PMID- 10572182
OWN - NLM
STAT- MEDLINE
DCOM- 20000125
LR  - 20190501
IS  - 1362-4962 (Electronic)
IS  - 0305-1048 (Linking)
VI  - 27
IP  - 24
DP  - 1999 Dec 15
TI  - Isolation and characterization of a gene encoding human Kruppel-like factor 5
      (IKLF): binding to the CAAT/GT box of the mouse lactoferrin gene promoter.
PG  - 4807-15
AB  - The mouse lactoferrin gene promoter includes a CAAT/GT box,
      GGGCAATAGGGTGGGGCCAGCCC, which functions as the epidermal growth factor response 
      element (EGFRE) in human endometrial carcinoma RL95-2 cells (RL95). A positive
      clone, EGFREB, of 2575 bp length, was isolated from an expression library of RL95
      cells with a multimer of the EGFRE sequence. In this work, we have identified
      that EGFREB encodes the C-terminus of Kruppel-like factor 5 (KLF5). This mRNA is 
      most abundant in human colon and small intestine. A full-length cDNA clone was
      isolated from a human colon library using EGFREB as the hybridization probe. The 
      full-length cDNA consists of 3336 bp with a 302 bp 5'-UTR, a 1663 bp 3'-UTR, and 
      a 1371 bp sequence coding for a 457 amino acid polypeptide. Based on its tissue
      distribution and sequence homology to the mouse IKLF, we renamed this protein
      IKLF. DNase I footprinting and electrophoresis mobility shift assay confirmed the
      binding of IKLF to the EGFRE. The human IKLF gene spans >20 kb in length and is
      organized into four exons, whose intron/exon junctions follow the GT/AG rule. The
      three zinc fingers are encoded by three exons. Nuclear localization of IKLF was
      demonstrated by green fluorescence protein (GFP)-tagged IKLF in transfection
      experiments and western analysis. Overexpression of IKLF in RL95 cells represses 
      the activity of reporter constructs containing the CAAT/GT box of the mouse
      lactoferrin gene. These findings imply that IKLF is a nuclear transcription
      factor that binds to the CAAT/GT box, and functions as a modulator of the mouse
      lacto-ferrin gene promoter activity.
FAU - Shi, H
AU  - Shi H
AD  - Gene Regulation Group, Laboratory of Reproductive and Development Toxicology,
      National Institute of Environmental Health Sciences, National Institutes of
      Health, Research Triangle Park, NC 27709, USA.
FAU - Zhang, Z
AU  - Zhang Z
FAU - Wang, X
AU  - Wang X
FAU - Liu, S
AU  - Liu S
FAU - Teng, C T
AU  - Teng CT
LA  - eng
SI  - GENBANK/AF132818
PT  - Journal Article
PL  - England
TA  - Nucleic Acids Res
JT  - Nucleic acids research
JID - 0411011
RN  - 0 (5' Untranslated Regions)
RN  - 0 (KLF5 protein, human)
RN  - 0 (Klf5 protein, mouse)
RN  - 0 (Kruppel-Like Transcription Factors)
RN  - 0 (RNA, Messenger)
RN  - 0 (Recombinant Proteins)
RN  - 0 (Trans-Activators)
RN  - EC 3.4.21.- (Lactoferrin)
SB  - IM
MH  - 5' Untranslated Regions/genetics
MH  - Amino Acid Sequence
MH  - Animals
MH  - Base Sequence
MH  - Binding Sites
MH  - Cloning, Molecular
MH  - Colon/metabolism
MH  - Endometrial Neoplasms
MH  - Exons
MH  - Female
MH  - Gene Expression Regulation, Neoplastic
MH  - Gene Library
MH  - Humans
MH  - Intestine, Small/metabolism
MH  - Introns
MH  - Kruppel-Like Transcription Factors
MH  - Lactoferrin/*genetics
MH  - Mice
MH  - Molecular Sequence Data
MH  - RNA, Messenger/genetics
MH  - Recombinant Proteins/biosynthesis/chemistry
MH  - Sequence Alignment
MH  - Sequence Homology, Amino Acid
MH  - Sequence Homology, Nucleic Acid
MH  - Trans-Activators/chemistry/*genetics/*metabolism
MH  - Transcription, Genetic
MH  - Tumor Cells, Cultured
MH  - Zinc Fingers
PMC - PMC148782
EDAT- 1999/11/26 00:00
MHDA- 1999/11/26 00:01
CRDT- 1999/11/26 00:00
PHST- 1999/11/26 00:00 [pubmed]
PHST- 1999/11/26 00:01 [medline]
PHST- 1999/11/26 00:00 [entrez]
AID - gkc683 [pii]
AID - 10.1093/nar/27.24.4807 [doi]
PST - ppublish
SO  - Nucleic Acids Res. 1999 Dec 15;27(24):4807-15. doi: 10.1093/nar/27.24.4807.