGACCGAAGTGAAGGCCCT
GGTGCCTTCTTAGGAGCTGT	
		Inner	GCCAGAGGTAAGTGGACTTTAAT
GAGGGGACCCTGAGACGGGT	
Table 2 Nucleotide base sequence of primersused for real time PCR

Virus	Region		Primer (5'-3')	
HSV-1	GpD	Forward	CATACCGGAACGCACCACACAA	
		Reverse	CCATATCGACCACACCGACGA	
CMV	MIEA	Forward	AAGCGGCCTCTGATAACCAAGCC	
		Reverse	AGCACCATCCTCCTCTTCCTCTGG	
EBV	EBNA-1	Forward	ATCAGGGCCAAGACATAGAGATG	
		Reverse	CCTTTGCAGCCAATGCAACT	
Table 3 Results from nested PCR and real-time PCR

	NESTED PCR	REAL TIME PCR	
		
	POS	NEG	POS	NEG	
CMV	85	150	85	150	
HSV-1	45	150+1a = 151	45+1b = 46	149+1a = 150	
EBV	145	150	145 +1b = 146	149	
a: sample resulted positive in previous nested PCR

b: samples resulted negative in nested PCR

Table 4 Sensitivity and specificity of nested PCR and real-time PCR

	Real-time PCR	
		
	Sensitivity (%)	Specificity (%)	
CMV	85/85 = 100%	150/150 = 100%	
HSV-1	45/45 = 100%	150/151 = 99%	
EBV	145/145 = 100%	149/150 = 99%
==== Refs
Langford TD Letendre SL Larrea GJ Masliah E  Changing patterns in the neuropathogenesis of HIV during the HAART era Brain Pathol 2003 13 195 210 12744473 
Wolff AJ O'Donnell AE  HIV-related pulmonary infections: a review of the recent literature Curr Opin Pulm Med 2003 9 210 214 12682566 10.1097/00063198-200305000-00009 
Thirlwell C Sarker D Stebbing J Bower M  Acquired immunodeficiency syndrome-related lymphoma in the era of highly active antiretroviral therapy Clin Lymphoma 2003 4 86 92 14556679 
Calvario A Bozzi A Scarasciulli M Ventola C Seccia R Stomati D Brancasi B  Herpes consensus PCR test: a useful diagnostic approach to the screening of viral diseases of the central nervous system J Clin Virol 2002 25 S71 S78 12091084 10.1016/S1386-6532(02)00036-7 
Studhal M Hagberg L Rekabdar E Bergstrom T  Herpesvirus DNA detection in cerebral spinal fluid: differences in clinical presentation between alpha-, beta-, and gamma-herpesviruses Scand J Infect Dis 2000 32 237 248 10879592 10.1080/00365540050165857 
Schacker T  The role of HSV in the transmission and progression of HIV Herpes 2001 8 46 49 11867018 
Wood MJ  Viral infections in neutropenia-current problems and chemotherapeutic control J Antimicrob Chemother 1998 41 81 93 9688454 10.1093/jac/41.suppl_4.81 
Minjolle S Arvieux C Gautier AL Jusselin I Thomas R Michelet C Colimon R  Detection of herpesvrus genomes by polymerase chain reaction in cerebrospinal fluid and clinical findings J Clin Virol 2002 25 S59 S70 12091083 10.1016/S1386-6532(02)00035-5 
Aberle SW Puchhammer-Stöckl E  Diagnosis of herpesvirus infections of the central nervous system J Clin Virol 2002 25 S79 S85 12091085 10.1016/S1386-6532(02)00037-9 
Maschke M Kastrup O Diener HC  CNS manifestations of cytomegalovirus infections: diagnosis and treatment CNS Drugs 2002 16 303 15 11994020 
Klein R Mullges W Bendszus M Woydt M Kreipe H Roggendorf W  Primary intracerebral Hodgkin's disease: report of a case with Epstein-Barr virus association and review of the literature Am J Surg Pathol 1999 23 477 481 10199479 10.1097/00000478-199904000-00014 
Whitley RJ  Fields BN, Knipe DM, Howley PM  Herpes simplex viruses In Fields virology 1996 3 Philadelphia, Raven Publishers 2297 2342 
Cinque P Vago L Marenzi R Giudici B Weber T Corradini R Ceresa D Lazzarin A Linde A  Herpes simplex virus infections of the central nervous system in human immunodeficiency virus-infected patients: clinical management by polymerase chain reaction assay of cerebrospinal fluid Clin Infect Dis 1998 27 303 309 9709880 
Sauerbrei A Wutzler P  Laboratory diagnosis of central nervous system infections caused by herpesviruses J Clin Virol 2002 25 S45 S51 12091081 10.1016/S1386-6532(02)00033-1 
Aurelius E Johansson B Sköldenberg B Forsgren M  Encephalitis in immunocompetent patients due to Herpes simplex virus type 1 or 2 as determined by two specific polymerase chain reaction and antibody assays of cerebrospinal fluid J Med Virol 1993 39 179 186 8385702 
Fenner TE Garweg J Hufert FT Boehnke M Schmitz H  Diagnosis of cytomegalovirus-induced retinitis in human immunodeficiency virus type 1-infected subjects by using the polymerase chain reaction J Clin Microbiol 1991 29 2621 2622 1663513 
Wakefield AJ Fox JD Sawyer AM Taylor JE Sweenie CH Smith M Emery VC Hudson M Tedder RS Pounder RE  Detection of Herpesvirus DNA in the large intestine of patients with ulcerative colitis and Crohn's disease using the nested polymerase chain reaction J Med Virol 1992 38 183 190 1287131 
Lo CY Ho KN Yuen KY Lui SL Li FK Chan TM Lo WK Cheng IK  Diagnosing cytomegalovirus disease in CMV seropositive renal allograft recipients: a comparison between the detection of CMV DNAemia by polymerase chain reaction and antigenemia by CMV pp65 assay Clin Transplant 1997 11 286 293 9267717 
Domingues RB Lakeman FD Mayo MS Whitley RJ  Application of competitive PCR to cerebrospinal fluid samples from patients with herpes simplex encephalitis J Clin Microbiol 1998 36 2229 2234 9665997 
Revello MG Baldanti F Sarasini A Zella D Zavattoni M Gerna G  Quantitation of herpes simplex virus DNA in cerebrospinal fluid of patients with herpes simplex encephalitis by the polymerase chain reaction Clin Diagn Virol 1997 7 183 191 9126688 10.1016/S0928-0197(97)00269-9 
Wildemann B Ehrhart K Storch-Hagenlocher B Meyding-Lamade U Steinvorth S Hacke W Haas J  Quantitation of herpes simplex virus type 1 DNA in cells of cerebrospinal fluid of patients with herpes simplex virus encephalitis Neurology 1997 48 1341 1346 9153470 
Emery VC Sabin CA Cope AV Gor D Hassan-Walker AF Griffiths PD  Application of viral-load kinetics to identify patients who develop cytomegalovirus disease after transplantation Lancet 2000 355 2032 2036 10885354 10.1016/S0140-6736(00)02350-3 
Emery VC Griffiths PD  Prediction of cytomegalovirus load and resistance patterns after antiviral chemotherapy Proc Natl Acad Sci 2000 97 8039 8044 10859361 10.1073/pnas.140123497 
Humar AD Kumar D Boivin G Caliendo AM  Cytomegalovirus (CMV) virus load kinetics to predict recurrent disease in solid-organ transplant patients with CMV disease J Infect Dis 2002 186 829 833 12198618 10.1086/342601 
Stöcher M Leb V Bozic M Kessler HH Halwachs-Bauman G Landt O Stekel H Berg J  Parallel detection of five human herpes virus DNAs by a set of real-time polymerase chain reactions in a single run J Clin Virol 2003 26 85 93 12589838 10.1016/S1386-6532(02)00042-2 
Espy MJ Uhl JR Mitchell PS Thorvilson JN Svien KA Wold AD Smith TF  Diagnosis of Herpes simplex virus infections in the clinical laboratory by LightCycler PCR J Clin Microbiol 2000 38 795 799 10655387 
O'Neill HJ Wyatt DE Coyle PV McCaughey C Mitchell F  Real-Time nested multiplex PCR for the detection of Herpes simplex virus types 1 and 2 and Varicella zoster virus J Med Virol 2003 71 557 560 14556269 10.1002/jmv.10516 
Kessler HH Mühlbauer G Rinner B Stelzl E Berger A Dörr HW Santner B Marth E Rabenau H  Detection of herpes simplex virus DNA by real-time PCR J Clin Microbiol 2000 38 2638 2642 10878056 
Weidmann M Meyer-König U Hufert FT  Rapid detection of Herpes simplex virus and Varicella-zoster virus infections by real time PCR J Clin Microbiol 2003 41 1565 1568 12682146 10.1128/JCM.41.4.1565-1568.2003 
Niesters HGM  Molecular and diagnostic clinical virology in real time Clin Microbiol Infect 2004 10 5 11 14706081 10.1111/j.1469-0691.2004.00699.x

