
==== Front
BMC MicrobiolBMC Microbiology1471-2180BioMed Central London 1471-2180-4-341533934210.1186/1471-2180-4-34Research ArticleDam inactivation in Neisseria meningitidis: prevalence among diverse hyperinvasive lineages Jolley Keith A 1keith.jolley@medawar.ox.ac.ukSun Li 2richard.moxon@paediatrics.ox.ac.ukMoxon E Richard 2richard.moxon@paediatrics.ox.ac.ukMaiden Martin CJ 1martin.maiden@zoo.ox.ac.uk1 The Peter Medawar Building for Pathogen Research and Department of Zoology, University of Oxford, South Parks Road, Oxford, OX1 3SY, UK2 Molecular Infectious Diseases Group, University of Oxford Department of Paediatrics, Weatherall Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, OX3 9DS, UK2004 31 8 2004 4 34 34 22 7 2004 31 8 2004 Copyright © 2004 Jolley et al; licensee BioMed Central Ltd.This is an open-access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
DNA adenine methyltransferase (Dam) activity is absent in many, but not all, disease isolates of Neisseria meningitidis, as a consequence of the insertion of a restriction endonuclease-encoding gene, the 'dam replacing gene' (drg) at the dam locus. Here, we report the results of a survey to assess the prevalence of drg in a globally representative panel of disease-associated meningococci.

Results
Of the known meningococcal hyper-invasive lineages investigated, drg was absent in all representatives of the ST-8 and ST-11 clonal complexes tested, but uniformly present in the representatives of the other hyper-invasive lineages present in the isolate collection (the ST-1, ST-4, ST-5, ST-32 and ST-41/44 clonal complexes). The patterns of sequence diversity observed in drg were consistent with acquisition of this gene from a source organism with a different G+C content, at some time prior to the emergence of present-day meningococcal clonal complexes, followed by spread through the meningococcal population by horizontal genetic exchange. During this spread a number of alleles have arisen by mutation and intragenic recombination.

Conclusion
These findings are consistent with the idea that possession of the drg gene may contribute to the divergence observed among meningococcal clonal complexes, but does not have a direct mechanistic involvement in virulence.
==== Body
Background
Neisseria meningitidis, the causative agent of meningococcal meningitis and septicaemia, is a common inhabitant of the human nasopharynx, being asymptomatically carried by approximately 10% of the population [1,2]. There is evidence for extensive horizontal genetic exchange in populations of this antigenically and genetically variable Gram-negative bacterium [3-7] but, despite the diversity of carried meningococci, only a limited number of genotypes – the hyper-invasive lineages – are responsible for most reported disease [8]. These lineages have been identified by the techniques of multilocus enzyme electrophoresis [9] and multilocus sequence typing (MLST) [10] as clonal complexes. In recent years, the ST-1 complex (formerly subgroup I), ST-4 complex (subgroup IV), and ST-5 complex (subgroup III) have dominated meningococcal disease in Africa and Asia, while members of the ST-11 (ET-37) complex, ST-8 complex (cluster A4), ST-41/44 complex (lineage 3), and ST-32 (ET-5) complex have caused most disease in other parts of the world. Meningococci occasionally cause epidemic outbreaks of varying scale up to global pandemics, although at a given point in time disease in a given geographical locale is often dominated by a limited number of clonal complexes [8].

DNA adenine methyltransferase (Dam) is an enzyme involved in the mismatch repair system of bacteria. During DNA replication, only the parental strand is fully methylated by the enzyme, since methylation is not immediate, allowing a mismatch on the newly synthesised strand to be excised and replaced [11]. Disruption of Dam activity suggests that mismatch repair will be less effective, potentially allowing the creation of frameshift mutations in the homopolymeric or simple repeat motifs within the promoter or coding regions of surface antigen genes leading to the reversible switching of their expression state. This is an important mechanism found at bacterial loci that encode gene products that are advantageous under certain conditions but not others; such genes have been termed contingency loci [12]. There is extensive evidence for such loci in the meningococcal genome [13]. In particular, the ability to vary the expression state of surface-exposed cellular components is important for within host adaptation, for example by allowing evasion of the immune response in the nasopharynx. These mechanisms are also important in the occasional transition from harmless colonisation to invasive disease [14-16]. Examples of such loci described in the meningococcus to date include: the capsular polysaccharide [17]; the Opc outer membrane protein [18-20]; pili [21]; the PorA protein [22]; and opacity proteins [19,23].

Dam methylation has been implicated in modifying the virulence of a number of bacterial pathogens [24-26], but its role in N. meningitidis has been contentious. Bucci et al., 1999 [27] suggested that the absence of Dam activity was responsible for high rates of phase variation in the siaD capsule gene, resulting in an increased virulence of some strains. In addition, the latter work suggested that all pathogenic isolates lacked Dam activity, the dam gene inactivated by the insertion of a putative restriction endonuclease, named 'dam replacing gene' (drg), with the genotypes dam+/drg- and dam-/drg+ being mutually exclusive. However, two subsequent studies [28,29] have found no effect. The drg gene encodes a restriction enzyme, NmeBII that is similar to the Streptococcus pneumoniae DpnI restriction endonuclease which cleaves at GmeATC, but not at GATC, sequences [30,31].

In the present study the prevalence of drg and its association with disease-associated isolates of N. meningitidis was examined by a survey of its distribution in a collection of isolates chosen to represent the known diversity of pathogenic meningococci [10]. The results suggest that, while drg is present in some lineages but not others, this gene has spread in the meningococcal population by horizontal genetic exchange, possibly after the introduction of the drg gene from an exogenous source.

Results
Distribution of dam and drg among invasive meningococci
In all cases, there was an exact correlation with the presence of dam and the absence of drg, and vice-versa. Of the 84 isolates tested, 23 were indicated to be dam+/drg- and 61 to be dam-/drg+ by restriction analysis and PCR amplification (see Additional file 1). The presence of dam or drg was associated with particular clonal complexes. Of the hyper-invasive lineages included in the analysis, all ST-8 complex and ST-11 complex isolates were dam+/drg-, while all of the representatives of the ST-1, ST-4, ST-5, ST-41/44, and ST-32 complexes were dam-/drg+.

Diversity of drg gene fragment sequences
The level of nucleotide diversity, as represented by number of alleles and polymorphic sites, along with the p-distances seen within drg gene fragments was similar to that seen with the housekeeping genes used for MLST (Table 1), with a total of 19 different fragment sequences (drg-1 – drg-19) present in this collection. The ratio of non-synonymous to synonymous substitutions (dN/dS, 0.11) was also similar to that seen in the MLST gene fragments. Three drg gene fragments (drg-13, drg-14 and drg-15) exhibited polymorphisms resulting in single base frameshifts, two resulting in stop codons (Figure 1) and one fragment (drg-16) had an insertion corresponding to a 24-base direct repeat. The G+C content of drg at 42.4% was lower than that of the housekeeping genes, which were in the range 51.1–57.4%.

Split decomposition analysis of the drg fragment sequences generated a star phylogeny with some net-like phylogenetic structure involving the drg-2 allele (Figure 2). The distribution of the different drg sequences amongst the clonal complexes is also shown in Figure 2.

Discussion
The meningococcus is an example of an accidental pathogen, a commensal organism that rarely causes disease and which gains no evolutionary benefit from this process [32]. A complete understanding of the diseases caused by such organisms is dependent upon an appreciation of the mechanisms by which harmless carriage develops into invasive disease [33]. The observation that some meningococcal genotypes, the hyper-invasive lineages, are more likely to cause disease than others [8,10] suggests that comparative studies of disease-associated and carried meningococci may identify genetic factors responsible for disease [34]. In this context, the suggestion that the possession of a single genetic change, the insertion of the drg gene at the dam locus, was essential for virulence in meningococci [27] was attractive as it provided a single characteristic associated with the disease phenotype. Further, this proposal provided a plausible mechanistic explanation, namely the promotion of rapid switching of expression of contingency genes, for example those encoding the capsule which represents the best defined meningococcal virulence determinant [35]. This is consistent with the evidence that inactivation of Dam has been shown to affect rates of recombination and phase change in other species [25,36].

The data presented here, however, do not support the contention that the drg insertion is preferentially associated with disease-associated meningococcal isolates, even those expressing serogroup B capsular polysaccharide. There was no evidence of a difference between disease-associated and carried meningococcal isolates with 76% (45/59) of disease-associated isolates and 75% (11/15) of carrier isolates possessing the drg insertion. The isolate collection employed by the present investigation was chosen to be globally representative of meningococcal disease in the latter part of the 20th century, with multiple examples of each of the major hyper-invasive meningococci identified over this period. When analysed by clonal complex, which identifies hyper-invasive lineages, it was apparent that the drg insertion was absent from all of the isolates representing the ST-8 and ST-11 clonal complexes, both major hyper-invasive lineages but, conversely, drg was present in all representatives of the hyper invasive lineages represented by the ST-1, ST-4, ST-5, ST-41/44, and ST-32 complexes. This association was independent of the serogroup expressed by the isolates and provided a likely explanation of the earlier observations [27]. As meningococcal disease in a given locale at a given time tends to be dominated by a limited number of clonal complexes [8], it is likely from the results provided here that a given sample of disease-associated isolates collected from a given locale will be uniform at the dam locus. At a given point in time they may be dominated by drg containing meningococci, while at other times isolates without this insertion might dominate. For example, as both the ST-1 and ST 32 complexes contain the drg insertion, this insertion would be prevalent among the disease isolates recovered by the pandemic outbreaks caused by these clonal complexes [37,38]; conversely, the spread of ST-11 meningococci [39,40] would result in an increased prevalence of disease-associated meningococci without the drg insertion. This observation highlights the importance of assembling genetically defined isolate collections with a prescribed sampling frame if comparisons of meningococci with potential for virulence are to be undertaken.

It has been suggested that the drg gene has been introduced into Neisseria from an exogenous source [30]. The difference in the G+C% content of the drg gene compared to the meningococcal housekeeping genes was consistent with this idea; however, the levels of diversity among the drg alleles, which was similar to that observed in the meningococcal housekeeping genes, along with the reported occurrence of drg in other Neisseria species [30], suggested that this was a relatively old event predating the emergence of present-day clonal complexes. The ratio of non-synonymous to synonymous substitutions (dN/dS), which was also similar to that observed in meningococcal housekeeping genes, suggested that the drg gene had been subject to stabilising selection for conservation of function since its putative introduction into the meningococcal population, although the possession of frame shift mutations in some of the drg alleles demonstrated that, as with N. lactamica, not all meningococci possessing the drg insertion expressed the endonuclease [30]. In other respects the distribution of the gene among clonal complexes and the patterns of nucleotide sequence variation observed were similar to those seen in meningococcal housekeeping genes, suggesting that it is subject to similar selection pressures [41].

The presence of multiple methylation systems is a characteristic of the Neisseria and may be related to the transformable nature of these organisms [42]. Whole genome comparisons of meningococci belonging to different clonal complexes frequently yield different restriction modification systems as the principal detectable genetic differences [43,44]. It is attractive to speculate that the genetic isolation of clonal complexes may be promoted by such differences [45] and in this respect the insertion of drg in the dam locus, replacing a methylase with an endonuclease, may provide a potent barrier to genetic exchange from dam+ to drg+ meningococci; indeed, while there was evidence for the occasional horizontal genetic exchange of drg alleles among the genetically diverse meningococci that possess the insertion, there was no evidence for the transformational loss of drg from a given clonal complex among the isolates examined here. This concept of genetic isolation among lineages receives some support from the possession of porB2 alleles by members of the dam+ ST-8 and ST-11 complexes and porB3 alleles by the clonal complexes with the drg insertion [9,39], but the evidence for limitations in gene flow between these subgroups of meningococci is not at present conclusive.

Conclusions
While it is possible that the possession of the drg insertion may influence meningococcal population structure, the data presented here do not support a direct association of this genotype with meningococcal virulence.

Methods
Bacterial isolates
The 84 isolates used in this study (see Additional file 1) were a subset of a collection of 107 diverse meningococci assembled to develop and validate the MLST scheme for Neisseria meningitidis [10]. The collection included representatives of the major hyper-invasive lineages and has been characterised at many genetic loci (full details of this isolate collection are available at ).

Restriction digestion of chromosomal DNA
The methylation status of the chromosomal DNA of each isolate was determined by restriction digestion with the restriction endonucleases DpnI, DpnII, and Sau3AI, followed by separation of the digestion products by agarose gel electrophoresis. Each enzyme specifically recognises a cognate target site of GATC and cleaves this site depending on whether it is methylated or not: DpnI cleaves this target sequence only when N6-methyladenine is present within the recognition sequence; DpnII cleaves only unmethylated sites, and Sau3AI cleaves both methylated and unmethylated target sequences.

PCR amplification and nucleotide sequence determination
The presence of the dam gene was determined by polymerase chain reaction (PCR) performed using dam specific primers, DamF1 (5' – TAAAATGGGCAGGCGGCA – 3') and DamB2 (5' – CGTAAGGGGGATCGCAAT – 3'). These amplify a 534 bp fragment from the 5' end of the dam gene in dam+ strains but not from dam-strains. The presence of drg was determined by PCR using primers DrgF1 (5' – CATGAATTTATTTTTCGATA – 3') and DrgB2 (5' – AATTTGCAACTGTTGGCG – 3') that bind to drg internal sites and produce a 705 bp fragment in isolates containing the drg gene. PCR amplification was also performed using primer pairs Drg5F (5' – TGTCTAAAGAACTCAAAG – 3') / DrgB3 (5' – CGGTATCGAAAAATAAAT – 3') and Drg3F (5' – ATCCATCCAATTTCCCCA – 3') / DamB5 (5' – AAATGCCGTCTGAA – 3') based on dam and drg coding regions in order to confirm that dam inactivation was due to drg insertion.

Amplicons corresponding to the drg gene were purified by precipitation with poylethylene glycol and sodium chloride as described previously [46] and their nucleotide sequences determined on both strands by cycle sequencing. BigDye™ terminators (ABI, Foster city, California) and the same primers as used for amplification were employed in the extension reactions and the labelled reaction products separated on an ABI 3700 automated DNA sequencer. Each fragment was sequenced at least once on each strand and the sequences assembled with the STADEN suite of computer programs. Each unique drg sequence was assigned an arbitrary allele number in order of discovery.

Data analysis
Percentage G+C was calculated using the program START [47]. Split decomposition analysis of the drg gene fragments was performed using SPLITSTREE, version 3.1 [48]. The proportion of non-synonymous to synonymous substitutions was calculated by the method of Nei and Gojobori [49] using the program MEGA2 [50].

Authors' contributions
KAJ carried out the nucleotide sequencing and analysis of the data. LS performed the PCR screening of the isolates. ERM and MCJM conceived of the study and participated in its design and coordination.

Supplementary Material
Additional File 1
Bacterial isolates used in the study

Click here for file

 Acknowledegements
MCJM is a Wellcome Trust Senior Research Fellow. This work was supported by an award from the Wellcome Trust to MCJM (grant 055104).

Figures and Tables
Figure 1 Variable sites in drg gene fragments

Figure 2 Splits graph of drg gene fragments. The drg alleles found in the major drg+ hyper-invasive lineages are annotated.

Table 1 Genetic variation in MLST and drg loci

Locus	No. of alleles (no./100 isolates)	No. (%) of polymorphic sites	dN/dS	Average p-distance	%G+C	
abcZ	15 (14)	75 (17.4)	0.05	0.052	51.1	
adk	10 (9.4)	17 (3.7)	0.02	0.012	52.3	
aroE	18 (16.8)	166 (34)	0.293	0.106	55.6	
fumC	19 (17.8)	38 (8.2)	0.024	0.022	57.4	
gdh	16 (15)	28 (5.6)	0.05	0.019	52.3	
pdhC	24 (22.4)	80 (16.7)	0.07	0.054	55.9	
pgm	21 (19.6)	77 (17)	0.121	0.050	54.2	
drg	19 (31.1*)	48 (7.4) †	0.11	0.021	42.4	
*only 61 isolates contained drg

† excluding indels – length of fragment: 650
==== Refs
Broome CV  The carrier state: Neisseria meningitidis. J Antimicrob Chemother 1986 18 25 34 3091563 
Cartwright K  Cartwright K  Meningococcal carriage and disease Meningococcal disease 1995 Chichester: John Wiley & Sons Ltd 115 146 
Bygraves JA Urwin R Fox AJ Gray SJ Russell JE Feavers IM Maiden MCJ  Population genetic and evolutionary approaches to the analysis of Neisseria meningitidis isolates belonging to the ET-5 complex J Bacteriol 1999 181 5551 5556 10482493 
Feavers IM Gray SJ Urwin R Russell JE Bygraves JA Kaczmarski EB Maiden MCJ  Multilocus sequence typing and antigen gene sequencing in the investigation of a meningococcal disease outbreak J Clin Microbiol 1999 37 3883 3887 10565901 
Kriz P Giorgini D Musilek M Larribe M Taha MK  Microevolution through DNA exchange among strains of Neisseria meningitidis isolated during an outbreak in the Czech Republic Res Microbiol 1999 150 273 80 10376489 10.1016/S0923-2508(99)80052-7 
Feil EJ Enright MC Spratt BG  Estimating the relative contributions of mutation and recombination to clonal diversification: a comparison between Neisseria meningitidis and Streptococcus pneumoniae Res Microbiol 2000 151 465 9 10961460 10.1016/S0923-2508(00)00168-6 
Feil EJ Maiden MCJ Achtman M Spratt BG  The relative contributions of recombination and mutation to the divergence of clones of Neisseria meningitidis Mol Biol Evol 1999 16 1496 1502 10555280 
Caugant DA  Population genetics and molecular epidemiology of Neisseria meningitidis Apmis 1998 106 505 25 9674888 
Caugant DA Mocca LF Frasch CE Frøholm LO Zollinger WD Selander RK  Genetic structure of Neisseria meningitidis populations in relation to serogroup, serotype, and outer membrane protein pattern J Bacteriol 1987 169 2781 2792 3108242 
Maiden MCJ Bygraves JA Feil E Morelli G Russell JE Urwin R Zhang Q Zhou J Zurth K Caugant DA  Multilocus sequence typing: a portable approach to the identification of clones within populations of pathogenic microorganisms Proc Natl Acad Sci USA 1998 95 3140 3145 9501229 10.1073/pnas.95.6.3140 
Modrich P  Mechanisms and biological effects of mismatch repair Annu Rev Genet 1991 25 229 53 1812808 10.1146/annurev.ge.25.120191.001305 
Moxon ER Rainey PB Nowak MA Lenski RE  Adaptive evolution of highly mutable loci in pathogenic bacteria Curr Biol 1994 4 24 32 7922307 10.1016/S0960-9822(00)00005-1 
Saunders NJ Jeffries AC Peden JF Hood DW Tettelin H Rappuoli R Moxon ER  Repeat associated phase variable genes in the complete genome sequence of Neisseria meningitidis MC58 Mol Microbiol 2000 37 207 215 10931317 10.1046/j.1365-2958.2000.02000.x 
Hammerschmidt S Birkholz C Zahringer U Robertson BD van Putten J Ebeling O Frosch M  Contribution of genes from the capsule gene complex cps to lipooligosaccharide biosynthesis and serum resistance in Neisseria meningitidis Mol Microbiol 1994 11 885 96 8022265 
Vogel U Hammerschmidt S Frosch M  Sialic acids of both the capsule and the sialylated lipooligosaccharide of Neisseria meningitis serogroup B are prerequisites for virulence of meningococci in the infant rat Med Microbiol Immunol (Berl) 1996 185 81 7 8884739 10.1007/s004300050018 
Stephens DS Spellman PA Swartley JS  Effect of the (alpha 2–>8)-linked polysialic acid capsule on adherence of Neisseria meningitidis to human mucosal cells J Infect Dis 1993 167 475 479 8380612 
Hammerschmidt S Muller A Sillmann H Muhlenhoff M Borrow R Fox A van Putten J Zollinger WD Gerardy-Schahn R Frosch M  Capsule phase variation in Neisseria meningitidis serogroup B by slipped-strand mispairing in the polysialyltransferase gene siaD: correlation with bacterial invasion and the outbreak of meningococcal disease Mol Microbiol 1996 20 1211 1220 8809773 
Virji M Makepeace K Ferguson DJP Achtman M Sarkari J Moxon ER  Expression of the Opc protein correlates with invasion of epithelial and endothelial cells by Neisseria meningitidis. Mol Microbiol 1992 6 2785 2795 1435257 
Virji M Makepeace K Ferguson DJ Achtman M Moxon ER  Meningococcal Opa and Opc proteins: their role in colonization and invasion of humanepithelial and endothelial cells Mol Microbiol 1993 10 499 510 7968528 
Sarkari J Pandit N Moxon ER Achtman M  Variable expression of the Opc outer membrane protein in Neisseria meningitidis is caused by size variation of a promotor containing poly-cytidine Mol Microbiol 1994 13 207 217 7984102 
Virji M Alexandrescu C Ferguson DJ Saunders JR Moxon ER  Variations in the expression of pili: the effect on adherence of Neisseria meningitidis tohuman epithelial and endothelial cells Mol Microbiol 1992 6 1271 1279 1353602 
van der Ende A Hopman CTP Dankert J  Multiple mechanisms of phase variation of PorA in Neisseria meningitidis Infect Immun 2000 68 6685 6690 11083782 10.1128/IAI.68.12.6685-6690.2000 
Dehio C Gray-Owen SD Meyer TF  The role of neisserial Opa proteins in interactions with host cells Trends Microbiol 1998 6 489 494 10036728 10.1016/S0966-842X(98)01365-1 
Garcia-Del Portillo F Pucciarelli MG Casadesus J  DNA adenine methylase mutants of Salmonella typhimurium show defects in protein secretion, cell invasion, and M cell cytotoxicity Proc Natl Acad Sci USA 1999 96 11578 83 10500219 10.1073/pnas.96.20.11578 
Watson ME JrJarisch J Smith AL  Inactivation of deoxyadenosine methyltransferase (dam) attenuates Haemophilus influenzae virulence Mol Microbiol 2004 53 651 64 15228541 10.1111/j.1365-2958.2004.04140.x 
Low DA Weyand NJ Mahan MJ  Roles of DNA adenine methylation in regulating bacterial gene expression and virulence Infect Immun 2001 69 7197 204 11705888 10.1128/IAI.69.12.7197-7204.2001 
Bucci C Lavitola A Salvatore P Del Giudice L Massardo DR Bruni CB Alifano P  Hypermutation in pathogenic bacteria: frequent phase variation in meningococci is a phenotypic trait of a specialized mutator biotype Mol Cell 1999 3 435 45 10230396 10.1016/S1097-2765(00)80471-2 
Richardson AR Stojiljkovic I  Mismatch repair and the regulation of phase variation in Neisseria meningitidis Mol Microbiol 2001 40 645 55 11359570 10.1046/j.1365-2958.2001.02408.x 
Martin P Sun L Hood DW Moxon ER  Involvement of genes of genome maintenance in the regulation of phase variation frequencies in Neisseria meningitidis Microbiology 2004  
Cantalupo G Bucci C Salvatore P Pagliarulo C Roberti V Lavitola A Bruni CB Alifano P  Evolution and function of the neisserial dam-replacing gene FEBS Lett 2001 495 178 83 11334887 10.1016/S0014-5793(01)02388-2 
Lacks S Greenberg B  A deoxyribonuclease of Diplococcus pneumoniae specific for methylated DNA J Biol Chem 1975 250 4060 66 236309 
Levin BR  The evolution and maintenance of virulence in microparasites Emerg Infect Dis 1996 2 93 102 8903208 
Maiden MCJ  High-throughput sequencing in the population analysis of bacterial pathogens Int J Med Microbiol 2000 290 183 190 11045923 
Tinsley CR Nassif X  Analysis of the genetic differences between Neisseria meningitidis and Neisseria gonorrhoeae: two closely related bacteria expressing two different pathogenicities Proc Natl Acad Sci U S A 1996 93 11109 14 8855317 10.1073/pnas.93.20.11109 
Peltola H  Meningococcal disease: still with us Rev Infect Dis 1983 5 71 91 6338571 
Waldron DE Owen P Dorman CJ  Competitive interaction of the OxyR DNA-binding protein and the Dam methylase at the antigen 43 gene regulatory region in Escherichia coli Mol Microbiol 2002 44 509 20 11972787 10.1046/j.1365-2958.2002.02905.x 
Caugant DA Frøholm LO Bovre K Holten E Frasch CE Mocca LF Zollinger WD Selander RK  Intercontinental spread of Neisseria meningitidis clones of the ET-5 complex Antonie Leeuwenhoek J Microbiol 1987 53 389 394 
Wang J-F Caugant DA Li X Hu X Poolman JT Crowe BA Achtman M  Clonal and antigenic analysis of serogroup A Neisseria meningitidis with particular reference to epidemiological features of epidemic meningitis in China Infect Immun 1992 60 5267 5282 1452360 
Wang J-F Caugant DA Morelli G Koumaré B Achtman M  Antigenic and epidemiological properties of the ET-37 complex of Neisseria meningitidis J Infect Dis 1993 167 1320 1329 8501321 
Jelfs J Munro R Ashto FE Caugant DA  Genetic characterization of a new variant within the ET-37 complex of Neisseria meningitidis associated with outbreaks in various parts of the world Epidemiol Infect 2000 125 285 98 11117951 10.1017/S0950268899004471 
Holmes EC Urwin R Maiden MCJ  The influence of recombination on the population structure and evolution of the human pathogen Neisseria meningitidis Mol Biol Evol 1999 16 741 749 10368953 
Ritchot N Roy PH  DNA methylation in Neisseria gonorrhoeae and other Neisseriae Gene 1990 86 103 6 2155857 10.1016/0378-1119(90)90120-G 
Claus H Friedrich A Frosch M Vogel U  Differential distribution of novel restriction-modification systems in clonal lineages of Neisseria meningitidis J Bacteriol 2000 182 1296 303 10671450 10.1128/JB.182.5.1296-1303.2000 
Bart A Dankert J van der Ende A  Representational difference analysis of Neisseria meningitidis identifies sequences that are specific for the hyper-virulent lineage III clone FEMS Microbiol Lett 2000 188 111 4 10913691 10.1016/S0378-1097(00)00221-4 
Claus H Stoevesandt J Frosch M Vogel U  Genetic isolation of meningococci of the electrophoretic type 37 complex J Bacteriol 2001 183 2570 2575 11274117 10.1128/JB.183.8.2570-2575.2001 
Embley TM  The linear PCR reaction: a simple and robust method for sequencing amplified rRNA genes Lett Appl Microbiol 1991 13 171 174 1370053 
Jolley KA Feil EJ Chan MS Maiden MC  Sequence type analysis and recombinational tests (START) Bioinformatics 2001 17 1230 1 11751234 10.1093/bioinformatics/17.12.1230 
Huson DH  SplitsTree: analyzing and visualizing evolutionary data Bioinformatics 1998 14 68 73 9520503 10.1093/bioinformatics/14.1.68 
Nei M Gojobori T  Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions Mol Biol Evol 1986 3 418 26 3444411 
Kumar S Tamura K Jakobsen IB Nei M  MEGA2: molecular evolutionary genetics analysis software Bioinformatics 2001 17 1244 5 11751241 10.1093/bioinformatics/17.12.1244

