
==== Front
BMC Blood DisordBMC Blood Disorders1471-2326BioMed Central London 1471-2326-4-41549150210.1186/1471-2326-4-4Case ReportEffect of splenectomy on type-1/type-2 cytokine gene expression in a patient with adult idiopathic thrombocytopenic purpura (ITP) Panitsas Fotios P 1fpanits@panafonet.grMouzaki Athanasia 1mouzaki@med.upatras.gr1 Hematology & Transfusion Medicine, Medical School, University of Patras, Patras, Greece2004 18 10 2004 4 4 4 23 6 2004 18 10 2004 Copyright © 2004 Panitsas and Mouzaki; licensee BioMed Central Ltd.2004Panitsas and Mouzaki; licensee BioMed Central Ltd.This is an open-access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
In view of clinical observations and laboratory results that support a central role of the spleen in idiopathic thrombocytopenic purpura (ITP) pathophysiology, we studied the effect of splenectomy on type-1 and type-2 cytokine gene expression in an adult ITP case, refractory to conservative treatment.

Case presentation
The patient was subjected to splenectomy 9 months after the diagnosis with complete response, attaining platelet counts over 150 × 106/L within 10 days after the operation. Two consecutive blood samples were obtained from the patient, 3 and 7 months after the splenectomy for the purposes of this study. A control group consisted of 11 healthy adults. Peripheral blood mononuclear cells were prepared from each blood sample and cultured in vitro for 8 h with the addition of the mitogens phorbol myristate acetate and ionomycin. Total cellular RNA extracted from 106 cells was submitted to semiquantitave reverse transcriptase-polymerase chain reaction (RT-PCR) for the amplification of IL-2, IFN-γ, IL-4, IL-5, and IL-10 metagraphs. The PCR products were run on ethidium-stained agarose gels, photographed and quantified by densitometry.

A steep decrease of type-1 cytokine expression (IL-2, IFN-γ) and their calculated sum expressing Th1 activity was observed at 7 months post-splenectomy compared to 3 months post-splenectomy, in parallel with a rise of platelet count from 190 × 106/L to 265 × 106/L. The change of type-2 cytokine expression (IL-4, IL-5, IL-10) was slight and the Th2 activity (IL-4+IL-5) remained largely unchanged. The Th1/Th2 ratio, that reflects the pathogenic disease-specific T-cell immune deviation, was accordingly reduced 7 months post-splenectomy (Th1/Th2 = 1.3) compared to 3 months (Th1/Th2 = 3.5).

Conclusions
The reduction of the Th1/Th2 cytokine ratio that was observed over time after splenectomy was accompanied by full clinical remission. Nevertheless, the persistence of a type-1 polarization, even after several months following spleen removal, is suggestive of a more basic abnormality of the immune function in these patients.
==== Body
Background
Adult autoimmune thrombocytopenic purpura (ITP) is a chronic acquired organ-specific autoimmune thrombocytopenic syndrome [1]. The low peripheral platelet concentration observed in ITP is the result of reduced platelet life span because of their early removal from the peripheral blood by the activated reticuloendothelial system of the spleen, liver or bone marrow, after their sensitization by autoantibodies that recognize their surface glycoprotein antigens [2]. Apart from phagocytosis, destruction mechanisms include complement activation [3] and direct cellular attack by T lymphocytes [4]. Ineffective thrombocytopoiesis because of autoimmune attack of megakaryocytes in the bone marrow contributes to the thrombocytopenia with varying degrees among cases [2]. The production of platelet autoantibodies by B-cells is driven by activated platelet-specific autoreactive T-cells [5]. The phenotype of the disease-specific T helper cells has been shown to be skewed towards type 1 cytokine production [6-8].

The spleen is considered to be the primary site of the autoimmune response where initiation, maintenance and regulation of the autoimmune attack take place. The spleen is the site of autoreactive T- and B-cell interaction and activation, and autoreactive anti-platelet antibody production [9]. Platelet destruction is also sited mainly in the spleen in most patients [2,10,11].

Splenectomy is followed by reduction of autoantibody peripheral blood titre [12,13]. Spleen cells isolated from ITP patients produce antiplatelet immunoglobulin in in vitro cultures [14]. The percentage of T- and B-cells with activated phenotype is far greater in the spleen than in the peripheral blood of ITP patients [9]. The number of circulating autoreactive anti-platelet T- and B-cells declines after splenectomy that leads to clinical remission, whereas the peripheral blood concentration of CD3+CD4+, CD3+CD8+, CD3+HLADR+, and CD3+CD25+ cells increases significantly in ITP patients refractory to splenectomy [15]. Changes in the histology of the spleen have been observed in ITP patients and include follicular hyperplasia, foam macrophages, and extramedullary hematopoiesis, among others [16].

Splenectomy is the most clinically effective therapeutic intervention in ITP patients, resulting in complete remission in two thirds of the patients with more than 60% maintaining the therapeutic effect in the long term [17,18]. Irrespective of clinical response, splenectomy seems to affect the natural history of the disease and to enhance the response of ITP patients to other treatments that follow [19].

Given the important immunoregulatory role of the spleen, we looked at the effects of splenectomy on immune activation and immune deviation indices in the peripheral blood of an ITP patient after splenectomy in association with peripheral platelet counts.

Case presentation
A 42 year old woman presented in October 1999 in Patras University Hospital (PUH) with lower limb purpura and low platelet count (7 × 106/L). Following clinical exclusion of causes of secondary thrombocytopenia [20] the diagnosis of ITP was reached.

The patient initially received glucocorticoid treatment to which she showed a temporary response until 6 months later when she relapsed. She was subsequently started on danazol without any clinical benefit. Intravenous immune globulin administration also proved ineffective after two 5-day cycles. As a result, the patient was subjected to splenectomy 9 months after the diagnosis with complete response, attaining platelet counts over 150 × 106/L within 10 days after the operation. Five years later, she remains in clinical remission.

Two consecutive blood samples were obtained from the patient, 3 and 7 months after splenectomy for the purposes of this study. A control group consisted of 11 adult healthy volunteers (6 women and 5 men, median age 40 years, range 18–65 years). Informed consent was obtained from the patient. PUH abides by the Helsinki declaration on ethical principles for medical research involving human subjects.

Peripheral blood mononuclear cells (PBMC) were prepared from each blood sample by centrifugation over a Ficoll-Paque gradient (Pharmacia, Sweden). The cells were cultured in vitro for 8 h with the addition of 20 ng/ml phorbol myristate acetate (PMA) and 1 μM ionomycin (Sigma, St-Louis, MI).

Total cellular RNA extracted from 106 cells was submitted to semiquantitative RT-PCR for the amplification of IL-2, IFN-γ, IL-4, IL-5, and IL-10 metagraphs [8]. Primers and conditions for the RT-PCR are summarized in Table 1. The PCR products were run on ethidium-stained agarose gels, photographed and quantified [8].

Table 1 Primers and conditions for the RT-PCR experiments performed in this study.

Gene	Sequence (5'→3')	T (°C)	Product (bp)	
IL-2	GCAACTCCTGTCTTGCATTG
AATGTGAGCATCCTGGTGAG	59	173	
IFN-γ	AGCTCTGCATCGTTTTGGGTTC
CAAATATTGCAGGCAGGACAACC	64	492	
IL-4	CTGTGCTCCGGCAGTTCTAC
ACGTACTCTGGTTGGCTTCC	58	176	
IL-5	GCTTCTGCATTTGAGTTTGCTAGCT
TGGCCGTCAATGTATTTCTTTATTAAG	59	291	
IL-10	ACCCAGTCTGAGAACAGCTGC
GTTCACATGCGCCTTGATGTCT	61	260	
β2m	CCCCCACTGAAAAAGATGAG
TCACTCAATCCAAATGCGGC	56	150	
A sharp decrease in the expression of the type-1 cytokines IL-2 and IFN-γ and their calculated sum expressing Th1 activity was observed at 7 months after splenectomy compared to 3 months after splenectomy (Figure 1); this was accompanied by a parallel rise of platelet count from 190 × 106/L to 265 × 106/L. Regarding type-2 cytokine gene expression, IL-4 increased, IL-5 decreased, and IL-10 remained unchanged, whereas the change in Th2 activity (IL-4 units plus IL-5 units) was slight (Figure 1). The Th1/Th2 ratio {(IL-2+IFNγ)/(IL-4+IL-5)}, that reflects immune deviation, was accordingly greatly reduced 7 months post-splenectomy (Th1/Th2 = 1.3) compared to 3 months (Th1/Th2 = 3.5) (Figure 2). Mean Th1/Th2 ratio of the controls was 0.5 with 95% confidence intervals of the mean (0.15–0.85). The Th1/Th2 values at 3 months and at 7 months post-splenectomy lie at 6.25 and 1.6 standard deviations above the mean of the controls, respectively.

Figure 1 Gene expression levels of individual cytokines and of calculated Th1 and Th2 activities at 3 and 7 months after splenectomy. Th1 equals with IL-2 units plus IFN-γ units and Th2 equals with IL-4 units plus IL-5 units.

Figure 2 Th1 activity (IL-2+IFNγ) versus Th2 activity (IL-4+IL-5) scatter gram. Asterisks denote the patient's case values at 3 and at 7 months after splenectomy. Diamonds denote the control values. Solid line is the regression line for the controls (r2 = 0.55, p = 0.014) and the two broken lines show the 95% confidence intervals.

The above results show that in this patient type-1 polarization persists after removal of the spleen and attainment of clinical remission. This may mean that the spleen is not exclusively responsible for the coordination or the maintenance of the pathological immune response in this patient, provided that no accessory splenic tissue exists. Other disease centres may control the autoimmune reaction as well, such as the liver or the bone marrow. Alternatively, it is possible that ITP is the manifestation of a general immune system malfunction that pre-existed before the development of thrombocytopenia and persists after removal of what seems to be the effector of a manifestation of an autoimmune proclivity.

Unfortunately, a pre-splenectomy sample was not available for analysis. As a result, no conclusions can be drawn about the effect of splenectomy on the direction of change of Th1 activity. Based on phenotypic studies showing increased presence of T lymphocytes with activated phenotype after splenectomy in ITP patients [15], it is plausible that peripheral Th1 activity may have increased after splenectomy.

The clinical remission may be due to the removal of a major platelet destruction site, although the underlying immune activity that drives the destruction may remain unaffected. Complete remission does not mean that increased platelet destruction has stopped after splenectomy. Platelet life span may still be shortened in this patient and/or her normal platelet count may be even higher than what was achieved after splenectomy.

The pathological immune activity seems to decrease over time after splenectomy, as reflected by the lower Th1/Th2 ratio that is indicative of the degree of immune polarization. This may be explained by reduced stimulation of the immune system by activated spleen reticuloendothelial cells that present platelet antigens to T helper lymphocytes. In this way, it may be hypothesized that removal of one vital component of the self-attacking immune process can break the vicious circle that culminates in even greater immune activation, polarization, and platelet destruction. Removal of a major site of autoimmune activity may have abrogated recruitment of naïve T-cells. As a result, overall autoimmune activity wears off, as existing activated Th1 effector cells perish leaving behind a much smaller population of peripheral memory cells that retain the initial Th phenotype.

Another consideration that stems from the results of this case study is that immune polarization and immune deviation of the pathological response depend more on upregulation of type-1 mediators rather than on suppression of type-2 cytokines, or that type-2 response is inadequate to control excess type-1 response in active disease.

Conclusions
Clinical improvement after splenectomy is associated with reduced but not normalized immune activation and polarization in the patient studied. However, the spleen seems not to be absolutely necessary for the maintenance of the autoimmune reactivity.

Competing interests
The authors declare that they have no competing interests.

Authors' contributions
FPP prepared the case report, performed the experiments and drafted the manuscript. AM conceived of the study, participated in its design and coordination and co-wrote the manuscript. Both authors read and approved the final manuscript.

Pre-publication history
The pre-publication history for this paper can be accessed here:



Acknowledgements
We thank Dr. Alexandra Kouraklis, PUH, for her help in this study.

Written consent was obtained from the patient or their relative for publication of the patient's details.

This work was supported in part by a grant from Novartis (Basel, Switzerland).
==== Refs
Cines DB Blanchette VS  Immune thrombocytopenic purpura N Engl J Med 2002 346 995 1008 11919310 10.1056/NEJMra010501 
McMillan R  The pathogenesis of chronic immune (idiopathic) thrombocytopenic purpura Semin Hematol 2000 37 5 9 10676917 
Hed J  Role of complement in immune or idiopathic thrombocytopenic purpura Acta Paediatr Suppl 1998 424 37 40 9736216 10.1080/080352598750030726 
Olsson B Andersson PO Jernas M Jacobsson S Carlsson B Carlsson LM Wadenvik H  T-cell-mediated cytotoxicity toward platelets in chronic idiopathic thrombocytopenic purpura Nat Med 2003 9 1123 1124 12937414 10.1038/nm921 
Kuwana M Kaburaki J Ikeda Y  Autoreactive T cells to platelet GPIIb-IIIa in immune thrombocytopenic purpura. Role in production of anti-platelet autoantibody J Clin Invest 1998 102 1393 1402 9769332 
Semple JW Milev Y Cosgrave D Mody M Hornstein A Blanchette V Freedman J  Differences in serum cytokine levels in acute and chronic autoimmune thrombocytopenic purpura: relationship to platelet phenotype and antiplatelet T-cell reactivity Blood 1996 87 4245 4254 8639783 
Coopamah MD Garvey MB Freedman J Semple JW  Cellular immune mechanisms in autoimmune thrombocytopenic purpura: An update Transfus Med Rev 2003 17 69 80 12522773 10.1053/tmrv.2003.50004 
Panitsas FP Theodoropoulou M Kouraklis A Karakantza M Theodorou GL Zoumbos NC Maniatis A Mouzaki A  Adult chronic idiopathic thrombocytopenic purpura (ITP) is the manifestation of a type-1 polarized immune response Blood 2004 103 2645 2647 14670926 10.1182/blood-2003-07-2268 
Kuwana M Okazaki Y Kaburaki J Kawakami Y Ikeda Y  Spleen is a primary site for activation of platelet-reactive T and B cells in patients with immune thrombocytopenic purpura J Immunol 2002 168 3675 3682 11907134 
Sandler SG  The spleen and splenectomy in immune (idiopathic) thrombocytopenic purpura Semin Hematol 2000 37 10 12 10676918 
Najean Y Rain JD Billotey C  The site of destruction of autologous 111In-labelled platelets and the efficiency of splenectomy in children and adults with idiopathic thrombocytopenic purpura: a study of 578 patients with 268 splenectomies Br J Haematol 1997 97 547 550 9207397 10.1046/j.1365-2141.1997.832723.x 
McMillan R  Autoantibodies and autoantigens in chronic immune thrombocytopenic purpura Semin Hematol 2000 37 239 248 10942218 
Mazzucconi MG Arista MC Peraino M Chistolini A Felici C Francavilla V Macale E Conti L Gandolfo GM  Long-term follow-up of autoimmune thrombocytopenic purpura (ATP) patients submitted to splenectomy Eur J Haematol 1999 62 219 222 10227454 
Aster RH George JN McMillan R Ganguly P  Workshop on autoimmune (idiopathic) thrombocytopenic purpura: pathogenesis and new approaches to therapy Am J Hematol 1998 58 231 234 9687283 10.1002/(SICI)1096-8652(199807)58:3<231::AID-AJH12>3.0.CO;2-C 
Mazzucconi MG Piola P Arista MC Bizzoni L Antenucci A Conti L  Modifications of lymphocyte subsets in autoimmune thrombocytopenic purpura patients submitted to splenectomy Haematologica 2000 85 776 777 10897141 
Chang CS Li CY Cha SS  Chronic idiopathic thrombocytopenic purpura. Splenic pathologic features and their clinical correlation Arch Pathol Lab Med 1993 117 981 985 8215839 
Kuhne T Elinder G Blanchette VS Garvey B  Current management issues of childhood and adult immune thrombocytopenic purpura (ITP) Acta Paediatr Suppl 1998 424 75 81 9736225 
Portielje JE Westendorp RG Kluin-Nelemans HC Brand A  Morbidity and mortality in adults with idiopathic thrombocytopenic purpura Blood 2001 97 2549 2554 11313240 10.1182/blood.V97.9.2549 
Stasi R Stipa E Masi M Cecconi M Scimo MT Oliva F Sciarra A Perrotti AP Adomo G Amadori S .  Long-term observation of 208 adults with chronic idiopathic thrombocytopenic purpura Am J Med 1995 98 436 442 7733121 10.1016/S0002-9343(99)80342-8 
Karpatkin S  Autoimmune (idiopathic) thrombocytopenic purpura Lancet 1997 349 1531 1536 9167472 10.1016/S0140-6736(96)12118-8

