PMID- 10527846
OWN - NLM
STAT- MEDLINE
DCOM- 19991112
LR  - 20081121
IS  - 0006-291X (Print)
IS  - 0006-291X (Linking)
VI  - 264
IP  - 1
DP  - 1999 Oct 14
TI  - Molecular cloning of a human MafF homologue, which specifically binds to the
      oxytocin receptor gene in term myometrium.
PG  - 86-92
AB  - The US-2 DNA-binding element (ggaatgattactcagctaga) in the promoter of the human 
      oxytocin receptor (OTR) gene has been shown to bind specifically nuclear proteins
      from human myometrium at parturition. To elucidate the molecular mechanisms
      involved in OTR gene upregulation at term, the US-2 element was used in a yeast
      one-hybrid system to screen a cDNA library derived from term human myometrium.
      Positive clones were further screened by electrophoretic mobility shift assay for
      their ability to bind the human OTR gene promoter, containing the US-2 motif. A
      2.3-kb full-length cDNA encoding a human homologue of chicken MafF (hMafF) was
      isolated. hMafF represents an 18-kDa protein and contains an extended leucine
      zipper structure, but lacks a transactivation domain. Furthermore, Northern
      hybridization showed strong hMafF mRNA expression in the kidney and in term
      myometrium only, but not in nonpregnant myometrium. The hMafF protein is also
      preferentially expressed in term myometrium, as shown by specific binding to the 
      OTR promoter. The highly specific binding of hMafF to the US-2 motif in the human
      OTR gene, together with its pattern of expression, supports a role for hMafF in
      OTR gene upregulation at term.
CI  - Copyright 1999 Academic Press.
FAU - Kimura, T
AU  - Kimura T
AD  - Faculty of Medicine, Osaka University, 2-2, Yamadaoka, Suita, Osaka, 5650871,
      Japan. tadashi@gyne.med.osaka-u.ac.jp
FAU - Ivell, R
AU  - Ivell R
FAU - Rust, W
AU  - Rust W
FAU - Mizumoto, Y
AU  - Mizumoto Y
FAU - Ogita, K
AU  - Ogita K
FAU - Kusui, C
AU  - Kusui C
FAU - Matsumura, Y
AU  - Matsumura Y
FAU - Azuma, C
AU  - Azuma C
FAU - Murata, Y
AU  - Murata Y
LA  - eng
SI  - GENBANK/AB025247
PT  - Journal Article
PT  - Research Support, Non-U.S. Gov't
PL  - United States
TA  - Biochem Biophys Res Commun
JT  - Biochemical and biophysical research communications
JID - 0372516
RN  - 0 (Avian Proteins)
RN  - 0 (DNA, Complementary)
RN  - 0 (DNA-Binding Proteins)
RN  - 0 (MAFF protein, Gallus gallus)
RN  - 0 (MAFF protein, human)
RN  - 0 (MafF Transcription Factor)
RN  - 0 (Nuclear Proteins)
RN  - 0 (Receptors, Oxytocin)
SB  - IM
MH  - Amino Acid Sequence
MH  - *Avian Proteins
MH  - Base Sequence
MH  - Cloning, Molecular
MH  - DNA, Complementary/analysis
MH  - DNA-Binding Proteins/metabolism
MH  - Enhancer Elements, Genetic/physiology
MH  - Female
MH  - Gene Expression Regulation
MH  - Humans
MH  - MafF Transcription Factor
MH  - Molecular Sequence Data
MH  - Myometrium/*metabolism
MH  - Nuclear Proteins/*genetics/metabolism
MH  - Pregnancy
MH  - Receptors, Oxytocin/*genetics
MH  - Sequence Homology, Amino Acid
MH  - Up-Regulation
EDAT- 1999/10/21 00:00
MHDA- 1999/10/21 00:01
CRDT- 1999/10/21 00:00
PHST- 1999/10/21 00:00 [pubmed]
PHST- 1999/10/21 00:01 [medline]
PHST- 1999/10/21 00:00 [entrez]
AID - 10.1006/bbrc.1999.1487 [doi]
AID - S0006-291X(99)91487-0 [pii]
PST - ppublish
SO  - Biochem Biophys Res Commun. 1999 Oct 14;264(1):86-92. doi:
      10.1006/bbrc.1999.1487.