
==== Front
BMC Struct BiolBMC Structural Biology1472-6807BioMed Central London 1472-6807-4-91530602810.1186/1472-6807-4-9Research ArticleThe solution structure of ChaB, a putative membrane ion antiporter regulator from Escherichia coli Osborne Michael J 1mike@bri.nrc.caSiddiqui Nadeem 1nsiddi@po-box.mcgill.caIannuzzi Pietro 2pietro@bri.nrc.caGehring Kalle 1kalle.gehring@mcgill.ca1 Department of Biochemistry, McGill University, 3655 Promenade Sir William Osler, Montreal, Quebec, Canada, H3G 1Y62 Biotechnology Research Institute, National Research Council of Canada, 6100 Royalmount Avenue, Montreal Quebec, Canada, H4P 2R22004 11 8 2004 4 9 9 14 5 2004 11 8 2004 Copyright © 2004 Osborne et al; licensee BioMed Central Ltd.2004Osborne et al; licensee BioMed Central Ltd.This is an open-access article distributed under the terms of the Creative Commons Attribution License (), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Background
ChaB is a putative regulator of ChaA, a Na+/H+ antiporter that also has Ca+/H+ activity in E. coli. ChaB contains a conserved 60-residue region of unknown function found in other bacteria, archaeabacteria and a series of baculoviral proteins. As part of a structural genomics project, the structure of ChaB was elucidated by NMR spectroscopy.

Results
The structure of ChaB is composed of 3 α-helices and a small sheet that pack tightly to form a fold that is found in the cyclin-box family of proteins.

Conclusion
ChaB is distinguished from its putative DNA binding sequence homologues by a highly charged flexible loop region that has weak affinity to Mg2+ and Ca2+ divalent metal ions.

NMR spectroscopystructureChaAChaBantiporter
==== Body
Background
The regulation of cellular ion concentrations is an essential process in all organisms, necessary to sustain a multitude of physiological processes including pH balance and ion homeostasis. This process is accomplished mainly through membrane ion transporters. In Escherichia coli, among the membrane proteins that catalyze the exchange of ions across the cell membrane [1] are the Na+/H+ antiporters NhaA, NhaB and ChaA, which are involved in sodium ion extrusion. Within E. coli and other enteric bacteria, antiporters encompass the primary systems responsible for adaptation to growth in conditions of high Na+ concentrations and varying pH [2-8]. It is common for bacteria to have multiple systems for a similar function. The use of one system is preferred depending on the stress as a means to adapt to varying environmental conditions [9,10]. Of the Na+/H+ antiporters, ChaA is unique in that it also shows pH-independent Ca+/H+ antiporter activity. ChaA is also regulated by Mg2+, which inhibits both its Na+/H+ and Ca+/H+ antiporter activity [11].

The Cha operon consists of 3 genes, chaA, chaB and chaC found at ~27 minutes on the E. coli chromosome [12]. Both ChaB and ChaC are proposed to be regulators of ChaA however, the biological function for either remains to be established. ChaB is a 76-residue protein that contains a conserved 60-residue region found in several other bacteria and baculoviruses. We report here the three-dimensional structure of ChaB determined by NMR spectroscopy and examine key differences between the ChaB families of proteins.

Results and Discussion
Assignment of resonances
The 1H-15N HSQC spectrum of ChaB (Fig. 1) is well dispersed suggesting ChaB is a globular, folded protein. Complete 1H, 15N and 13C backbone assignments were made for ChaB, except residues S39 and H40, which yielded no apparent amide cross peaks. Virtually complete assignments (> 98%) were made for the 1H, 13C, and 15N side chain resonances. Resonance assignments have been deposited at BMRB (code 6117). Six signals in the 1H-15N HSQC spectrum originated from the 21 residue N-terminal His-tag (Fig. 1). The low heteronuclear NOE values (Fig. 2A) and the relatively low number of long range NOE's (Fig. 2B) for these residues indicate the His-tag to be flexible in solution.

Figure 1 1H-15N HSQC spectrum of ChaB at 600 MHz, pH 6.3 in 50 mM CaCl2. Folded resonances are indicated by asterisks. Numbering shown includes the N-terminal His-tag (residues 1–21). The native ChaB sequence starts at P22. The unassigned peak is denoted as a question mark. Folded arginine/lysine side chain resonances are indicated by SC.

Figure 2 Plots of 1H-15N heteronuclear NOE, NOE constraints and RMSD statistics for ChaB. (A) 1H-15N heteronuclear NOE acquired at 600 MHz. (B) Summary of all unassigned unambiguous NOE constraints: intra-residue, sequential, medium and long range NOEs are shown as blue, green, red and black bars respectively. (C) Backbone RMSD's calculated for the 17 lowest energy ChaB structures based on superposition of residues P22-S96.

Solution structure of ChaB
The 3D structure of ChaB (Fig. 3) is well defined by the structural constraints (Table 1) and is dominated by two, relatively long central helices comprising residues H40-Q55 (helix α2) and D65-E83 (helix α3) and a small N-terminal helix (helix α1, E31-K34), which is terminated by a proline (P30). At the C-terminus, a short two-strand β-sheet is observed involving residues Y84-K86 and W92-K94. A tightly packed hydrophobic core stabilizes the overall fold of ChaB. The following hydrophobic residues have < 10% of their surface area exposed to the solvent: Y23, L29, V33, L37, A41, I44, Y45, A48, F49, A52, A72, A76, V80, Y84, A85 and W92. Many of the hydrophobic contacts are between the two long helices (α2 and α3). The C-terminal β-sheet acts as a "cap" for hydrophobic residues from loop 1 (V36, L37), which connects helices α1 and α2, and residues at the N-terminus of helix α2 (A41) and the C-terminus of α3 (V80). Both central helices are largely amphipathic, with residues D43, K46, E47, D54, of helix α2 and E70, K74 and K81 of helix α3 exposed to the bulk solvent and contributing to a highly charged ChaB surface. Most notable, an area of negative charge is observed at the highly mobile loop 2 and the helices immediately surrounding it. In addition, K74, K81, K86, and K95 contribute to a positively charged area while Y56, V75 and A79 present a small hydrophobic patch.

Table 1 Constraints and structural statistics for ChaB

Constraints used for structure calculation (all residues)	
Total NOE constraints		2140	
Intraresidue NOEs	(n = 0)	515	
Sequential NOEs	(n = 1)	432	
Medium Range NOEs	(n = 2,3,4)	379	
Long Range NOEs	(n > 4)	486	
Total Unambigous NOEs		1794	
Ambiguous NOE restraints		346	
Dihedral angle constraints		49	
15N-1H residual dipolar couplings		58	
Average RMSD to mean structure (Å) (residues 22–96)	
Backbone atoms		0.397	
All heavy (non-hydrogen atoms)		0.807	
Average energy values (kcal mole-1) quoted for residues 1–96	
Etotal		-332.42 ± 9.46	
Ebond		11.93 ± 0.89	
Eangle		84.06 ± 1.56	
Eimproper		16.35 ± 0.58	
EVdW		-515.11 ± 10.31	
ENOE		41.39 ± 3.75	
Edihedral		0.86 ± 0.21	
Esani		28.09 ± 3.11	
Deviation from idealised covalent geometry	
Bonds (Å)		0.0028 ± 0.0001	
Angles (°)		0.4470 ± 0.0042	
Improper (°)		0.353 ± 0.006	
RMSD from experimental data	
Distance restraints (Å)		0.016 ± 0.0007	
Dihedral angle restraints (°)		0.302 ± 0.094	
Average Ramachandran statistics for 17 lowest energy structures (residues 22–96)	
Residues in most favored regions		78.2%	
Residues in additional allowed regions		8.6%	
Residues in generously allowed regions		3.3%	
Residues in disallowed regions		0.0%	
Analysis of residual dipolar coupling	
RMSD (Hz)		1.495 ± 0.097	
Q-factor		0.138 ± 0.0059	
Correlation coefficient		0.98	
Figure 3 Solution structure of ChaB. Ensemble of the 17 lowest energy structures showing (A) backbone and (B) heavy-atom traces. Superposition was made over residues comprising the native ChaB sequence (P22-S96). (C) Ribbon representation of the lowest energy ChaB conformer.

In general, the secondary structure elements of ChaB are well defined exhibiting RMSD's of 0.14 Å and 0.39 Å for backbone and all non-hydrogen atoms, respectively. This is confirmed by the heteronuclear NOE data, which show a 10% trimmed weighted mean of 0.77 ± 0.03 in the structured regions and indicate lack of motions on the nanosecond timescale (Fig. 2A). Regions connecting the secondary structural elements exhibited lower heteronuclear NOE values. In particular, the loops connecting helices α2 and α3 (loop 2, Y56-D64) and the two strands of the β-sheet (loop3, G87-K91) exhibited NOE values below 0.65, indicating large amplitude nanosecond motions in these regions. These motions manifest as regions with large RMSD values in the structural ensemble (Fig. 2C). The small sheet region at the C-terminus was also seen to exhibit some motional freedom particularly for the second strand. However, it is notable that its NOE values are substantially higher than the surrounding loop.

The ChaB family and structurally similar proteins
Figure 4 shows the alignment of protein sequences related to E. coli ChaB. The most conserved residues make up the hydrophobic core of ChaB, particularly the two long helices and the small sheet. With the exception of P38 and A79 all these residues exhibit < 5% solvent accessibility. These residues are critical for defining the overall fold of ChaB and suggest that all proteins within this family adopt a similar fold.

Figure 4 Sequence alignment of the family of ChaB proteins. (A) Alignment of ChaB from E. coli aligned with a series of related proteins identified by Pfam [34]. In bold above alignments, are residues most conserved among ChaB proteins. Cartoon diagram above represents the secondary structure of ChaB. ChaB from E. coli (in bold) Salmonella typhi (Q8XGJ2)and Methanosarcina mazei (Q8PYS9) are classified as group I ChaB proteins. Group II ChaB proteins are all found in Baculoviridae. The figure was created using BOXSHADE (EMBnet). Identical amino acids are highlighted in black and homologous residues in gray. (B) Sequence alignments of ChaB and related proteins σ70 and σRN based structural composition (see text for details).

Structural homologues of ChaB in the PDB were identified using the DALI server [13] (Fig. 5). This yielded several matches with fragments of other structures, the best match being sigma factor σ70 (PDB code 1SIG, [14]) with a DALI Z-score of 4.7. A DALI-Z score greater than 2.0 is considered structurally similar. Another sigma factor, σRN[15], with little sequence homology to σ70 was identified with a DALI-Z score of 3.5. ChaB, however, exhibits no significant sequence similarity with these proteins. Sigma factors are proteins, which bind to DNA dependent RNA polymerases to form the holeoenzyme [16,17]. Although the observed structural similarities do not define a functional role for ChaB it is worth noting that the σRN domain is classified in the cyclin-box fold of proteins [15], a class of proteins that bind a diverse set of proteins and nucleic acids [18].

Figure 5 Comparison of ChaB with structurally similar proteins. Structural similarities between (A) ChaB, (B) σ70(PDB code 1SIG [14]) and (C) σRN (PDB code 1H3L, [15]) proteins identified from the DALI server. The three helices in ChaB are colour coded, with the equivalent helices in σ70 and σRN similarly coloured.

An interesting observation can be made when aligning the sequences of ChaB, σ70 and σRN based on their structural similarity (Fig. 4B). Residues in the three structures with < 10% of the surface exposed to the solvent are highlighted in red. Clearly, the hydrophobic core, critical for the ChaB fold (marked above the sequence alignments in Fig. 4) is also important for the fold observed in the sigma factors. Key hydrophobic residues appear in similar locations in their "structural space" between the three proteins, forging contacts important for stabilizing the fold. These residues are among the most conserved in the two sigma factor families and within ChaB proteins.

Loop 2 has weak affinity for divalent ions
Given the proposed function of ChaB as a regulator and the effect of magnesium as an inhibitor of the Ca+/H+ antiporter ChaA, we examined the influence of calcium and magnesium ions on ChaB 15N-1H chemical shifts. The pattern of perturbed shifts (summarised in Fig. 6A for Ca2+) indicates that the highly charged (Fig. 6B) flexible loop 2 and surrounding regions are most important for binding. Chemical shift perturbations of similar magnitude and direction were witnessed upon addition of MgCl2 indicating that Mg2+ has a similar binding site and affinity for ChaB as Ca2+. The observed association constant for CaCl2 is weak (the KD was estimated to be > 10 mM by NMR) and not likely to be physiologically significant. Given ChaB's proposed role as a regulatory protein, it is possible that the affinity for Ca2+ or Mg2+ is increased in the presence of ChaA or ChaC.

Figure 6 CaCl2 titration and surface potential map of ChaB. (A) Summary of the perturbations of CaCl2 on the backbone 1H-15N chemical shifts of ChaB. The change in chemical shifts (determined from a weighted vector sum of 1H and 15N ppm deviations) are mapped onto the structure of ChaB using a colour gradient from blue, to red to yellow, where yellow is the largest perturbation and blue the smallest. Residues that could not be analyzed such as overlapping residues or residues that do not exhibit NH resonances are coloured grey. (B) Potential map of the surface of ChaB calculated using MOLMOL [35] shown in the same orientation as (A). Residues most perturbed by Ca2+ cluster around a highly negatively charged patch on the ChaB surface comprising a flexible loop.

A functional role for loop 2?
ChaB proteins are classified into two major groups based on their sequence alignments (Fig. 4). Group I consists of ChaB proteins found in bacteria (E. coli and Salmonella typhi) and archeabacteria (Methanosarcina mazei), while Group II contain ChaB related proteins that are found in Baculoviridae. Thus far, no ChaB domains have been identified in vertebrate and plant species. One major difference between the two classes of ChaB proteins is the presence of the charged loop (loop 2, Fig. 4) that we have shown to bind weakly to Ca2+and Mg2+ions. The EMBL European bioinformatic database annotates ChaB proteins found within group II (Baculoviridae, Fig. 4) as putative DNA binding proteins. Interestingly, the σ-factor domains that are structurally similar to ChaB are known to bind DNA at the position equivalent to helix α3 in ChaB. However, the composition of the corresponding loop in sigma factors is more hydrophobic and/or shorter than in ChaB. Members of the ChaB sequences belonging to group I (Fig. 4) are annotated as cation transport regulators based on being part of the ChaA operon. The alignment results suggest that the loop 2 region, which is only observed in the group I family of ChaB, is correlated to its function as a cation transport regulator protein. Clearly, further experiments are required to test this hypothesis.

Conclusion
As part of the E. coli structural genomics project, we report the first 3D structure of a member from the ChaB protein family. E. coli ChaB is a putative cation transport regulator protein whose structure resembles the cyclin-box fold. ChaB was shown to have weak affinity for calcium and magnesium ions at a highly charged and mobile loop that is only present in ChaB family members associated with a cation transporter. We hypothesise that this loop may play a role in the function of ChaB as a regulator of cation transport.

Methods
Cloning, expression and purification of ChaB
The gene encoding full length ChaB (residues 1–76) was amplified from genomic E. coli DNA strain O157:H7 using oligos OPI403 AAAAAAGGATCCCCGTATAAAACGAAAAGCGACCTG and OPI499 AAAAAAGAATTCTTACGATTTTTTATGCCATTTATCATCA. Underlined are restriction sites BamHI and EcoRI for both oligos, respectively. The product was cloned into the BamHI/EcoRI site of pFO-1. The plasmid pFO-1 is a tailored pET-15b vector (Novagen Inc., Madison, WI), which contains an extended poly-linker region and an 8× N-terminal histidine tag with a modified thrombin cleavage site.

The ChaB construct (plasmid ID: pPI489) was expressed in E. coli BL21-Gold (DE3) cells (Stratagene) as an 8× His-tagged fusion protein. At an OD600 of 0.8, the cells were induced with 1 mM IPTG and grown for another 3 hours at 30°C. The protein was purified to homogeneity by absorption onto a Ni2+ charged chelating sepharose column (Amersham Biosciences) under native conditions. The recombinant protein used for NMR studies consists of the ChaB sequence with an extra 21 residues (MGSSHHHHHHHHSSGFNPRGS) at the N-terminus containing the 8× His-tag and a thrombin cleavage site. This tag replaced the first residue, a methionine, of the genomic sequence of ChaB. In the analysis vide ante ChaB refers to residues P22-S96 of our construct (i.e. the wild type ChaB sequence excluding the first Met residue). Thus, ChaB begins at P22 in our numbering scheme, corresponding to P2 in the native ChaB sequence. The mass of ChaB was confirmed by SDS-PAGE and electrospray mass spectroscopy.

NMR Spectroscopy
Uniform enrichment of ChaB with 15N and/or 13C was achieved by growing the bacteria in M9 minimal medium supplemented with BME vitamins (SIGMA) and (15NH4)2SO4 and/or 13C6-glucose as the sole nitrogen and carbon sources at 37°C. ChaB was purified as described above. NMR samples were obtained by exchanging ChaB into an NMR buffer comprising 50 mM CaCl2 at pH 6.3 using a PD-10 column and subsequent concentration to ~200–300 μL using an Amicon Ultra-4 (5 KDa cutoff, Millipore). Typical protein concentrations ranged from 1.5–2.0 mM.

NMR spectra for resonance assignments were recorded at 303 K on a Bruker Avance DRX 600 MHz spectrometer equipped with a triple-resonance CryoProbe and processed with NMRPipe [21]. Backbone 1H, 13C and 15N assignments were completed from CBCA(CO)NH, CBCANH and HBHA(CBCACO)NH spectra using a combination of NMRView [22] and SMARTNOTEBOOK (a module designed for semi-automated assignment in NMRView) [23] packages. 1H, 13C and 15N sidechain assignments were obtained by manual analysis of the H(CC)(CO)NH, C(C)(CO)NH and HCCH-TOCSY experiments using NMRView and in-house written scripts. 1H, 13C and 15N chemical shifts were referenced to DSS according to the IUPAC recommendation [24].

Distance constraints were obtained from a simultaneous 3D 13C/15N-edited NOESY experiment (τm= 120 ms) in 90% H2O/10% D2O, and 13C-edited NOESY (τm = 100 ms) and 13C-edited NOESY (aromatic region) (τm = 100 ms) experiments acquired in 99.9% D2O. The experiments in D2O were acquired at 800 MHz on a Varian INOVA spectrometer at NANUC). A 4D 13C-13C edited NOESY experiment (τm = 100 ms) was acquired at 600 MHz to resolve ambiguities involving methyl groups. For all experiments at 600 MHz, the minimal number of scans dictated by the phase cycle was used in combination extensive folding in 15N and 13C to reduce experimentation time. Additional restraints used in structure calculations were: dihedral restraints, derived from 3JHN-Cα coupling constants obtained from the HNHA experiment [25] and 1H-15N residual dipolar couplings extracted from comparison of IPAP-HSQC experiments recorded on ChaB with and without 11 mg/mL Pf1 phage [26]. For the measurement of dipolar couplings, the NMR buffer was altered to 50 mM phosphate and 100 mM NaCl, pH 6.3 since the presence of CaCl2 precipitated the Pf1 phage.

Steady state {1H}-15N NOE spectra were acquired in an interleaved manner in which each individual FID was collected with and without presaturation and a recycle delay of 4 s [27]. Saturation was achieved using a train of 120° pulses separated by 5 ms for a total irradiation time of 3 s.

Structure calculations
A set of unambiguous NOE constraints were extracted from the 3D-NOESY spectra and used in conjunction with dihedral angle restraints to generate a preliminary fold of ChaB using CNS1.1 [28]. The resulting structures were used as model templates for automated assignment of NOE peaks using the ARIA 1.1 package [29]. In many cases, the 4D 13C-13C NOESY experiment was important for manually assigning a number of ambiguous assignments. A total of 1794 unambiguous and 346 ambiguous NOE restraints were obtained from this method and used in combination with dihedral restraints to calculate an ensemble of ChaB structures using CNS [28]. These structures were further refined using residual dipolar coupling restraints. The axial and rhombic components of the alignment tensor were obtained from the histogram method [30] and optimized by a grid search [31] and determined to be Da = 13.7 and R = 0.325. Only residues exhibiting a heteronuclear NOE > 0.65 were included as residual dipolar couplings. Seventeen lowest energy structures with the fewest violations were selected to represent the ChaB structure. No NOE violations over 0.2Å were observed. Structural statistics for this ensemble as calculated by CNS [28], PROCHECK [32] and SSIA [33] are summarised in Table 1. The coordinates have been deposited in the RCSB under PDB code 1SG7.

Titration with calcium and magnesium
The effect of calcium on ChaB was determined from addition of aliquots of 5 M CaCl2 or 2 M MgCl2 to 15N labeled ChaB. Prior to titration, metal impurities were removed by addition of EDTA to the ChaB sample followed by exchange into 20 mM Bis-Tris buffer, pH 6.3 using a PD-10 column. Aliquots of CaCl2 or MgCl2 were added up to a final concentration of 50 mM. Minimal changes in pH and volume were ensured throughout. Chemical shift perturbations were measured as a weighted vector sum of the 1H and 15N chemical deviations: {[(Δ1H ppm)2 + (Δ15N ppm × 0.2)2]0.5}.

List of abbreviations
NMR: nuclear magnetic resonance NOE: nuclear Overhauser enhancement HSQC: heteronuclear single quantum coherence PPM: parts per million RMSD: root mean squared deviation PDB: Protein Data Bank

Authors' contributions
MJO expressed and purified isoptically enriched ChaB, collected all NMR spectra at 600 MHz, processed and analyzed NMR data, performed structural calculations and structural refinement. NS identified ChaB among a series of E. coli proteins cloned as part of the structural genomics initiative. PI completed the initial cloning of chaB. NS expressed, purified and characterized ChaB by mass spectrometry. MJO drafted and NS contributed to the written manuscript. KG coordinated and provided financial support for this study.

Acknowledgements
The Montreal-Kingston Bacterial Structural Genomics Initiative supported this work under a Canadian Institute of Health Research (CIHR) grant to KG. We would like to acknowledge the Canadian National High Field NMR Center (NANUC) for their assistance and use of their facilities. CIHR, the Natural Science and Engineering Council of Canada (NSERC) and the University of Alberta fund the operation of NANUC.
==== Refs
Ambudkar SV Rosen BP  Bacterial Energetics 1990 XII 
Padan E Gerchman Y Rimon A Rothman A Dover N Carmel-Harel O  The molecular mechanism of regulation of the NhaA Na+/H+ antiporter of Escherichia coli, a key transporter in the adaptation to Na+ and H+ Novartis Found Symp 1999 221 183 196 discussion 196–189 10207920 
Padan E Schuldiner S  Na+/H+ antiporters, molecular devices that couple the Na+ and H+ circulation in cells J Bioenerg Biomembr 1993 25 647 669 8144493 
Padan E Schuldiner S  Molecular physiology of Na+/H+ antiporters, key transporters in circulation of Na+ and H+ in cells Biochim Biophys Acta 1994 1185 129 151 8167133 10.1016/0005-2728(94)90204-6 
Padan E Venturi M Gerchman Y Dover N  Na(+)/H(+) antiporters Biochim Biophys Acta 2001 1505 144 157 11248196 10.1016/S0005-2728(00)00284-X 
Sakuma T Yamada N Saito H Kakegawa T Kobayashi H  pH dependence of the function of sodium ion extrusion systems in Escherichia coli Biochim Biophys Acta 1998 1363 231 237 9518629 10.1016/S0005-2728(97)00102-3 
Boot IR Cash P O'Byrne C  Sensing and adapting to acid stress Antonie Van Leeuwenhoek 2002 81 33 42 12448703 10.1023/A:1020565206835 
Konings WN Albers SV Koning S Driessen AJ  The cell membrane plays a crucial role in survival of bacteria and archaea in extreme environments Antonie Van Leeuwenhoek 2002 81 61 72 12448706 10.1023/A:1020573408652 
Kobayashi H Saito H Kakegawa T  Bacterial strategies to inhabit acidic environments J Gen Appl Microbiol 2000 46 235 243 12483574 
Shijuku T Yamashino T Ohashi H Saito H Kakegawa T Ohta M Kobayashi H  Expression of chaA, a sodium ion extrusion system of Escherichia coli, is regulated by osmolarity and pH Biochim Biophys Acta 2002 1556 142 148 12460671 
Ivey DM Guffanti AA Zemsky J Pinner E Karpel R Padan E Schuldiner S Krulwich TA  Cloning and characterization of a putative Ca2+/H+ antiporter gene from Escherichia coli upon functional complementation of Na+/H+ antiporter-deficient strains by the overexpressed gene J Biol Chem 1993 268 11296 11303 8496184 
Oshima T Aiba H Baba T Fujita K Hayashi K Honjo A Ikemoto K Inada T Itoh T Kajihara M  A 718-kb DNA sequence of the Escherichia coli K-12 genome corresponding to the 12.7–28.0 min region on the linkage map (supplement) DNA Res 1996 3 211 223 8905239 
Holm L Sander C  Dali: a network tool for protein structure comparison Trends Biochem Sci 1995 20 478 480 8578593 10.1016/S0968-0004(00)89105-7 
Malhotra A Severinova E Darst SA  Crystal structure of a sigma 70 subunit fragment from E. coli RNA polymerase Cell 1996 87 127 136 8858155 10.1016/S0092-8674(00)81329-X 
Li W Stevenson CE Burton N Jakimowicz P Paget MS Buttner MJ Lawson DM Kleanthous C  Identification and structure of the anti-sigma factor-binding domain of the disulphide-stress regulated sigma factor sigma(R) from Streptomyces coelicolor J Mol Biol 2002 323 225 236 12381317 10.1016/S0022-2836(02)00948-8 
Burgess RR Travers AA Dunn JJ Bautz EK  Factor stimulating transcription by RNA polymerase Nature 1969 221 43 46 4882047 
Travers AA Burgessrr   Cyclic re-use of the RNA polymerase sigma factor Nature 1969 222 537 540 5781654 
Noble ME Endicott JA Brown NR Johnson LN  The cyclin box fold: protein recognition in cell-cycle and transcription control Trends Biochem Sci 1997 22 482 487 9433129 10.1016/S0968-0004(97)01144-4 
Skelton NJ Kordel J Forsen S Chazin WJ  Comparative structural analysis of the calcium free and bound states of the calcium regulatory protein calbindin D9K J Mol Biol 1990 213 593 598 2359115 
Skelton NJ Kordel J Akke M Chazin WJ  Nuclear magnetic resonance studies of the internal dynamics in Apo, (Cd2+)1 and (Ca2+)2 calbindin D9k. The rates of amide proton exchange with solvent J Mol Biol 1992 227 1100 1117 1331470 
Delaglio F Grzesiek S Vuister GW Zhu G Pfeifer J Bax A  NMRPipe: a multidimensional spectral processing system based on UNIX pipes J Biomol NMR 1995 6 277 293 8520220 
Johnson BA Blevins RA  NMRView: A computer program for the visualization and analysis of NMR data Journal of Biomolecular NMR 1994 4 603 614 
Slupsky CM Boyko RF Booth VK Sykes BD  Smartnotebook: a semiautomated approach to protein sequential NMR resonance assignments J Biomol NMR 2003 27 313 321 14512729 10.1023/A:1025870122182 
Markely JL Bax A Arata Y Hilbers CW Kaptein R Sykes BD Wright PE Wutrich K  Recommendations for the presentaion of NMR structures of proteins and nucleic acids Pure & Applied Chemistry 1998 70 117 142 
Kuboniwa H Grzesiek S Delaglio F Bax A  Measurement of HN-H alpha J couplings in calcium-free calmodulin using new 2D and 3D water-flip-back methods J Biomol NMR 1994 4 871 878 7812158 
Ottiger M Bax A  Characterization of magnetically oriented phospholipid micelles for measurement of dipolar couplings in macromolecules J Biomol NMR 1998 12 361 372 9835045 10.1023/A:1008366116644 
Farrow NA Muhandiram R Singer AU Pascal SM Kay CM Gish G Shoelson SE Pawson T Forman-Kay JD Kay LE  Backbone dynamics of a free and phosphopeptide-complexed Src homology 2 domain studied by 15 N NMR relaxation Biochemistry 1994 33 5984 6003 7514039 
Brunger AT Adams PD Clore GM DeLano WL Gros P Grosse-Kunstleve RW Jiang JS Kuszewski J Nilges M Pannu NS  Crystallography & NMR system: A new software suite for macromolecular structure determination Acta Crystallogr D Biol Crystallogr 1998 54 905 921 9757107 10.1107/S0907444998003254 
Nilges M Macias MJ O'Donoghue SI Oschkinat H  Automated NOESY interpretation with ambiguous distance restraints: the refined NMR solution structure of the pleckstrin homology domain from beta-spectrin J Mol Biol 1997 269 408 422 9199409 10.1006/jmbi.1997.1044 
Clore GM Gronenborn AM Bax A  A robust method for determining the magnitude of the fully asymmetric alignment tensor of oriented macromolecules in the absence of structural information J Magn Reson 1998 133 216 221 9654491 10.1006/jmre.1998.1419 
Clore GM Gronenborn AM Tjandra N  Direct structure refinement against residual dipolar couplings in the presence of rhombicity of unknown magnitude J Magn Reson 1998 131 159 162 9533920 10.1006/jmre.1997.1345 
Laskowski RA Rullmannn JA MacArthur MW Kaptein R Thornton JM  AQUA and PROCHECK-NMR: programs for checking the quality of protein structures solved by NMR J Biomol NMR 1996 8 477 486 9008363 
Zweckstetter M Bax A  Prediction of sterically induced alignment in a dilute liquid crystalline phase: aid to protein strucutre determination by NMR Journal of the American Chemical Society 2000 122 3791 2792 10.1021/ja0000908 
Bateman A Birney E Cerruti L Durbin R Etwiller L Eddy SR Griffiths-Jones S Howe KL Marshall M Sonnhammer EL  The Pfam protein families database Nucleic Acids Res 2002 30 276 280 11752314 10.1093/nar/30.1.276 
Koradi R Billeter M Wuthrich K  MOLMOL: a program for display and analysis of macromolecular structures J Mol Graph 1996 14 51 55 29–32 8744573 10.1016/0263-7855(96)00009-4

