
==== Front
BMC CancerBMC Cancer1471-2407BioMed Central London 1471-2407-4-841556084910.1186/1471-2407-4-84Research ArticleSMAC is expressed de novo in a subset of cervical cancer tumors Espinosa Magali 1maggiec73@hotmail.comCantu David 1dcantu3@excite.comLopez Carlos M 1carlos2724mx@yahoo.com.mxDe la Garza Jaime G 1jgdelagarza@starnet.net.mxMaldonado Vilma A 1vilmaml@yahoo.comMelendez-Zajgla Jorge 1jorgezajgla@ssa.gob.mx1 Subdirección de Investigación Básica. Instituto Nacional de Cancerología. Av. San Fernando # 22. Tlalpan 14080 México, D.F. MEXICO2004 23 11 2004 4 84 84 3 8 2004 23 11 2004 Copyright © 2004 Espinosa et al; licensee BioMed Central Ltd.This is an Open Access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
Smac/Diablo is a recently identified protein that is released from mitochondria after apoptotic stimuli. It binds IAPs, allowing caspase activation and cell death. In view of its activity it might participate in carcinogenesis. In the present study, we analyzed Smac expression in a panel of cervical cancer patients.

Methods
We performed semi quantitative RT-PCR on 41 cervical tumor and 6 normal tissue samples. The study included 8 stage I cases; 16 stage II; 17 stage III; and a control group of 6 samples of normal cervical squamous epithelial tissue.

Results
Smac mRNA expression was below the detection limit in the normal cervical tissue samples. In contrast, 13 (31.7%) of the 41 cervical cancer biopsies showed detectable levels of this transcript. The samples expressing Smac were distributed equally among the stages (5 in stage I, 4 in stage II and 4 in stage III) with similar expression levels. We found no correlation between the presence of Smac mRNA and histology, menopause, WHO stage or disease status.

Conclusions
Smac is expressed de novo in a subset of cervical cancer patients, reflecting a possible heterogeneity in the pathways leading to cervical cancer. There was no correlation with any clinical variable.
==== Body
Background
Apoptosis is an evolutionarily conserved biological process that plays a fundamental role in development and tissue homeostasis in metazoans [1]. This type of cell death is executed by a family of proteases known as caspases [2]. There are two well-characterized apoptotic pathways that converge in caspase activation: the death receptor pathway and the mitochondrial pathway [3]. Inhibitors of Apoptosis Proteins (IAPs) are the most important regulators of caspases. These proteins inhibit caspase activation, thus preventing the induction of apoptosis [4]. In cells undergoing apoptosis, IAPs are inactivated by interaction with proteins containing the so-called IBM (IAP-binding motif) [4,5].

One IBM protein is the recently identified Smac/DIABLO [6,7]. Smac resides in the mitochondrial intermembrane space in healthy cells but is released into the cytosol during apoptosis, where it interacts with IAPs and disrupts their ability to bind caspases [8]. Smac is expressed ubiquitously, with high expression in adult testis, heart, liver, kidney, spleen, prostate and ovary and low expression in brain, lung, thymus, and peripheral blood leukocytes [9]. It is encoded in a nuclear gene and is post-translationally imported into the mitochondria via a targeting sequence in its amino terminus. Removal of this signal generates a mature polypeptide with the IBM at the amino terminal end [10]. Smac interacts with all mammalian IAPs examined so far: XIAP, cIAP-1, cIAP-2, survivin and ML-IAP [6,7,11,12]. The structure of the Smac-XIAP complex has been studied by X-ray crystallography [13] and high-resolution NMR [14]; it appears that the tetrapeptide AVPI is indispensable for the formation of this complex.

IAPs are highly expressed in human tumor cells [15-17], contributing to the intrinsic resistance of these cells to endogenous death receptor-induced apoptosis and consequently to chemotherapy [18]. For this reason, peptides mimicking the action of Smac have been generated and analyzed. Four publications to date have shown promising effects of these Smac peptides in vitro and in vivo; however, further studies are required prior to clinical testing [19-22].

Recently, Sekimura and colleagues found that Smac expression was significantly lower in primary lung cancers than in normal tissue [23]; patients with lower Smac mRNA levels had worse prognoses. These results indicate that Smac expression may play a role in the progression of primary lung cancer and may be useful for prognosis [23]. However, Smac expression has not been analyzed in other tumors. In view of the possible role of Smac in cervical carcinogenesis and its potential as a therapeutic target, we have investigated the expression of this apoptotic protein in cervical cancer patients.

Methods
Cell lines and tumor samples
Cervical cancer cell lines (HeLa, SiHa, CaSki and CaLo) were obtained from ATCC and cultured as monolayers in Dulbecco Modified Eagle's Medium (DMEM) containing 10% (V/V) fetal bovine serum (GIBCO, Bethesda, MD, USA) at 37°C in a humidified atmosphere of 5% (V/V) CO2.

Forty-one cervical cancer samples were obtained from the Instituto Nacional de Cancerologia of Mexico. Written consent was obtained from patients before the samples were collected. Tumors were staged according to the International Gynecology and Obstetric Federation (FIGO) system. The samples comprised 8 at stage IB, 16 at stage IIB and 17 at stage IIIB; and a control group comprising 6 samples of normal cervical squamous epithelial tissue (Table 1). The control samples were derived from hysterectomy specimens from patients with uterine myomatosis. Only samples with normal pathological reports were included.

Histology
Histopathological grading was done according to the WHO (World Health Organization) classification system (Table 1).

RNA isolation and RT-PCR
RNA extraction and RT-PCR analysis were performed as described previously [24]. Briefly, total RNA was extracted from cultured cells, tumors and non-neoplastic tissue samples with Trizol reagent (Invitrogen) following the manufacturer's protocol. RNA purity was confirmed by the 260/280 nm absorbance ratio and its integrity was established with agarose gels. Total RNA (2 μg) was reverse-transcribed in a final 20 μl reaction volume using 15 U ThermoScript reverse transcriptase, 2.5 × RT Buffer and random hexamers (ThermoScript RT-PCR, Invitrogen). The RT-PCR steps were 25°C for 10 min, 50°C for 50 min and 85°C for 5 min. Smac and GAPDH mRNA PCR reactions contained 0.25 μl Amplitaq gold polymerase (Applied Biosystems, ROCHE), 2.5 μl 10 × reaction buffer, 0.5 μl dNTP mix 10 mM, 1 μl sense primer 10 μM, 1 μl anti-sense primer 10 μM and 1 μl cDNA in 25 μl final volume. The Smac primers were: sense 5' GCGCGGATCCATGGCGGCTCTGAAGAGTTG 3' and anti-sense 5' AGCTCTCTAGACTCAGGCCCTCAATCCTCA 3'. The GAPDH primers were: sense 5' CCCCTTCATTGACCTCAACT 3' and antisense 5' TTGTCATGGATGACCTTGGC 3'.

The PCR cycle parameters for Smac were: 10 min enzyme activation at 95°C followed by 3 cycles of 30 s at 95°C and 2 min at 72°C, then 30 cycles of 30 s at 95°C and 30 s at 68°C, and finally 5 min at 72°C. The corresponding parameters for GAPDH were: 10 min enzyme activation at 95°C followed by 25 cycles of 30 s at 95°C, 30 s at 60°C and 30 s at 72°C. The products were electrophoresed on 1% agarose gels and stained with ethidium bromide. Smac mRNA data were expressed as ratios between the densitometric values (Scion Image software) of Smac gene expression. The PCR products were normalized to the amplified GAPDH, the internal reference gene. Gene expression measurements were repeated at least twice.

Statistical analysis
To detect a correlation between pathological tumor parameters and normalized Smac expression we used ANOVA (stage, current disease and menopause status) and chi square tests (stage, histology of tumors, menopause and current status). Kaplan-Meier curves for status were generated and log rank was used to test for differences. The mean follow-up was 14.7 months. The statistical package Intercooled Stata 7.0 was used for analyses and statistical significance was accepted when the p value was less than 0.05.

Results
To ascertain whether Smac is expressed in cervical cancer we performed semiquantitative RT-PCR analyses on a panel of cervical cancer lines, including HeLa, SiHa, CasKi and CaLo cells. As shown in Figure 1, the HeLa and CasKi lines contained Smac mRNA, but very low levels were observed in SiHa and CaLo cells.

Next, we measured Smac mRNA levels using the same approach in 41 cervical tumor and 6 normal cervical samples. To ensure accurate determinations and to verify equal RNA input, GAPDH mRNA was amplified simultaneously. Figure 2 shows a representative panel of results, which are given in Tables 1 and 2. Unexpectedly, Smac mRNA was below the detection limit in normal cervical samples. In contrast, as expected from the cell line data, 13 (31.7%) of the 41 cervical cancer biopsies contained detectable levels of this transcript. The samples expressing Smac were distributed equally among the stages (5 in stage I, 4 in stage II and 4 in stage III). We found no significant correlation between Smac mRNA level and histology, menopause, clinical stage or disease status (Table 2). When the Smac expression levels in the tumor samples were analyzed, there were no significant differences between clinical stages (Figure 3), menopause status (Figure 4) or disease status (Figure 5). Similarly, a survival analysis of the patients showed no statistical differences between patients expressing or not expressing Smac mRNA (Figure 6).

Discussion
Tumors proliferate beyond the constraints that limit growth in normal tissue. Therefore, the resistance of tumor cells to apoptosis is an essential feature of carcinogenesis. This has been confirmed by the finding that deregulated proliferation alone is not sufficient for tumor formation because there is concomitant induction of cell death [25]. Overexpression of growth-promoting oncogenes such as c-Myc sensitize cells to apoptosis [26]. Thus, tumor progression requires the expression of anti-apoptotic proteins or the inactivation of essential pro apoptotic proteins [27,28]. Indeed, it has been shown that survivin, a member of the Inhibitor of Apoptosis Protein (IAP) family, is upregulated in some tumors [29], correlating with prognosis [30,31].

Smac is a recently identified proapoptotic protein that interacts with and inhibits several IAPs, including survivin [6,11]. It has been shown that Smac mRNA levels in tumor tissues are significantly lower than in normal tissues [23]. Patients with lower Smac mRNA levels have worse prognoses. These results indicate that Smac expression may play a role in the progression of primary lung cancer, as expected by the known role of this protein in cell death induced by chemotherapeutic drugs. Unexpectedly, we found that during cancer progression, some cervical tumors express this protein de novo.

Unfortunately, we found no correlation between Smac expression and any clinical variable. This could be attributed to differences in tissue expression of IAPs, which are reported to have different binding affinities for Smac. On the other hand, alternative IAPs such as the recently identified Omi/Htra2 [32] might play an important tissue- or tumor-specific role. This is supported by the recent report of a null phenotype in Smac-deficient mice, in which a role for other IAP inhibitory proteins is suspected [33].

Cancer treatment by chemotherapy and γ-irradiation kills cells primarily by the induction of apoptosis. However, few tumors are wholly sensitive to these therapies, and the development of resistance to therapy is an important clinical problem. Failure to activate the apoptotic programme represents an important mode of drug resistance in tumor cells [34]. Modulation of the key elements in apoptotic signaling should directly influence therapy-induced tumor-cell death. Indeed, it has recently been suggested that peptides mimicking the Smac amino-terminus could be a novel therapeutic weapon [19]. Tumors with low or null Smac expression, such as the ones reported in this study, could be more susceptible to this approach.

Conclusions
During cervical cancer progression, a subset of tumors express the apoptotic protein Smac de novo. This finding contrasts with a previous report for lung cancer [23], underlining the notion that downregulation or even expression of Smac could be dispensable for tumor progression, at least in cervical cancer. This could be because other mitochondrial molecules such as Omi might substitute for its known proapoptotic function. There was no correlation between Smac expression and any clinical variable.

Competing interests
The author(s) declare that they have no competing interests.

Authors' contributions
JMZ Conceived and coordinated the study.

VAML: Conceived and coordinated the study. Statistical Analysis

MEC: Performed RT-PCR assays

DCL: Provided the clinical samples and coordinated patient study

CMLG: Coordinated patient assessment, ethical guidelines.

JGGS: Provided clinical assessment

Pre-publication history
The pre-publication history for this paper can be accessed here:



Acknowledgements
This work was supported by grants CONACYT-2002-C01-42040/A-1 and SALUD-2002-C01-6579 from Consejo Nacional de Ciencia y Tecnolología, México.

Figures and Tables
Figure 1 Smac/Diablo mRNA expression in cervical cancer cell lines. Upper panel: RT-PCR analysis of HeLa, SiHa, CasKi and CaLo cervical cancer cell lines. To the left molecular weight marker (100 bp ladder, Invitrogen). Lower panel: RT-PCR of GAPDH, used as a mRNA load control.

Figure 2 Smac/Diablo mRNA expression in cervical cancer patients. Upper panel: RT-PCR analysis of Smac/Diablo mRNA. To the left molecular weight marker (100 bp ladder, Invitrogen). Clinical stage is showed at the top of the panel: C: control samples, 1, 2 and 3, clinical stages. Lower panel: RT-PCR of GAPDH, used as a load control.

Figure 3 Smac expression levels versus clinical stage of cervical cancer samples. Graph shows median, upper and lower quartiles. P value testing the significance of the difference by ANOVA.

Figure 4 Smac expression levels versus menopausal status of cervical cancer samples. Graph shows median, upper and lower quartiles. P value testing the significance of the difference by ANOVA.

Figure 5 Smac expression versus disease status of cervical cancer samples. Graph shows median, upper and lower quartiles. P value testing the significance of the difference by ANOVA.

Figure 6 Kaplan/Meier survival analysis of cases by Smac expression. Continue black line: Negative expression. Dotted line: Positive expression. Insert in the lower left corner of plot is the P value testing the significance of the difference in the survival curves by the Mantel/Cox log rank test

Table 1 Smac mRNA expression levels and clinicopathological factors in cervical cancer


                              Sample
                           	
                              Age
                           	
                              Stage
                           	
                              Histology of tumor
                           	
                              Menopause
                           	
                              Current status
                           	Smac/GAPDH	
Control	42		-	Menopause	Disease-free	0	
Control	33		-	Pre-menopause	Disease-free	0	
Control	28		-	Pre-menopause	Disease-free	0	
Control	44		-	Menopause	Disease-free	0	
Control	47		-	Menopause	Disease-free	0	
Control	35		-	Pre-menopause	Disease-free	0	
1	46	I	Adenocarcinome	Menopause	Disease-free	0	
2	52	I	Squamous cell	Post-menopause	Disease-free	76.01	
3	49	I	Squamous cell	Menopause	Disease	203.36	
4	44	I	Squamous cell	Pre-menopause	Disease-free	0	
5	65	I	Squamous cell	Post-menopause	Disease-free	0	
6	67	I	Squamous cell	Post-menopause	Disease-free	86.53	
7	47	I	Squamous cell	Menopause	Disease-free	65.3	
8	34	I	Squamous cell	Pre-menopause	Disease-free	66.45	
9	49	II	Squamous cell	Menopause	Disease-free	78.44	
10	63	II	Squamous cell	Post-menopause	Disease-free	0	
11	38	II	Squamous cell	Menopause	Disease-free	0	
12	48	II	Squamous cell	Menopause	Disease-free	0	
13	55	II	Squamous cell	Post-menopause	Disease-free	0	
14	35	II	Squamous cell	Pre-menopause	Disease-free	166.25	
15	66	II	Squamous cell	Post-menopause	Disease	0	
16	52	II	Squamous cell	Post-menopause	Disease	0	
17	80	II	Squamous cell	Post-menopause	Disease	0	
18	70	II	Squamous cell	Post-menopause	Disease-free	0	
19	65	II	Squamous cell	Post-menopause	Disease	0	
20	39	II	Squamous cell	Pre-menopause	Disease	70.42	
21	57	II	Squamous cell	Post-menopause	Disease-free	55.45	
22	37	II	Squamous cell	Pre-menopause	Disease-free	0	
23	59	II	Squamous cell	Post-menopause	Disease	0	
24	36	II	Squamous cell	Pre-menopause	Disease	0	
25	33	III	Adenocarcinome	Pre-menopause	Dead	0	
26	50	III	Adenocarcinome	Post-menopause	Dead	0	
27	60	III	Squamous cell	Post-menopause	Disease-free	0	
28	64	III	Adenocarcinome	Post-menopause	Dead	0	
29	80	III	Squamous cell	Post-menopause	Dead	0	
30	52	III	Squamous cell	Post-menopause	Disease-free	173.96	
31	56	III	Squamous cell	Post-menopause	Disease-free	0	
32	70	III	Squamous cell	Post-menopause	Disease-free	81.5	
33	72	III	Adenosquamous	Post-menopause	Dead	0	
34	33	III	Squamous cell	Pre-menopause	Disease	0	
35	82	III	Adenocarcinome	Post-menopause	Disease	0	
36	48	III	Squamous cell	Menopause	Disease-free	0	
37	32	III	Squamous cell	Pre-menopause	Disease	98.59	
38	48	III	Squamous cell	Menopause	Disease	0	
39	36	III	Adenosquamous	Pre-menopause	Disease	0	
40	52	III	Squamous cell	Post-menopause	Disease-free	0	
41	67	III	Squamous cell	Post-menopause	Disease-free	88.95	
Table 2 Smac positivity in cervical cancer tumor samples.

Variable	No. Patients (n = 41)	Smac Positive (n = 13)	Smac Negative (n = 28)	
                           P
                        	
Age	53.36 (32–82)	50	54.92	0.3	
Stage	
IB	8	5	3		
IIB	16	4	12	0.11	
IIIB	17	4	13		
Histology of tumors	
Squamous cell	34	13	21		
Adenocarcinoma	5	0	5	0.14	
Adenosquamous	2	0	2		
Menopausal status	
Pre-Menopause	12	5	7		
Menopause	6	2	4	0.64	
Post-Menopause	23	6	17		
Current status	
Disease free	21	9	12		
Diseased	15	4	11	0.15	
Dead	5	0	5
==== Refs
Uren AG Coulson EJ Vaux DL  Conservation of baculovirus inhibitor of apoptosis repeat proteins (BIRPs) in viruses, nematodes, vertebrates and yeasts Trends Biochem Sci 1998 23 159 162 9612077 10.1016/S0968-0004(98)01198-0 
Budihardjo I Oliver H Lutter M Luo X Wang X  Biochemical pathways of caspase activation during apoptosis Annu Rev Cell Dev Biol 1999 15 269 290 10611963 10.1146/annurev.cellbio.15.1.269 
Shi Y  Mechanisms of caspase activation and inhibition during apoptosis Mol Cell 2002 9 459 470 11931755 10.1016/S1097-2765(02)00482-3 
Deveraux QL Reed JC  IAP family proteins--suppressors of apoptosis Genes Dev 1999 13 239 252 9990849 
Shi Y  A conserved tetrapeptide motif: potentiating apoptosis through IAP-binding Cell Death Differ 2002 9 93 95 11840157 10.1038/sj/cdd/4400957 
Du C Fang M Li Y Li L Wang X  Smac, a mitochondrial protein that promotes cytochrome c-dependent caspase activation by eliminating IAP inhibition Cell 2000 102 33 42 10929711 10.1016/S0092-8674(00)00008-8 
Verhagen AM Ekert PG Pakusch M Silke J Connolly LM Reid GE Moritz RL Simpson RJ Vaux DL  Identification of DIABLO, a mammalian protein that promotes apoptosis by binding to and antagonizing IAP proteins Cell 2000 102 43 53 10929712 10.1016/S0092-8674(00)00009-X 
Srinivasula SM Datta P Fan XJ Fernandes-Alnemri T Huang Z Alnemri ES  Molecular determinants of the caspase-promoting activity of Smac/DIABLO and its role in the death receptor pathway J Biol Chem 2000 275 36152 36157 10950947 10.1074/jbc.C000533200 
Tikoo A O'Reilly L Day CL Verhagen AM Pakusch M Vaux DL  Tissue distribution of Diablo/Smac revealed by monoclonal antibodies Cell Death Differ 2002 9 710 716 12058276 10.1038/sj.cdd.4401031.sgm 
Chai J Du C Wu JW Kyin S Wang X Shi Y  Structural and biochemical basis of apoptotic activation by Smac/DIABLO Nature 2000 406 855 862 10972280 10.1038/35022514 
Song Z Yao X Wu M  Direct interaction between survivin and Smac/DIABLO is essential for the anti-apoptotic activity of survivin during taxol-induced apoptosis J Biol Chem 2003 278 23130 23140 12660240 10.1074/jbc.M300957200 
Vucic D Deshayes K Ackerly H Pisabarro MT Kadkhodayan S Fairbrother WJ Dixit VM  SMAC negatively regulates the anti-apoptotic activity of melanoma inhibitor of apoptosis (ML-IAP) J Biol Chem 2002 277 12275 12279 11801603 10.1074/jbc.M112045200 
Wu G Chai J Suber TL Wu JW Du C Wang X Shi Y  Structural basis of IAP recognition by Smac/DIABLO Nature 2000 408 1008 1012 11140638 10.1038/35050012 
Liu Z Sun C Olejniczak ET Meadows RP Betz SF Oost T Herrmann J Wu JC Fesik SW  Structural basis for binding of Smac/DIABLO to the XIAP BIR3 domain Nature 2000 408 1004 1008 11140637 10.1038/35050006 
Yang L Cao Z Yan H Wood WC  Coexistence of high levels of apoptotic signaling and inhibitor of apoptosis proteins in human tumor cells: implication for cancer specific therapy Cancer Res 2003 63 6815 6824 14583479 
Tanaka K Iwamoto S Gon G Nohara T Iwamoto M Tanigawa N  Expression of survivin and its relationship to loss of apoptosis in breast carcinomas Clin Cancer Res 2000 6 127 134 10656440 
Ferreira CG van der Valk P Span SW Jonker JM Postmus PE Kruyt FA Giaccone G  Assessment of IAP (inhibitor of apoptosis) proteins as predictors of response to chemotherapy in advanced non-small-cell lung cancer patients Ann Oncol 2001 12 799 805 11484955 10.1023/A:1011167113067 
Hong X Lei L Glas R  Tumors acquire inhibitor of apoptosis protein (IAP)-mediated apoptosis resistance through altered specificity of cytosolic proteolysis J Exp Med 2003 197 1731 1743 12810691 10.1084/jem.20020801 
Arnt CR Chiorean MV Heldebrant MP Gores GJ Kaufmann SH  Synthetic Smac/DIABLO peptides enhance the effects of chemotherapeutic agents by binding XIAP and cIAP1 in situ J Biol Chem 2002 277 44236 44243 12218061 10.1074/jbc.M207578200 
Guo F Nimmanapalli R Paranawithana S Wittman S Griffin D Bali P O'Bryan E Fumero C Wang HG Bhalla K  Ectopic overexpression of second mitochondria-derived activator of caspases (Smac/DIABLO) or cotreatment with N-terminus of Smac/DIABLO peptide potentiates epothilone B derivative-(BMS 247550) and Apo-2L/TRAIL-induced apoptosis Blood 2002 99 3419 3426 11964312 10.1182/blood.V99.9.3419 
Yang L Mashima T Sato S Mochizuki M Sakamoto H Yamori T Oh-Hara T Tsuruo T  Predominant suppression of apoptosome by inhibitor of apoptosis protein in non-small cell lung cancer H460 cells: therapeutic effect of a novel polyarginine-conjugated Smac peptide Cancer Res 2003 63 831 837 12591734 
Tamm I Trepel M Cardo-Vila M Sun Y Welsh K Cabezas E Swatterthwait A Arap W Reed JC Pasqualini R  Peptides targeting caspase inhibitors J Biol Chem 2003 278 14401 14405 12538646 10.1074/jbc.M210133200 
Sekimura A Konishi A Mizuno K Kobayashi Y Sasaki H Yano M Fukai I Fujii Y  Expression of Smac/DIABLO is a novel prognostic marker in lung cancer Oncol Rep 2004 11 797 802 15010875 
Bandala E Espinosa M Maldonado V Melendez-Zajgla J  Inhibitor of apoptosis-1 (IAP-1) expression and apoptosis in non-small-cell lung cancer cells exposed to gemcitabine Biochem Pharmacol 2001 62 13 19 11377392 10.1016/S0006-2952(01)00632-3 
Evan GI Vousden KH  Proliferation, cell cycle and apoptosis in cancer Nature 2001 411 342 348 11357141 10.1038/35077213 
Evan GI Wyllie AH Gilbert CS Littlewood TD Land H Brooks M Waters CM Penn LZ Hancock DC  Induction of apoptosis in fibroblasts by c-myc protein Cell 1992 69 119 128 1555236 10.1016/0092-8674(92)90123-T 
Stambolic V Mak TW Woodgett JR  Modulation of cellular apoptotic potential: contributions to oncogenesis Oncogene 1999 18 6094 6103 10557100 10.1038/sj.onc.1203126 
Ambrosini G Adida C Altieri DC  A novel anti-apoptosis gene, survivin, expressed in cancer and lymphoma Nat Med 1997 3 917 921 9256286 10.1038/nm0897-917 
Reed JC  The Survivin saga goes in vivo J Clin Invest 2001 108 965 969 11581297 
Adida C Haioun C Gaulard P Lepage E Morel P Briere J Dombret H Reyes F Diebold J Gisselbrecht C Salles G Altieri DC Molina TJ  Prognostic significance of survivin expression in diffuse large B-cell lymphomas Blood 2000 96 1921 1925 10961895 
Adida C Recher C Raffoux E Daniel MT Taksin AL Rousselot P Sigaux F Degos L Altieri DC Dombret H  Expression and prognostic significance of survivin in de novo acute myeloid leukaemia Br J Haematol 2000 111 196 203 11091201 10.1046/j.1365-2141.2000.02328.x 
Hegde R Srinivasula SM Zhang Z Wassell R Mukattash R Cilenti L DuBois G Lazebnik Y Zervos AS Fernandes-Alnemri T Alnemri ES  Identification of Omi/HtrA2 as a mitochondrial apoptotic serine protease that disrupts inhibitor of apoptosis protein-caspase interaction J Biol Chem 2002 277 432 438 11606597 10.1074/jbc.M109721200 
Okada H Suh WK Jin J Woo M Du C Elia A Duncan GS Wakeham A Itie A Lowe SW Wang X Mak TW  Generation and characterization of Smac/DIABLO-deficient mice Mol Cell Biol 2002 22 3509 3517 11971981 10.1128/MCB.22.10.3509-3517.2002 
Kim R Tanabe K Uchida Y Emi M Inoue H Toge T  Current status of the molecular mechanisms of anticancer drug-induced apoptosis. The contribution of molecular-level analysis to cancer chemotherapy Cancer Chemother Pharmacol 2002 50 343 352 12439591 10.1007/s00280-002-0522-7

